The Exomiser - A Tool to Annotate and Prioritise Whole-Exome Sequencing Data

Exomiser Analysis Results for Anonymous

Analysis Settings

Settings used for this analysis:

---
sample:
  genomeAssembly: "hg19"
  vcf: "/exomiser/challenge02.vcf.gz"
  hpoIds:
  - "HP:0001156"
  - "HP:0001363"
  - "HP:0011304"
  - "HP:0010055"
  pedigree: {}
  age: {}
analysis:
  inheritanceModes:
    AUTOSOMAL_RECESSIVE_COMP_HET: 2.0
    MITOCHONDRIAL: 0.2
    AUTOSOMAL_RECESSIVE_HOM_ALT: 0.1
    X_DOMINANT: 0.1
    AUTOSOMAL_DOMINANT: 0.1
    X_RECESSIVE_COMP_HET: 2.0
    X_RECESSIVE_HOM_ALT: 0.1
  frequencySources:
  - "THOUSAND_GENOMES"
  - "TOPMED"
  - "UK10K"
  - "ESP_AFRICAN_AMERICAN"
  - "ESP_EUROPEAN_AMERICAN"
  - "ESP_ALL"
  - "EXAC_AFRICAN_INC_AFRICAN_AMERICAN"
  - "EXAC_AMERICAN"
  - "EXAC_EAST_ASIAN"
  - "EXAC_FINNISH"
  - "EXAC_NON_FINNISH_EUROPEAN"
  - "EXAC_OTHER"
  - "EXAC_SOUTH_ASIAN"
  - "GNOMAD_E_AFR"
  - "GNOMAD_E_AMR"
  - "GNOMAD_E_EAS"
  - "GNOMAD_E_FIN"
  - "GNOMAD_E_NFE"
  - "GNOMAD_E_OTH"
  - "GNOMAD_E_SAS"
  - "GNOMAD_G_AFR"
  - "GNOMAD_G_AMR"
  - "GNOMAD_G_EAS"
  - "GNOMAD_G_FIN"
  - "GNOMAD_G_NFE"
  - "GNOMAD_G_OTH"
  - "GNOMAD_G_SAS"
  pathogenicitySources:
  - "POLYPHEN"
  - "MUTATION_TASTER"
  - "SIFT"
  steps:
  - variantEffectFilter:
      remove:
      - "CODING_TRANSCRIPT_INTRON_VARIANT"
      - "FIVE_PRIME_UTR_EXON_VARIANT"
      - "THREE_PRIME_UTR_EXON_VARIANT"
      - "FIVE_PRIME_UTR_INTRON_VARIANT"
      - "THREE_PRIME_UTR_INTRON_VARIANT"
      - "NON_CODING_TRANSCRIPT_EXON_VARIANT"
      - "NON_CODING_TRANSCRIPT_INTRON_VARIANT"
      - "UPSTREAM_GENE_VARIANT"
      - "DOWNSTREAM_GENE_VARIANT"
      - "INTERGENIC_VARIANT"
      - "REGULATORY_REGION_VARIANT"
  - frequencyFilter:
      maxFrequency: 2.0
  - pathogenicityFilter:
      keepNonPathogenic: true
  - inheritanceFilter: {}
  - omimPrioritiser: {}
  - hiPhivePrioritiser:
      runParams: "human, mouse, fish, ppi"
outputOptions:
  outputPrefix: "results/Pfeiffer-hiphive-exome-PASS_ONLY"
  outputFormats:
  - "HTML"
  - "VCF"
  - "TSV_GENE"
  - "TSV_VARIANT"
  - "JSON"

Filtering Summary

Filter	Report	Passed filter
Variant effect	Removed variants with effects of type: [CODING_TRANSCRIPT_INTRON_VARIANT, FIVE_PRIME_UTR_EXON_VARIANT, THREE_PRIME_UTR_EXON_VARIANT, FIVE_PRIME_UTR_INTRON_VARIANT, THREE_PRIME_UTR_INTRON_VARIANT, NON_CODING_TRANSCRIPT_EXON_VARIANT, NON_CODING_TRANSCRIPT_INTRON_VARIANT, UPSTREAM_GENE_VARIANT, DOWNSTREAM_GENE_VARIANT, INTERGENIC_VARIANT, REGULATORY_REGION_VARIANT]	1081
Frequency	Variants filtered for maximum allele frequency of 2.00%	1081
Pathogenicity	Retained all non-pathogenic variants of all types. Scoring was applied, but the filter passed all variants.	1081
Inheritance	Genes filtered for compatibility with AUTOSOMAL_DOMINANT, AUTOSOMAL_RECESSIVE, X_RECESSIVE, X_DOMINANT, MITOCHONDRIAL inheritance.	418

Variant Type Distribution

Variant Type	sample
FRAMESHIFT_ELONGATION	16
FRAMESHIFT_TRUNCATION	16
FRAMESHIFT_VARIANT	11
INTERNAL_FEATURE_ELONGATION	0
FEATURE_TRUNCATION	0
MNV	0
STOP_GAINED	19
STOP_LOST	1
START_LOST	1
SPLICE_ACCEPTOR_VARIANT	8
SPLICE_DONOR_VARIANT	11
MISSENSE_VARIANT	602
INFRAME_INSERTION	6
DISRUPTIVE_INFRAME_INSERTION	11
INFRAME_DELETION	6
DISRUPTIVE_INFRAME_DELETION	9
FIVE_PRIME_UTR_TRUNCATION	0
THREE_PRIME_UTR_TRUNCATION	0
SPLICE_REGION_VARIANT	86
STOP_RETAINED_VARIANT	0
INITIATOR_CODON_VARIANT	0
SYNONYMOUS_VARIANT	278
CODING_TRANSCRIPT_INTRON_VARIANT	0
THREE_PRIME_UTR_EXON_VARIANT	0
FIVE_PRIME_UTR_INTRON_VARIANT	0
THREE_PRIME_UTR_INTRON_VARIANT	0
NON_CODING_TRANSCRIPT_EXON_VARIANT	0
NON_CODING_TRANSCRIPT_INTRON_VARIANT	0
UPSTREAM_GENE_VARIANT	0
DOWNSTREAM_GENE_VARIANT	0
INTERGENIC_VARIANT	0
REGULATORY_REGION_VARIANT	0

Prioritised Genes

Exomiser Score: 0.984

Phenotype Score: 0.869

Variant Score: 0.910

Phenotype matches:

Phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with BCORL1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.501 in interactome to HDAC4 and phenotypic similarity 0.656 to 2q37 microdeletion syndrome associated with HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.501 in interactome to HDAC4 and phenotypic similarity 0.934 to mouse mutant of HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0001363, Craniosynostosis - MP:0030356, premature lambdoid suture closure; HP:0011304, Broad thumb - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0010055, Broad hallux - MP:0000165, abnormal long bone hypertrophic chondrocyte zone

Proximity score 0.501 in interactome to HDAC4 and phenotypic similarity 0.614 to fish mutant of HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0107238, anguloarticular premature ossification, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:301029 Shukla-Vernon syndrome - X-linked recessive; ORPHA:528084 Non-specific syndromic intellectual disability - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.984

Phenotype Score: 0.869

Variant Score: 0.910

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.869 to ORPHA:528084 Non-specific syndromic intellectual disability
Phenotypic similarity 0.432 to OMIM:301029 Shukla-Vernon syndrome

Variants contributing to score:

MISSENSE_VARIANT SNV X-129162702-G-A [0/1] rs199973665

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]

Variant score: 0.910 CONTRIBUTING VARIANT

Transcripts:: BCORL1:ENST00000218147.7:c.4171G>A:p.(Gly1391Arg); BCORL1:ENST00000303743.5:c.4171G>A:p.(Gly1391Arg); BCORL1:ENST00000359304.2:c.3781G>A:p.(Gly1261Arg); BCORL1:ENST00000540052.1:c.4171G>A:p.(Gly1391Arg)

Pathogenicity Data:: Best Score: 0.996; Mutation Taster: 0.865; SIFT: 0.004 (D)

Frequency Data:: 1000Genomes: 0.0530%; TOPMed: 0.0302%; ExAC EAS: 0.3767%; gnomAD_E_EAS: 0.4429%; gnomAD_G_EAS: 0.4936%

Exomiser Score: 0.974

Phenotype Score: 0.744

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.744 to mouse mutant involving CPLANE2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0002639, micrognathia; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Proximity score 0.539 in interactome to FUZ and phenotypic similarity 0.251 to Caudal regression sequence associated with FUZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0000921, Missing ribs; HP:0010055, Broad hallux - HP:0001762, Talipes equinovarus

Proximity score 0.539 in interactome to FUZ and phenotypic similarity 0.752 to mouse mutant of FUZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0001293, anophthalmia; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.974

Phenotype Score: 0.744

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-16560112-G-C [0/1] rs1557558792

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CPLANE2:ENST00000375599.3:c.260C>G:p.(Thr87Ser)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.367 (B); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.971

Phenotype Score: 0.734

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.734 to mouse mutant involving BAIAP2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000565, oligodactyly; HP:0001363, Craniosynostosis - MP:0000079, abnormal basioccipital bone morphology; HP:0011304, Broad thumb - MP:0000565, oligodactyly; HP:0010055, Broad hallux - MP:0000565, oligodactyly

Proximity score 0.501 in interactome to ACTB and phenotypic similarity 0.706 to Baraitser-Winter cerebrofrontofacial syndrome associated with ACTB.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009942, Duplication of thumb phalanx; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0009942, Duplication of thumb phalanx; HP:0010055, Broad hallux - HP:0009942, Duplication of thumb phalanx

Proximity score 0.501 in interactome to ACTB and phenotypic similarity 0.239 to mouse mutant of ACTB.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004527, abnormal outer hair cell stereociliary bundle morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.971

Phenotype Score: 0.734

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-79082790-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: BAIAP2:ENST00000321280.7:c.1558A>G:p.(Thr520Ala); BAIAP2:ENST00000321300.6:c.1535+481A>G:p.(=); BAIAP2:ENST00000392411.3:c.1301+481A>G:p.(=); BAIAP2:ENST00000428708.2:c.1535+481A>G:p.(=); BAIAP2:ENST00000435091.3:c.1535+481A>G:p.(=); BAIAP2:ENST00000575245.1:c.1634+481A>G:p.(=); BAIAP2:ENST00000575712.1:c.*477A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.971 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.935

Phenotype Score: 0.652

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.479 to Primary ciliary dyskinesia associated with HYDIN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Phenotypic similarity 0.652 to mouse mutant involving HYDIN.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.502 in interactome to IFT80 and phenotypic similarity 0.662 to Jeune syndrome associated with IFT80.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.502 in interactome to IFT80 and phenotypic similarity 0.702 to mouse mutant of IFT80.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

Known diseases:: OMIM:608647 Ciliary dyskinesia, primary, 5 - autosomal recessive; ORPHA:244 Primary ciliary dyskinesia - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.935

Phenotype Score: 0.652

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.479 to ORPHA:244 Primary ciliary dyskinesia

Variants contributing to score:

FRAMESHIFT_VARIANT DEL 16-70896015-GA-G [0/1] rs11337008

Exomiser ACMG: PATHOGENIC [PVS1, PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: HYDIN:ENST00000393567.2:c.11712del:p.(Ile3904Ilefs*6)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

STOP_LOST SNV 16-71061495-A-G [0/1] rs1022220

Exomiser ACMG: PATHOGENIC [PVS1, PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: HYDIN:ENST00000321489.5:c.3052T>C:p.(*1018Glnext*11); HYDIN:ENST00000448691.1:c.3052T>C:p.(*1018Glnext*11); HYDIN:ENST00000393567.2:c.3042+10T>C:p.(=); HYDIN:ENST00000448089.2:c.3042+10T>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.328

Phenotype Score: 0.326

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_VARIANT DEL 16-70896015-GA-G [0/1] rs11337008

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: HYDIN:ENST00000393567.2:c.11712del:p.(Ile3904Ilefs*6)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 16-71098649-T-C [0/1] rs3817211

Variant score: 1.000

Transcripts:: HYDIN:ENST00000321489.5:c.2170A>G:p.(Asn724Asp); HYDIN:ENST00000393567.2:c.2170A>G:p.(Asn724Asp); HYDIN:ENST00000448089.2:c.2170A>G:p.(Asn724Asp); HYDIN:ENST00000448691.1:c.2170A>G:p.(Asn724Asp); HYDIN:ENST00000538248.1:c.2251A>G:p.(Asn751Asp); HYDIN:ENST00000541601.1:c.2221A>G:p.(Asn741Asp)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 0.971 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-71122408-C-T [0/1] rs62040318

Variant score: 1.000

Transcripts:: HYDIN:ENST00000288168.10:c.1517G>A:p.(Gly506Asp); HYDIN:ENST00000321489.5:c.1466G>A:p.(Gly489Asp); HYDIN:ENST00000393550.2:c.1466G>A:p.(Gly489Asp); HYDIN:ENST00000393567.2:c.1466G>A:p.(Gly489Asp); HYDIN:ENST00000448089.2:c.1466G>A:p.(Gly489Asp); HYDIN:ENST00000448691.1:c.1466G>A:p.(Gly489Asp); HYDIN:ENST00000538248.1:c.1547G>A:p.(Gly516Asp); HYDIN:ENST00000541601.1:c.1517G>A:p.(Gly506Asp)

Pathogenicity Data:: Best Score: 0.999923; Polyphen2: 0.995 (D); Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70926334-G-C [0/1] rs1774423

Variant score: 0.996

Transcripts:: HYDIN:ENST00000393567.2:c.9347C>G:p.(Thr3116Arg)

Pathogenicity Data:: Best Score: 0.996; Mutation Taster: 0.597; SIFT: 0.004 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70896033-C-T [0/1] rs1626593

Variant score: 0.994

Transcripts:: HYDIN:ENST00000393567.2:c.11695G>A:p.(Val3899Met)

Pathogenicity Data:: Best Score: 0.995; SIFT: 0.005 (D)

Frequency Data:: gnomAD_E_SAS: 0.0065%

MISSENSE_VARIANT SNV 16-70917855-A-G [0/1] rs1774331

Variant score: 0.994

Transcripts:: HYDIN:ENST00000393567.2:c.9947T>C:p.(Leu3316Pro)

Pathogenicity Data:: Best Score: 0.994072; Mutation Taster: 0.994 (P); SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70972620-G-C [0/1] rs1774360

Variant score: 0.983

Transcripts:: HYDIN:ENST00000393567.2:c.6892C>G:p.(Arg2298Gly)

Pathogenicity Data:: Best Score: 0.983; Mutation Taster: 0.954 (P); SIFT: 0.017 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70989335-G-A [0/1] rs1774541

Variant score: 0.982

Transcripts:: HYDIN:ENST00000393567.2:c.6259C>T:p.(Arg2087Cys)

Pathogenicity Data:: Best Score: 0.99982; Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0151%; gnomAD_E_EAS: 0.0232%; gnomAD_G_EAS: 0.1235%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 16-70884524-C-G [0/1] rs1798314

Variant score: 0.971

Transcripts:: HYDIN:ENST00000393567.2:c.12478G>C:p.(Glu4160Gln)

Pathogenicity Data:: Best Score: 0.971; SIFT: 0.029 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70902559-C-T [0/1] rs1798413

Variant score: 0.944

Transcripts:: HYDIN:ENST00000393567.2:c.11224G>A:p.(Val3742Ile)

Pathogenicity Data:: Best Score: 0.944; SIFT: 0.056 (D)

Frequency Data:: No frequency data

INFRAME_DELETION DEL 16-70954703-GGCGCTCCTTCTCCGT-G [0/1] rs67115747

Variant score: 0.850

Transcripts:: HYDIN:ENST00000393567.2:c.7561_7575del:p.(Thr2521_Arg2525del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70894087-T-C [0/1] rs1539302

Variant score: 0.849

Transcripts:: HYDIN:ENST00000393567.2:c.12013A>G:p.(Thr4005Ala)

Pathogenicity Data:: Best Score: 0.949; Mutation Taster: 0.937; SIFT: 0.051 (D)

Frequency Data:: gnomAD_E_AMR: 0.0032%; gnomAD_E_NFE: 0.0009%; gnomAD_G_AFR: 0.3475%; gnomAD_G_AMR: 0.4587%; gnomAD_G_EAS: 0.0714%; gnomAD_G_FIN: 0.5756%; gnomAD_G_NFE: 0.1181%; gnomAD_G_OTH: 0.3788%

MISSENSE_VARIANT SNV 16-71101200-T-C [0/1] rs10744982

Variant score: 0.824

Transcripts:: HYDIN:ENST00000288168.10:c.2119A>G:p.(Thr707Ala); HYDIN:ENST00000321489.5:c.2068A>G:p.(Thr690Ala); HYDIN:ENST00000393550.2:c.2113A>G:p.(Thr705Ala); HYDIN:ENST00000393567.2:c.2068A>G:p.(Thr690Ala); HYDIN:ENST00000448089.2:c.2068A>G:p.(Thr690Ala); HYDIN:ENST00000448691.1:c.2068A>G:p.(Thr690Ala); HYDIN:ENST00000538248.1:c.2149A>G:p.(Thr717Ala); HYDIN:ENST00000541601.1:c.2119A>G:p.(Thr707Ala)

Pathogenicity Data:: Best Score: 0.967; Polyphen2: 0.491 (P); Mutation Taster: 0.947 (P); SIFT: 0.033 (D)

Frequency Data:: gnomAD_E_AFR: 0.1663%; gnomAD_E_AMR: 0.0756%; gnomAD_E_EAS: 0.0945%; gnomAD_E_NFE: 0.0289%; gnomAD_E_OTH: 0.0554%; gnomAD_E_SAS: 0.0328%; gnomAD_G_AFR: 0.7378%; gnomAD_G_EAS: 0.3708%; gnomAD_G_FIN: 0.2583%; gnomAD_G_NFE: 0.3007%; gnomAD_G_OTH: 0.3074%

SPLICE_REGION_VARIANT SNV 16-70913501-T-C [0/1] rs1774325

Variant score: 0.800

Transcripts:: HYDIN:ENST00000393567.2:c.10367+7A>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 16-71015290-C-G [0/1] rs2669067

Variant score: 0.800

Transcripts:: HYDIN:ENST00000393567.2:c.4510+4G>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 16-71113780-C-T [0/1] rs1512612

Variant score: 0.800

Transcripts:: HYDIN:ENST00000288168.10:c.1789+8G>A:p.?; HYDIN:ENST00000321489.5:c.1738+8G>A:p.?; HYDIN:ENST00000393550.2:c.1738+8G>A:p.?; HYDIN:ENST00000393567.2:c.1738+8G>A:p.?; HYDIN:ENST00000448089.2:c.1738+8G>A:p.?; HYDIN:ENST00000448691.1:c.1738+8G>A:p.?; HYDIN:ENST00000538248.1:c.1819+8G>A:p.?; HYDIN:ENST00000541601.1:c.1789+8G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 16-70891778-C-G [0/1] rs1774417

Variant score: 0.795

Transcripts:: HYDIN:ENST00000393567.2:c.12130-5G>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.0470%

MISSENSE_VARIANT SNV 16-71054178-T-C [0/1] rs6416709

Variant score: 0.755

Transcripts:: HYDIN:ENST00000393567.2:c.3229A>G:p.(Ile1077Val); HYDIN:ENST00000448089.2:c.3085A>G:p.(Ile1029Val)

Pathogenicity Data:: Best Score: 0.759; SIFT: 0.241 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; gnomAD_E_AMR: 0.0152%; gnomAD_E_NFE: 0.0036%; gnomAD_E_SAS: 0.0033%

MISSENSE_VARIANT SNV 16-70954945-T-A [0/1] rs1798532

Variant score: 0.682

Transcripts:: HYDIN:ENST00000393567.2:c.7334A>T:p.(Asn2445Ile)

Pathogenicity Data:: Best Score: 0.68200004; SIFT: 0.318 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70897039-C-G [0/1] rs1798325

Variant score: 0.641

Transcripts:: HYDIN:ENST00000393567.2:c.11518G>C:p.(Val3840Leu)

Pathogenicity Data:: Best Score: 0.64100003; SIFT: 0.359 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70896122-A-C [0/1] rs7192347

Variant score: 0.613

Transcripts:: HYDIN:ENST00000393567.2:c.11606T>G:p.(Met3869Arg)

Pathogenicity Data:: Best Score: 0.61399996; SIFT: 0.386 (T)

Frequency Data:: gnomAD_G_AFR: 0.0115%

MISSENSE_VARIANT SNV 16-70954691-T-C [0/1] rs1798528

Variant score: 0.567

Transcripts:: HYDIN:ENST00000393567.2:c.7588A>G:p.(Lys2530Glu)

Pathogenicity Data:: Best Score: 0.56700003; SIFT: 0.433 (T)

Frequency Data:: TOPMed: 0.0004%

MISSENSE_VARIANT SNV 16-70902568-C-T [0/1] rs1774504

Variant score: 0.528

Transcripts:: HYDIN:ENST00000393567.2:c.11215G>A:p.(Ala3739Thr)

Pathogenicity Data:: Best Score: 0.528; SIFT: 0.472 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70954513-T-C [0/1] rs1774395

Variant score: 0.510

Transcripts:: HYDIN:ENST00000393567.2:c.7766A>G:p.(Lys2589Arg)

Pathogenicity Data:: Best Score: 0.51; SIFT: 0.490 (T)

Frequency Data:: TOPMed: 0.0008%

MISSENSE_VARIANT SNV 16-70954571-C-T [0/1] rs8044001

Variant score: 0.464

Transcripts:: HYDIN:ENST00000393567.2:c.7708G>A:p.(Asp2570Asn)

Pathogenicity Data:: Best Score: 0.464; SIFT: 0.536 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70989299-C-T [0/1] rs1798337

Variant score: 0.312

Transcripts:: HYDIN:ENST00000393567.2:c.6295G>A:p.(Val2099Met)

Pathogenicity Data:: Best Score: 0.31199998; SIFT: 0.688 (T)

Frequency Data:: TOPMed: 0.0032%

MISSENSE_VARIANT SNV 16-70954606-C-T [0/1] rs8044142

Variant score: 0.182

Transcripts:: HYDIN:ENST00000393567.2:c.7673G>A:p.(Gly2558Glu)

Pathogenicity Data:: Best Score: 0.18199998; SIFT: 0.818 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70942688-A-C [0/1] rs1774449

Variant score: 0.143

Transcripts:: HYDIN:ENST00000393567.2:c.8081T>G:p.(Ile2694Ser)

Pathogenicity Data:: Best Score: 0.143; SIFT: 0.857 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70954774-A-G [0/1] rs1798529

Variant score: 0.105

Transcripts:: HYDIN:ENST00000393567.2:c.7505T>C:p.(Leu2502Ser)

Pathogenicity Data:: Best Score: 0.10500002; SIFT: 0.895 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70894024-C-T [0/1] rs11075798

Variant score: 0.103

Transcripts:: HYDIN:ENST00000393567.2:c.12076G>A:p.(Ala4026Thr)

Pathogenicity Data:: Best Score: 0.102999985; SIFT: 0.897 (T)

Frequency Data:: gnomAD_G_AFR: 0.0129%; gnomAD_G_NFE: 0.0068%

SYNONYMOUS_VARIANT SNV 16-70884534-T-A [0/1] rs1798315

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.12468A>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70896118-A-G [0/1] rs1774421

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.11610T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70908239-G-A [0/1] rs1774311

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.10917C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70908736-A-G [0/1] rs1354550

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.10644T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70913386-G-A [0/1] rs1774323

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.10371C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70934994-C-T [0/1] rs2502696

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.8961G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70954572-T-A [0/1] rs8045289

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.7707A>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70954809-C-A [0/1] rs1798530

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.7470G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-70986480-G-A [0/1] rs2458386

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.6375C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-71008169-T-C [0/1] rs1774293

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.4944A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 16-71101270-C-T [0/1] rs10735134

Variant score: 0.100

Transcripts:: HYDIN:ENST00000288168.10:c.2049G>A:p.(=); HYDIN:ENST00000321489.5:c.1998G>A:p.(=); HYDIN:ENST00000393550.2:c.2043G>A:p.(=); HYDIN:ENST00000393567.2:c.1998G>A:p.(=); HYDIN:ENST00000448089.2:c.1998G>A:p.(=); HYDIN:ENST00000448691.1:c.1998G>A:p.(=); HYDIN:ENST00000538248.1:c.2079G>A:p.(=); HYDIN:ENST00000541601.1:c.2049G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0033%

SYNONYMOUS_VARIANT SNV 16-70889147-A-G [0/1] rs2502698

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.100

Transcripts:: HYDIN:ENST00000393567.2:c.12327T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0094%; gnomAD_E_EAS: 0.0060%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0189%; gnomAD_E_SAS: 0.0033%; gnomAD_G_NFE: 0.0139%

SYNONYMOUS_VARIANT SNV 16-71094434-G-A [0/1] rs2271453

Variant score: 0.099

Transcripts:: HYDIN:ENST00000321489.5:c.2502C>T:p.(=); HYDIN:ENST00000393567.2:c.2502C>T:p.(=); HYDIN:ENST00000448089.2:c.2502C>T:p.(=); HYDIN:ENST00000448691.1:c.2502C>T:p.(=); HYDIN:ENST00000538248.1:c.2583C>T:p.(=); HYDIN:ENST00000541601.1:c.2553C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_NFE: 0.0076%; gnomAD_E_OTH: 0.0591%; gnomAD_E_SAS: 0.0143%; gnomAD_G_NFE: 0.0070%

SYNONYMOUS_VARIANT SNV 16-71026098-C-T [0/1] rs704641

Variant score: 0.098

Transcripts:: HYDIN:ENST00000393567.2:c.3660G>A:p.(=); HYDIN:ENST00000448089.2:c.3516G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; ExAC AFR: 0.1134%; ExAC EAS: 0.0234%; ExAC NFE: 0.0031%; gnomAD_E_AFR: 0.0683%; gnomAD_E_EAS: 0.0130%; gnomAD_E_FIN: 0.0049%; gnomAD_E_NFE: 0.0061%; gnomAD_G_AFR: 0.0475%; gnomAD_G_FIN: 0.0288%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 16-70902683-G-A [0/1] rs2502690

Variant score: 0.098

Transcripts:: HYDIN:ENST00000393567.2:c.11100C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.1179%; gnomAD_E_AMR: 0.0060%; gnomAD_G_AFR: 0.0803%

SYNONYMOUS_VARIANT SNV 16-71025245-C-T [0/1] rs1774516

Variant score: 0.098

Transcripts:: HYDIN:ENST00000393567.2:c.3840G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_FIN: 0.0046%; gnomAD_E_NFE: 0.0054%; gnomAD_G_AFR: 0.0508%; gnomAD_G_AMR: 0.1330%; gnomAD_G_EAS: 0.1439%; gnomAD_G_NFE: 0.0437%

SYNONYMOUS_VARIANT SNV 16-71163579-C-T [0/1] rs929311

Variant score: 0.095

Transcripts:: HYDIN:ENST00000288168.10:c.1242G>A:p.(=); HYDIN:ENST00000321489.5:c.1191G>A:p.(=); HYDIN:ENST00000393550.2:c.1191G>A:p.(=); HYDIN:ENST00000393567.2:c.1191G>A:p.(=); HYDIN:ENST00000448089.2:c.1191G>A:p.(=); HYDIN:ENST00000448691.1:c.1191G>A:p.(=); HYDIN:ENST00000538248.1:c.1272G>A:p.(=); HYDIN:ENST00000541601.1:c.1242G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0186%; gnomAD_E_EAS: 0.0060%; gnomAD_E_FIN: 0.0092%; gnomAD_E_NFE: 0.0083%; gnomAD_E_OTH: 0.0191%; gnomAD_E_SAS: 0.0138%; gnomAD_G_AFR: 0.0991%; gnomAD_G_EAS: 0.1418%; gnomAD_G_NFE: 0.0508%; gnomAD_G_OTH: 0.3326%

SYNONYMOUS_VARIANT SNV 16-71103269-T-C [0/1] rs1398391

Variant score: 0.093

Transcripts:: HYDIN:ENST00000288168.10:c.1926A>G:p.(=); HYDIN:ENST00000321489.5:c.1875A>G:p.(=); HYDIN:ENST00000393550.2:c.1920A>G:p.(=); HYDIN:ENST00000393567.2:c.1875A>G:p.(=); HYDIN:ENST00000448089.2:c.1875A>G:p.(=); HYDIN:ENST00000448691.1:c.1875A>G:p.(=); HYDIN:ENST00000538248.1:c.1956A>G:p.(=); HYDIN:ENST00000541601.1:c.1926A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.3211%; gnomAD_G_EAS: 0.4255%

MISSENSE_VARIANT SNV 16-71026076-C-G [0/1] rs1774513

Variant score: 0.046

Transcripts:: HYDIN:ENST00000393567.2:c.3682G>C:p.(Val1228Leu); HYDIN:ENST00000448089.2:c.3538G>C:p.(Val1180Leu)

Pathogenicity Data:: Best Score: 0.046000004; SIFT: 0.954 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70917931-C-G [0/1] rs1798440

Variant score: 0.000

Transcripts:: HYDIN:ENST00000393567.2:c.9871G>C:p.(Ala3291Pro)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70975565-T-C [0/1] rs1815707

Variant score: 0.000

Transcripts:: HYDIN:ENST00000393567.2:c.6827A>G:p.(Gln2276Arg)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 16-70975667-T-C [0/1] rs2258307

Variant score: 0.000

Transcripts:: HYDIN:ENST00000393567.2:c.6725A>G:p.(Gln2242Arg)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: gnomAD_E_AFR: 0.2650%; gnomAD_E_AMR: 0.3918%; gnomAD_E_EAS: 0.7308%; gnomAD_E_FIN: 0.0046%; gnomAD_E_NFE: 0.1732%; gnomAD_E_OTH: 0.3832%; gnomAD_E_SAS: 0.2220%; gnomAD_G_AFR: 0.0494%; gnomAD_G_AMR: 0.1316%; gnomAD_G_FIN: 0.0307%; gnomAD_G_NFE: 0.0215%

Exomiser Score: 0.925

Phenotype Score: 0.637

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.637 to mouse mutant involving PKD1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003409, decreased width of hypertrophic chondrocyte zone; HP:0001363, Craniosynostosis - MP:0003420, delayed intramembranous bone ossification; HP:0011304, Broad thumb - MP:0003409, decreased width of hypertrophic chondrocyte zone; HP:0010055, Broad hallux - MP:0003409, decreased width of hypertrophic chondrocyte zone

Proximity score 0.508 in interactome to IFT88 and phenotypic similarity 0.814 to mouse mutant of IFT88.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0003840, abnormal coronal suture morphology; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005104, abnormal tarsal bone morphology

Known diseases:: OMIM:173900 Polycystic kidney disease 1 - autosomal dominant; ORPHA:730 Autosomal dominant polycystic kidney disease - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.925

Phenotype Score: 0.637

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-2156949-C-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: PKD1:ENST00000262304.4:c.7066G>T:p.(Val2356Leu); PKD1:ENST00000423118.1:c.7066G>T:p.(Val2356Leu)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.996 (D); Mutation Taster: 1.000 (P); SIFT: 0.017 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.923

Phenotype Score: 0.638

Variant Score: 0.996

Phenotype matches:

Phenotypic similarity 0.638 to Erythrokeratodermia variabilis associated with GJB4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to GJB3 and phenotypic similarity 0.638 to Erythrokeratodermia variabilis associated with GJB3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Known diseases:: OMIM:617524 Erythrokeratodermia variabilis et progressiva 2 - autosomal dominant; ORPHA:317 Erythrokeratodermia variabilis - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.923

Phenotype Score: 0.638

Variant Score: 0.996

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.638 to ORPHA:317 Erythrokeratodermia variabilis
Phenotypic similarity 0.175 to OMIM:617524 Erythrokeratodermia variabilis et progressiva 2

Variants contributing to score:

MISSENSE_VARIANT SNV 1-35227528-C-T [0/1] rs758125233

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: GJB4:ENST00000339480.1:c.673C>T:p.(Arg225Trp)

Pathogenicity Data:: Best Score: 0.997; Polyphen2: 0.394 (B); SIFT: 0.003 (D)

Frequency Data:: TOPMed: 0.0004%; ExAC SAS: 0.0061%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.861

Phenotype Score: 0.570

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.570 to Kleefstra syndrome due to a point mutation associated with KMT2C.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001182, Tapered finger; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0001182, Tapered finger

Phenotypic similarity 0.268 to mouse mutant involving KMT2C.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001290, delayed eyelid opening; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.535 in interactome to KDM4B and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with KDM4B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Known diseases:: OMIM:617768 Kleefstra syndrome 2 - autosomal dominant; ORPHA:261652 Kleefstra syndrome due to a point mutation - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.861

Phenotype Score: 0.570

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.570 to ORPHA:261652 Kleefstra syndrome due to a point mutation
Phenotypic similarity 0.426 to OMIM:617768 Kleefstra syndrome 2

Variants contributing to score:

STOP_GAINED SNV 7-151927023-G-C [0/1] rs58528565

Exomiser ACMG: PATHOGENIC [PVS1, PM2]

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KMT2C:ENST00000262189.6:c.2961C>G:p.(Tyr987*); KMT2C:ENST00000355193.2:c.2961C>G:p.(Tyr987*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.210

Phenotype Score: 0.268

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

STOP_GAINED SNV 7-151927023-G-C [0/1] rs58528565

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KMT2C:ENST00000262189.6:c.2961C>G:p.(Tyr987*); KMT2C:ENST00000355193.2:c.2961C>G:p.(Tyr987*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 7-151935871-C-A [0/1] rs111493987

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KMT2C:ENST00000262189.6:c.2573G>T:p.(Trp858Leu); KMT2C:ENST00000355193.2:c.2573G>T:p.(Trp858Leu)

Pathogenicity Data:: Best Score: 0.999989; Polyphen2: 0.996 (D); Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 7-151935799-A-G [0/1] rs199839047

Variant score: 0.999

Transcripts:: KMT2C:ENST00000262189.6:c.2645T>C:p.(Ile882Thr); KMT2C:ENST00000355193.2:c.2645T>C:p.(Ile882Thr)

Pathogenicity Data:: Best Score: 0.999337; Polyphen2: 0.796 (P); Mutation Taster: 0.999 (P); SIFT: 0.001 (D)

Frequency Data:: TOPMed: 0.0004%

MISSENSE_VARIANT SNV 7-151927067-T-C [0/1] rs60244562

Variant score: 0.994

Transcripts:: KMT2C:ENST00000262189.6:c.2917A>G:p.(Arg973Gly); KMT2C:ENST00000355193.2:c.2917A>G:p.(Arg973Gly)

Pathogenicity Data:: Best Score: 0.994; Polyphen2: 0.994 (D); Mutation Taster: 0.986 (P); SIFT: 0.023 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 7-151935866-G-A [0/1] rs112515611

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.978

Transcripts:: KMT2C:ENST00000262189.6:c.2578C>T:p.(Pro860Ser); KMT2C:ENST00000355193.2:c.2578C>T:p.(Pro860Ser)

Pathogenicity Data:: Best Score: 0.977932; Polyphen2: 0.131 (B); Mutation Taster: 0.978 (P); SIFT: 0.031 (D)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 7-151935798-G-T [0/1] rs201452267

Variant score: 0.100

Transcripts:: KMT2C:ENST00000262189.6:c.2646C>A:p.(=); KMT2C:ENST00000355193.2:c.2646C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.848

Phenotype Score: 0.737

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.709 to Short-rib thoracic dysplasia 9 with or without polydactyly associated with IFT140.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009803, Short phalanx of finger; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger; HP:0010055, Broad hallux - HP:0009803, Short phalanx of finger

Phenotypic similarity 0.737 to mouse mutant involving IFT140.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Proximity score 0.524 in interactome to IFT43 and phenotypic similarity 0.729 to Cranioectodermal dysplasia associated with IFT43.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0008388, Abnormal toenail morphology

Known diseases:: OMIM:266920 Short-rib thoracic dysplasia 9 with or without polydactyly - autosomal recessive; OMIM:617781 Retinitis pigmentosa 80 - autosomal recessive; ORPHA:474 Jeune syndrome - autosomal recessive; ORPHA:65 Leber congenital amaurosis - autosomal dominant/recessive; ORPHA:791 Retinitis pigmentosa - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.848

Phenotype Score: 0.737

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 16-1630850-C-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: IFT140:ENST00000426508.2:c.1434G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.847

Phenotype Score: 0.737

Variant Score: 0.799

Phenotype matches:

Phenotypic similarity 0.737 to Intellectual disability-craniofacial dysmorphism-cryptorchidism syndrome associated with PACS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001238, Slender finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0001238, Slender finger

Known diseases:: OMIM:615009 Schuurs-Hoeijmakers syndrome - autosomal dominant; ORPHA:329224 Intellectual disability-craniofacial dysmorphism-cryptorchidism syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.847

Phenotype Score: 0.737

Variant Score: 0.799

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.737 to ORPHA:329224 Intellectual disability-craniofacial dysmorphism-cryptorchidism syndrome
Phenotypic similarity 0.352 to OMIM:615009 Schuurs-Hoeijmakers syndrome

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 11-65983585-C-T [0/1] rs79265330

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4]

Variant score: 0.799 CONTRIBUTING VARIANT

Transcripts:: PACS1:ENST00000320580.4:c.661-5C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_EAS: 0.0116%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.841

Phenotype Score: 0.555

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.539 to Van Maldergem syndrome 1 associated with DCHS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0030084, Clinodactyly; HP:0001363, Craniosynostosis - HP:0010537, Wide cranial sutures; HP:0011304, Broad thumb - HP:0010554, Cutaneous finger syndactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Phenotypic similarity 0.555 to mouse mutant involving DCHS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0012279, wide sternum; HP:0001363, Craniosynostosis - MP:0008272, abnormal endochondral bone ossification; HP:0011304, Broad thumb - MP:0012279, wide sternum; HP:0010055, Broad hallux - MP:0012279, wide sternum

Proximity score 0.501 in interactome to FAT4 and phenotypic similarity 0.739 to Hennekam syndrome associated with FAT4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0006101, Finger syndactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0006101, Finger syndactyly

Proximity score 0.501 in interactome to FAT4 and phenotypic similarity 0.553 to mouse mutant of FAT4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0012279, wide sternum; HP:0001363, Craniosynostosis - MP:0008272, abnormal endochondral bone ossification; HP:0011304, Broad thumb - MP:0012279, wide sternum; HP:0010055, Broad hallux - MP:0012279, wide sternum

Known diseases:: OMIM:601390 Van Maldergem syndrome 1 - autosomal recessive; OMIM:607829 Mitral valve prolapse 2 - autosomal dominant; ORPHA:314679 Cerebrofacioarticular syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.841

Phenotype Score: 0.555

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-6644241-C-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: DCHS1:ENST00000299441.3:c.8666G>C:p.(Arg2889Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.968 (D); Mutation Taster: 1.000 (P); SIFT: 0.018 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.832

Phenotype Score: 0.555

Variant Score: 0.993

Phenotype matches:

Proximity score 0.555 in interactome to GATAD2B and phenotypic similarity 0.745 to Severe intellectual disability-poor language-strabismus-grimacing face-long fingers syndrome associated with GATAD2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010511, Long toe; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger; HP:0010055, Broad hallux - HP:0010511, Long toe

Proximity score 0.555 in interactome to GATAD2B and phenotypic similarity 0.252 to mouse mutant of GATAD2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.832

Phenotype Score: 0.555

Variant Score: 0.993

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-126678112-T-C [0/1] rs201769282

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.993 CONTRIBUTING VARIANT

Transcripts:: CTBP2:ENST00000309035.6:c.2933A>G:p.(Asn978Ser); CTBP2:ENST00000334808.6:c.1517A>G:p.(Asn506Ser); CTBP2:ENST00000337195.5:c.1313A>G:p.(Asn438Ser); CTBP2:ENST00000411419.2:c.1313A>G:p.(Asn438Ser); CTBP2:ENST00000494626.2:c.1313A>G:p.(Asn438Ser); CTBP2:ENST00000531469.1:c.1313A>G:p.(Asn438Ser)

Pathogenicity Data:: Best Score: 0.994; Polyphen2: 0.406 (B); SIFT: 0.006 (D)

Frequency Data:: gnomAD_E_EAS: 0.0058%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.076

Phenotype Score: 0.555

Variant Score: 0.547

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-126678112-T-C [0/1] rs201769282

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.993 CONTRIBUTING VARIANT

Transcripts:: CTBP2:ENST00000309035.6:c.2933A>G:p.(Asn978Ser); CTBP2:ENST00000334808.6:c.1517A>G:p.(Asn506Ser); CTBP2:ENST00000337195.5:c.1313A>G:p.(Asn438Ser); CTBP2:ENST00000411419.2:c.1313A>G:p.(Asn438Ser); CTBP2:ENST00000494626.2:c.1313A>G:p.(Asn438Ser); CTBP2:ENST00000531469.1:c.1313A>G:p.(Asn438Ser)

Pathogenicity Data:: Best Score: 0.994; Polyphen2: 0.406 (B); SIFT: 0.006 (D)

Frequency Data:: gnomAD_E_EAS: 0.0058%

SYNONYMOUS_VARIANT SNV 10-126678102-G-A [0/1] rs75408575

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CTBP2:ENST00000309035.6:c.2943C>T:p.(=); CTBP2:ENST00000334808.6:c.1527C>T:p.(=); CTBP2:ENST00000337195.5:c.1323C>T:p.(=); CTBP2:ENST00000411419.2:c.1323C>T:p.(=); CTBP2:ENST00000494626.2:c.1323C>T:p.(=); CTBP2:ENST00000531469.1:c.1323C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.823

Phenotype Score: 0.712

Variant Score: 0.809

Phenotype matches:

Phenotypic similarity 0.712 to Trichothiodystrophy associated with RNF113A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Phenotypic similarity 0.262 to mouse mutant involving RNF113A.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to SNIP1 and phenotypic similarity 0.761 to Psychomotor retardation, epilepsy, and craniofacial dysmorphism associated with SNIP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001182, Tapered finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0001182, Tapered finger

Proximity score 0.500 in interactome to SNIP1 and phenotypic similarity 0.262 to mouse mutant of SNIP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0006241, abnormal placement of pupils; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:300953 Trichothiodystrophy 5, nonphotosensitive - X-linked dominant; ORPHA:33364 Trichothiodystrophy - X-linked dominant

Gene scores under compatible inheritance modes:

X_DOMINANT

Exomiser Score: 0.823

Phenotype Score: 0.712

Variant Score: 0.809

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.712 to ORPHA:33364 Trichothiodystrophy

Variants contributing to score:

MISSENSE_VARIANT SNV X-119005311-T-C [0/1] rs1393093562

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4, BP4]

Variant score: 0.809 CONTRIBUTING VARIANT

Transcripts:: RNF113A:ENST00000371442.2:c.266A>G:p.(Glu89Gly)

Pathogenicity Data:: Best Score: 0.809; Polyphen2: 0.002 (B); SIFT: 0.191 (T)

Frequency Data:: TOPMed: 0.0008%

X_RECESSIVE

Exomiser Score: 0.037

Phenotype Score: 0.250

Variant Score: 0.809

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-119005311-T-C [0/1] rs1393093562

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.809 CONTRIBUTING VARIANT

Transcripts:: RNF113A:ENST00000371442.2:c.266A>G:p.(Glu89Gly)

Pathogenicity Data:: Best Score: 0.809; Polyphen2: 0.002 (B); SIFT: 0.191 (T)

Frequency Data:: TOPMed: 0.0008%

Exomiser Score: 0.812

Phenotype Score: 0.536

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.384 to mouse mutant involving TDG.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006279, abnormal limb development; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0006279, abnormal limb development; HP:0010055, Broad hallux - MP:0006279, abnormal limb development

Proximity score 0.536 in interactome to MBD4 and phenotypic similarity 0.772 to mouse mutant of MBD4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004083, polysyndactyly; HP:0001363, Craniosynostosis - MP:0001286, abnormal eye development; HP:0011304, Broad thumb - MP:0005230, ectrodactyly; HP:0010055, Broad hallux - MP:0005230, ectrodactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.812

Phenotype Score: 0.536

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT INS 12-104378698-G-GAGGATGCAAAGAAGATGGCTGTTAAGGAA [0/1] rs764159587

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TDG:ENST00000266775.9:c.952_952+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?; TDG:ENST00000392872.3:c.964_964+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?; TDG:ENST00000542036.1:c.352_352+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?; TDG:ENST00000544861.1:c.535_535+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.806

Phenotype Score: 0.536

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT INS 12-104378698-G-GAGGATGCAAAGAAGATGGCTGTTAAGGAA [0/1] rs764159587

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TDG:ENST00000266775.9:c.952_952+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?; TDG:ENST00000392872.3:c.964_964+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?; TDG:ENST00000542036.1:c.352_352+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?; TDG:ENST00000544861.1:c.535_535+1insAGGATGCAAAGAAGATGGCTGTTAAGGAA:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_DONOR_VARIANT INS 12-104379508-T-TGGAGTTAAGAGGAGAATC [0/1] rs749286024

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: TDG:ENST00000266775.9:c.1078+2_1078+3insGGAGTTAAGAGGAGAATC:p.?; TDG:ENST00000392872.3:c.1090+2_1090+3insGGAGTTAAGAGGAGAATC:p.?; TDG:ENST00000542036.1:c.478+2_478+3insGGAGTTAAGAGGAGAATC:p.?; TDG:ENST00000544861.1:c.661+2_661+3insGGAGTTAAGAGGAGAATC:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0067%; gnomAD_E_AMR: 0.0032%; gnomAD_E_FIN: 0.0232%; gnomAD_E_NFE: 0.0224%; gnomAD_E_OTH: 0.0194%; gnomAD_E_SAS: 0.0645%

Other passed variants:

SYNONYMOUS_VARIANT SNV 12-104380766-C-T [0/1] rs142826846

Variant score: 0.095

Transcripts:: TDG:ENST00000266775.9:c.1119C>T:p.(=); TDG:ENST00000392872.3:c.1131C>T:p.(=); TDG:ENST00000542036.1:c.519C>T:p.(=); TDG:ENST00000544861.1:c.702C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0799%; ExAC EAS: 0.1387%; gnomAD_E_EAS: 0.1276%; gnomAD_G_EAS: 0.3083%

Exomiser Score: 0.809

Phenotype Score: 0.534

Variant Score: 1.000

Phenotype matches:

Proximity score 0.534 in interactome to ALX4 and phenotypic similarity 0.839 to Enlarged parietal foramina associated with ALX4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0011304, Broad thumb; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0011304, Broad thumb

Proximity score 0.534 in interactome to ALX4 and phenotypic similarity 0.775 to mouse mutant of ALX4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0000109, abnormal parietal bone morphology; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Known diseases:: OMIM:617039 Patent ductus arteriosus 3 - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.809

Phenotype Score: 0.534

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-122495312-G-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: PRDM6:ENST00000407847.4:c.1133G>A:p.(Cys378Tyr)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.737 (P); Mutation Taster: 1.000 (P); SIFT: 0.079 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.805

Phenotype Score: 0.533

Variant Score: 0.998

Phenotype matches:

Phenotypic similarity 0.334 to Autosomal dominant hypohidrotic ectodermal dysplasia associated with TRAF6.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001231, Abnormal fingernail morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001231, Abnormal fingernail morphology; HP:0010055, Broad hallux - HP:0001231, Abnormal fingernail morphology

Phenotypic similarity 0.533 to mouse mutant involving TRAF6.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000133, abnormal long bone metaphysis morphology; HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density; HP:0011304, Broad thumb - MP:0000133, abnormal long bone metaphysis morphology; HP:0010055, Broad hallux - MP:0000133, abnormal long bone metaphysis morphology

Proximity score 0.533 in interactome to DYNC2I2 and phenotypic similarity 0.662 to Jeune syndrome associated with DYNC2I2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.533 in interactome to DYNC2I2 and phenotypic similarity 0.699 to mouse mutant of DYNC2I2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0001297, microphthalmia; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Known diseases:: ORPHA:1810 Autosomal dominant hypohidrotic ectodermal dysplasia - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.805

Phenotype Score: 0.533

Variant Score: 0.998

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.334 to ORPHA:1810 Autosomal dominant hypohidrotic ectodermal dysplasia

Variants contributing to score:

MISSENSE_VARIANT SNV 11-36511736-T-C [0/1] rs1299539710

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: TRAF6:ENST00000348124.5:c.1221A>G:p.(Ile407Met); TRAF6:ENST00000526995.1:c.1221A>G:p.(Ile407Met)

Pathogenicity Data:: Best Score: 0.999982; Polyphen2: 0.831 (P); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0004%; gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.785

Phenotype Score: 0.520

Variant Score: 1.000

Phenotype matches:

Proximity score 0.520 in interactome to MAP3K20 and phenotypic similarity 0.382 to Split-foot malformation with mesoaxial polydactyly associated with MAP3K20.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0012725, Cutaneous syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0012725, Cutaneous syndactyly; HP:0010055, Broad hallux - HP:0012725, Cutaneous syndactyly

Proximity score 0.520 in interactome to MAP3K20 and phenotypic similarity 0.723 to mouse mutant of MAP3K20.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.785

Phenotype Score: 0.520

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-14551121-C-T [0/1] rs1347176681

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: PKN1:ENST00000342216.4:c.19C>T:p.(Pro7Ser); PKN1:ENST00000242783.6:c.22-834C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.986 (D); Mutation Taster: 1.000 (P); SIFT: 0.129 (T)

Frequency Data:: gnomAD_E_NFE: 0.0022%

Exomiser Score: 0.778

Phenotype Score: 0.629

Variant Score: 0.871

Phenotype matches:

Phenotypic similarity 0.629 to mouse mutant involving PRKRA.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to TNRC6B and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with TNRC6B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Known diseases:: OMIM:612067 Dystonia 16 - autosomal recessive; ORPHA:210571 Dystonia 16 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.778

Phenotype Score: 0.629

Variant Score: 0.871

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-179306420-A-G [0/1] rs201959988

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: PRKRA:ENST00000325748.4:c.526T>C:p.(Ser176Pro); PRKRA:ENST00000432031.2:c.493T>C:p.(Ser165Pro); PRKRA:ENST00000438687.3:c.187T>C:p.(Ser63Pro); PRKRA:ENST00000487082.1:c.451T>C:p.(Ser151Pro)

Pathogenicity Data:: Best Score: 0.999994; Polyphen2: 0.936 (P); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: gnomAD_E_EAS: 0.0058%

MISSENSE_VARIANT SNV 2-179309165-G-A [0/1] rs75862065

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3, BP6]

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.743 CONTRIBUTING VARIANT

Transcripts:: PRKRA:ENST00000325748.4:c.380C>T:p.(Pro127Leu); PRKRA:ENST00000432031.2:c.347C>T:p.(Pro116Leu); PRKRA:ENST00000438687.3:c.41C>T:p.(Pro14Leu); PRKRA:ENST00000487082.1:c.305C>T:p.(Pro102Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.993 (D); Mutation Taster: 1.000 (P); SIFT: 0.008 (D)

Frequency Data:: gnomAD_E_AFR: 0.2121%; gnomAD_E_AMR: 1.0638%; gnomAD_E_EAS: 0.5170%; gnomAD_E_FIN: 0.3058%; gnomAD_E_NFE: 0.5882%; gnomAD_E_OTH: 0.6875%; gnomAD_E_SAS: 0.5048%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.301

Phenotype Score: 0.315

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-179306420-A-G [0/1] rs201959988

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: PRKRA:ENST00000325748.4:c.526T>C:p.(Ser176Pro); PRKRA:ENST00000432031.2:c.493T>C:p.(Ser165Pro); PRKRA:ENST00000438687.3:c.187T>C:p.(Ser63Pro); PRKRA:ENST00000487082.1:c.451T>C:p.(Ser151Pro)

Pathogenicity Data:: Best Score: 0.999994; Polyphen2: 0.936 (P); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.773

Phenotype Score: 0.513

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.340 to Immunodeficiency 10 associated with STIM1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002164, Nail dysplasia; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0002164, Nail dysplasia; HP:0010055, Broad hallux - HP:0002164, Nail dysplasia

Phenotypic similarity 0.320 to mouse mutant involving STIM1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.513 in interactome to ASPH and phenotypic similarity 0.737 to mouse mutant of ASPH.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

Known diseases:: OMIM:160565 Myopathy, tubular aggregate, 1 - autosomal dominant; OMIM:185070 Stormorken syndrome - autosomal dominant; OMIM:612783 Immunodeficiency 10 - autosomal recessive; ORPHA:2593 Tubular aggregate myopathy - autosomal dominant; ORPHA:3204 Stormorken-Sjaastad-Langslet syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.773

Phenotype Score: 0.513

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.158 to OMIM:160565 Myopathy, tubular aggregate, 1

Variants contributing to score:

MISSENSE_VARIANT SNV 11-4080605-G-A [0/1] rs752494097

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: STIM1:ENST00000300737.4:c.592G>A:p.(Val198Met); STIM1:ENST00000527651.1:c.592G>A:p.(Val198Met); STIM1:ENST00000533977.1:c.73G>A:p.(Val25Met)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.843 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.764

Phenotype Score: 0.508

Variant Score: 1.000

Phenotype matches:

Proximity score 0.508 in interactome to APC2 and phenotypic similarity 0.717 to Sotos syndrome associated with APC2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0005617, Bilateral camptodactyly; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.764

Phenotype Score: 0.508

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-45214523-A-C [0/1] rs62075617

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CDC27:ENST00000066544.3:c.1908T>G:p.(Asn636Lys); CDC27:ENST00000446365.2:c.1725T>G:p.(Asn575Lys); CDC27:ENST00000527547.1:c.1905T>G:p.(Asn635Lys); CDC27:ENST00000531206.1:c.1926T>G:p.(Asn642Lys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.521 (P); Mutation Taster: 1.000 (P); SIFT: 0.055 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.764

Phenotype Score: 0.508

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-45214523-A-C [0/1] rs62075617

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CDC27:ENST00000066544.3:c.1908T>G:p.(Asn636Lys); CDC27:ENST00000446365.2:c.1725T>G:p.(Asn575Lys); CDC27:ENST00000527547.1:c.1905T>G:p.(Asn635Lys); CDC27:ENST00000531206.1:c.1926T>G:p.(Asn642Lys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.521 (P); Mutation Taster: 1.000 (P); SIFT: 0.055 (D)

Frequency Data:: No frequency data

FRAMESHIFT_VARIANT DEL 17-45214613-TA-T [0/1] rs1555785828

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CDC27:ENST00000066544.3:c.1817del:p.(Leu606Hisfs*2); CDC27:ENST00000446365.2:c.1634del:p.(Leu545Hisfs*2); CDC27:ENST00000527547.1:c.1814del:p.(Leu605Hisfs*2); CDC27:ENST00000531206.1:c.1835del:p.(Leu612Hisfs*2)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

FRAMESHIFT_ELONGATION INS 17-45214617-G-GC [0/1] rs138264973

Variant score: 1.000

Transcripts:: CDC27:ENST00000446365.2:c.1630_1631insG:p.(Thr544Serfs*6); CDC27:ENST00000531206.1:c.1831_1832insG:p.(Thr611Serfs*6); CDC27:ENST00000066544.3:c.1813_1814insG:p.(Thr605Serfs*6); CDC27:ENST00000527547.1:c.1810_1811insG:p.(Thr604Serfs*6)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214633-A-C [0/1] rs148087250

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1798T>G:p.(Tyr600Asp); CDC27:ENST00000446365.2:c.1615T>G:p.(Tyr539Asp); CDC27:ENST00000527547.1:c.1795T>G:p.(Tyr599Asp); CDC27:ENST00000531206.1:c.1816T>G:p.(Tyr606Asp)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.004 (B); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214648-G-C [0/1] rs796969472

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1783C>G:p.(Gln595Glu); CDC27:ENST00000446365.2:c.1600C>G:p.(Gln534Glu); CDC27:ENST00000527547.1:c.1780C>G:p.(Gln594Glu); CDC27:ENST00000531206.1:c.1801C>G:p.(Gln601Glu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.647 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214651-T-G [0/1] rs796265930

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1780A>C:p.(Ile594Leu); CDC27:ENST00000446365.2:c.1597A>C:p.(Ile533Leu); CDC27:ENST00000527547.1:c.1777A>C:p.(Ile593Leu); CDC27:ENST00000531206.1:c.1798A>C:p.(Ile600Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.101 (B); Mutation Taster: 1.000 (P); SIFT: 0.009 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214654-C-T [0/1] rs775321736

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1777G>A:p.(Ala593Thr); CDC27:ENST00000446365.2:c.1594G>A:p.(Ala532Thr); CDC27:ENST00000527547.1:c.1774G>A:p.(Ala592Thr); CDC27:ENST00000531206.1:c.1795G>A:p.(Ala599Thr)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.931 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214669-T-G [0/1] rs62075620

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1762A>C:p.(Lys588Gln); CDC27:ENST00000446365.2:c.1579A>C:p.(Lys527Gln); CDC27:ENST00000527547.1:c.1759A>C:p.(Lys587Gln); CDC27:ENST00000531206.1:c.1780A>C:p.(Lys594Gln)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.895 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214699-T-C [0/1] rs62075623

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1732A>G:p.(Ser578Gly); CDC27:ENST00000446365.2:c.1549A>G:p.(Ser517Gly); CDC27:ENST00000527547.1:c.1729A>G:p.(Ser577Gly); CDC27:ENST00000531206.1:c.1750A>G:p.(Ser584Gly)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.455 (P); Mutation Taster: 1.000 (P); SIFT: 0.007 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45216169-T-G [0/1] rs77891297

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1640A>C:p.(Gln547Pro); CDC27:ENST00000446365.2:c.1457A>C:p.(Gln486Pro); CDC27:ENST00000527547.1:c.1637A>C:p.(Gln546Pro); CDC27:ENST00000531206.1:c.1658A>C:p.(Gln553Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.992 (D); Mutation Taster: 1.000 (P); SIFT: 0.005 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45216172-A-G [0/1] rs76836152

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1637T>C:p.(Leu546Pro); CDC27:ENST00000446365.2:c.1454T>C:p.(Leu485Pro); CDC27:ENST00000527547.1:c.1634T>C:p.(Leu545Pro); CDC27:ENST00000531206.1:c.1655T>C:p.(Leu552Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.998 (D); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45221298-A-G [0/1] rs80120716

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1121T>C:p.(Leu374Pro); CDC27:ENST00000446365.2:c.938T>C:p.(Leu313Pro); CDC27:ENST00000527547.1:c.1121T>C:p.(Leu374Pro); CDC27:ENST00000531206.1:c.1139T>C:p.(Leu380Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.003 (B); Mutation Taster: 1.000 (P); SIFT: 0.127 (T)

Frequency Data:: No frequency data

SPLICE_ACCEPTOR_VARIANT INS 17-45221350-T-TTTGTGTTTTTGCAAGGACTGGAGTTACCTTTCGGCTCTTTCCCCTCTGCGAGAAGACAG [0/1]

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1071-3_1071-2insCTGTCTTCTCGCAGAGGGGAAAGAGCCGAAAGGTAACTCCAGTCCTTGCAAAAACACAA:p.?; CDC27:ENST00000446365.2:c.888-3_888-2insCTGTCTTCTCGCAGAGGGGAAAGAGCCGAAAGGTAACTCCAGTCCTTGCAAAAACACAA:p.?; CDC27:ENST00000527547.1:c.1071-3_1071-2insCTGTCTTCTCGCAGAGGGGAAAGAGCCGAAAGGTAACTCCAGTCCTTGCAAAAACACAA:p.?; CDC27:ENST00000531206.1:c.1089-3_1089-2insCTGTCTTCTCGCAGAGGGGAAAGAGCCGAAAGGTAACTCCAGTCCTTGCAAAAACACAA:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_ELONGATION INS 17-45232087-T-TAC [0/1]

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.907_908insGT:p.(Asn303Serfs*6); CDC27:ENST00000446365.2:c.724_725insGT:p.(Asn242Serfs*6); CDC27:ENST00000527547.1:c.907_908insGT:p.(Asn303Serfs*6); CDC27:ENST00000531206.1:c.907_908insGT:p.(Asn303Serfs*6)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

STOP_GAINED SNV 17-45232102-A-C [0/1] rs796572277

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.893T>G:p.(Leu298*); CDC27:ENST00000446365.2:c.710T>G:p.(Leu237*); CDC27:ENST00000527547.1:c.893T>G:p.(Leu298*); CDC27:ENST00000531206.1:c.893T>G:p.(Leu298*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234343-T-G [0/1] rs3208659

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.778A>C:p.(Asn260His); CDC27:ENST00000446365.2:c.595A>C:p.(Asn199His); CDC27:ENST00000527547.1:c.778A>C:p.(Asn260His); CDC27:ENST00000531206.1:c.778A>C:p.(Asn260His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.540 (P); Mutation Taster: 1.000 (P); SIFT: 0.042 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV 17-45234360-A-C [0/1] rs62077264

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.761T>G:p.(Leu254*); CDC27:ENST00000446365.2:c.578T>G:p.(Leu193*); CDC27:ENST00000527547.1:c.761T>G:p.(Leu254*); CDC27:ENST00000531206.1:c.761T>G:p.(Leu254*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234663-A-C [0/1] rs370261409

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.563T>G:p.(Val188Gly); CDC27:ENST00000446365.2:c.380T>G:p.(Val127Gly); CDC27:ENST00000527547.1:c.563T>G:p.(Val188Gly); CDC27:ENST00000531206.1:c.563T>G:p.(Val188Gly)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.002 (B); Mutation Taster: 1.000 (P); SIFT: 0.261 (T)

Frequency Data:: No frequency data

STOP_GAINED SNV 17-45234721-T-A [0/1] rs199899451

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.505A>T:p.(Lys169*); CDC27:ENST00000446365.2:c.322A>T:p.(Lys108*); CDC27:ENST00000527547.1:c.505A>T:p.(Lys169*); CDC27:ENST00000531206.1:c.505A>T:p.(Lys169*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45249365-C-T [0/1] rs62077268

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.169G>A:p.(Ala57Thr); CDC27:ENST00000527547.1:c.169G>A:p.(Ala57Thr); CDC27:ENST00000531206.1:c.169G>A:p.(Ala57Thr); CDC27:ENST00000446365.2:c.69-1957G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.758 (P); Mutation Taster: 1.000 (P); SIFT: 0.083 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45249391-T-G [0/1] rs62077270

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.143A>C:p.(Tyr48Ser); CDC27:ENST00000527547.1:c.143A>C:p.(Tyr48Ser); CDC27:ENST00000531206.1:c.143A>C:p.(Tyr48Ser); CDC27:ENST00000446365.2:c.69-1983A>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.942 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45232151-A-C [0/1] rs79452779

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.844T>G:p.(Phe282Val); CDC27:ENST00000446365.2:c.661T>G:p.(Phe221Val); CDC27:ENST00000527547.1:c.844T>G:p.(Phe282Val); CDC27:ENST00000531206.1:c.844T>G:p.(Phe282Val)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.991 (D); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45216132-T-G [0/1] rs62075657

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1677A>C:p.(Leu559Phe); CDC27:ENST00000446365.2:c.1494A>C:p.(Leu498Phe); CDC27:ENST00000527547.1:c.1674A>C:p.(Leu558Phe); CDC27:ENST00000531206.1:c.1695A>C:p.(Leu565Phe)

Pathogenicity Data:: Best Score: 0.999998; Polyphen2: 0.995 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45232093-T-C [0/1] rs200061079

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.902A>G:p.(Tyr301Cys); CDC27:ENST00000446365.2:c.719A>G:p.(Tyr240Cys); CDC27:ENST00000527547.1:c.902A>G:p.(Tyr301Cys); CDC27:ENST00000531206.1:c.902A>G:p.(Tyr301Cys)

Pathogenicity Data:: Best Score: 0.999998; Mutation Taster: 1.000 (P); SIFT: 0.084 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45232109-A-G [0/1] rs76383230

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.886T>C:p.(Ser296Pro); CDC27:ENST00000446365.2:c.703T>C:p.(Ser235Pro); CDC27:ENST00000527547.1:c.886T>C:p.(Ser296Pro); CDC27:ENST00000531206.1:c.886T>C:p.(Ser296Pro)

Pathogenicity Data:: Best Score: 0.999998; Polyphen2: 0.101 (B); Mutation Taster: 1.000 (P); SIFT: 0.007 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234706-G-C [0/1] rs143453365

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.520C>G:p.(Gln174Glu); CDC27:ENST00000446365.2:c.337C>G:p.(Gln113Glu); CDC27:ENST00000527547.1:c.520C>G:p.(Gln174Glu); CDC27:ENST00000531206.1:c.520C>G:p.(Gln174Glu)

Pathogenicity Data:: Best Score: 0.999997; Polyphen2: 0.005 (B); Mutation Taster: 1.000 (P); SIFT: 0.338 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234403-T-G [0/1] rs75184508

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.718A>C:p.(Ile240Leu); CDC27:ENST00000446365.2:c.535A>C:p.(Ile179Leu); CDC27:ENST00000527547.1:c.718A>C:p.(Ile240Leu); CDC27:ENST00000531206.1:c.718A>C:p.(Ile240Leu)

Pathogenicity Data:: Best Score: 0.999996; Polyphen2: 0.007 (B); Mutation Taster: 1.000 (P); SIFT: 0.447 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234685-G-A [0/1] rs149474782

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.541C>T:p.(Pro181Ser); CDC27:ENST00000446365.2:c.358C>T:p.(Pro120Ser); CDC27:ENST00000527547.1:c.541C>T:p.(Pro181Ser); CDC27:ENST00000531206.1:c.541C>T:p.(Pro181Ser)

Pathogenicity Data:: Best Score: 0.999996; Polyphen2: 0.001 (B); Mutation Taster: 1.000 (P); SIFT: 0.694 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214592-T-G [0/1] rs79285536

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1839A>C:p.(Leu613Phe); CDC27:ENST00000446365.2:c.1656A>C:p.(Leu552Phe); CDC27:ENST00000527547.1:c.1836A>C:p.(Leu612Phe); CDC27:ENST00000531206.1:c.1857A>C:p.(Leu619Phe)

Pathogenicity Data:: Best Score: 0.999994; Polyphen2: 0.079 (B); Mutation Taster: 1.000 (P); SIFT: 0.007 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234702-T-C [0/1] rs147617501

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.524A>G:p.(Asn175Ser); CDC27:ENST00000446365.2:c.341A>G:p.(Asn114Ser); CDC27:ENST00000527547.1:c.524A>G:p.(Asn175Ser); CDC27:ENST00000531206.1:c.524A>G:p.(Asn175Ser)

Pathogenicity Data:: Best Score: 0.99999; Polyphen2: 0.004 (B); Mutation Taster: 1.000 (P); SIFT: 0.304 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234654-T-G [0/1] rs374614181

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.572A>C:p.(His191Pro); CDC27:ENST00000446365.2:c.389A>C:p.(His130Pro); CDC27:ENST00000527547.1:c.572A>C:p.(His191Pro); CDC27:ENST00000531206.1:c.572A>C:p.(His191Pro)

Pathogenicity Data:: Best Score: 0.999982; Polyphen2: 0.093 (B); Mutation Taster: 1.000 (P); SIFT: 0.100 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45221273-A-C [0/1] rs1141701

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1146T>G:p.(Phe382Leu); CDC27:ENST00000446365.2:c.963T>G:p.(Phe321Leu); CDC27:ENST00000527547.1:c.1146T>G:p.(Phe382Leu); CDC27:ENST00000531206.1:c.1164T>G:p.(Phe388Leu)

Pathogenicity Data:: Best Score: 0.999962; Polyphen2: 0.548 (P); Mutation Taster: 1.000 (P); SIFT: 0.050 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45214600-A-G [0/1] rs112627286

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1831T>C:p.(Phe611Leu); CDC27:ENST00000446365.2:c.1648T>C:p.(Phe550Leu); CDC27:ENST00000527547.1:c.1828T>C:p.(Phe610Leu); CDC27:ENST00000531206.1:c.1849T>C:p.(Phe617Leu)

Pathogenicity Data:: Best Score: 0.99982; Polyphen2: 0.002 (B); Mutation Taster: 1.000 (P); SIFT: 0.456 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45216162-A-C [0/1] rs111227623

Variant score: 1.000

Transcripts:: CDC27:ENST00000066544.3:c.1647T>G:p.(Asp549Glu); CDC27:ENST00000446365.2:c.1464T>G:p.(Asp488Glu); CDC27:ENST00000527547.1:c.1644T>G:p.(Asp548Glu); CDC27:ENST00000531206.1:c.1665T>G:p.(Asp555Glu)

Pathogenicity Data:: Best Score: 0.999577; Polyphen2: 0.082 (B); Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234720-T-C [0/1] rs202182614

Variant score: 0.999

Transcripts:: CDC27:ENST00000066544.3:c.506A>G:p.(Lys169Arg); CDC27:ENST00000446365.2:c.323A>G:p.(Lys108Arg); CDC27:ENST00000527547.1:c.506A>G:p.(Lys169Arg); CDC27:ENST00000531206.1:c.506A>G:p.(Lys169Arg)

Pathogenicity Data:: Best Score: 0.998578; Polyphen2: 0.006 (B); Mutation Taster: 0.999 (P); SIFT: 0.128 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234680-G-C [0/1] rs368304141

Variant score: 0.998

Transcripts:: CDC27:ENST00000066544.3:c.546C>G:p.(Asn182Lys); CDC27:ENST00000446365.2:c.363C>G:p.(Asn121Lys); CDC27:ENST00000527547.1:c.546C>G:p.(Asn182Lys); CDC27:ENST00000531206.1:c.546C>G:p.(Asn182Lys)

Pathogenicity Data:: Best Score: 0.997774; Polyphen2: 0.001 (B); Mutation Taster: 0.998 (P); SIFT: 0.139 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234298-G-C [0/1] rs62077263

Variant score: 0.997

Transcripts:: CDC27:ENST00000066544.3:c.823C>G:p.(Leu275Val); CDC27:ENST00000446365.2:c.640C>G:p.(Leu214Val); CDC27:ENST00000527547.1:c.823C>G:p.(Leu275Val); CDC27:ENST00000531206.1:c.823C>G:p.(Leu275Val)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.667 (P); Mutation Taster: 1.000 (P); SIFT: 0.065 (T)

Frequency Data:: gnomAD_E_FIN: 0.0091%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0185%; gnomAD_E_SAS: 0.0067%

MISSENSE_VARIANT SNV 17-45229253-T-G [0/1] rs200834582

Variant score: 0.997

Transcripts:: CDC27:ENST00000066544.3:c.989A>C:p.(Lys330Thr); CDC27:ENST00000446365.2:c.806A>C:p.(Lys269Thr); CDC27:ENST00000527547.1:c.989A>C:p.(Lys330Thr); CDC27:ENST00000531206.1:c.1007A>C:p.(Lys336Thr)

Pathogenicity Data:: Best Score: 0.999994; Polyphen2: 0.341 (B); Mutation Taster: 1.000 (P); SIFT: 0.012 (D)

Frequency Data:: gnomAD_E_OTH: 0.0190%; gnomAD_E_SAS: 0.0034%

MISSENSE_VARIANT SNV 17-45229254-T-G [0/1] rs201804958

Variant score: 0.997

Transcripts:: CDC27:ENST00000066544.3:c.988A>C:p.(Lys330Gln); CDC27:ENST00000446365.2:c.805A>C:p.(Lys269Gln); CDC27:ENST00000527547.1:c.988A>C:p.(Lys330Gln); CDC27:ENST00000531206.1:c.1006A>C:p.(Lys336Gln)

Pathogenicity Data:: Best Score: 0.999974; Polyphen2: 0.158 (B); Mutation Taster: 1.000 (P); SIFT: 0.017 (D)

Frequency Data:: gnomAD_E_OTH: 0.0190%

MISSENSE_VARIANT SNV 17-45232088-T-C [0/1] rs796316978

Variant score: 0.996

Transcripts:: CDC27:ENST00000066544.3:c.907A>G:p.(Asn303Asp); CDC27:ENST00000446365.2:c.724A>G:p.(Asn242Asp); CDC27:ENST00000527547.1:c.907A>G:p.(Asn303Asp); CDC27:ENST00000531206.1:c.907A>G:p.(Asn303Asp)

Pathogenicity Data:: Best Score: 0.996494; Polyphen2: 0.001 (B); Mutation Taster: 0.996 (P); SIFT: 0.271 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45219332-T-G [0/1] rs62077261

Variant score: 0.992

Transcripts:: CDC27:ENST00000066544.3:c.1438A>C:p.(Asn480His); CDC27:ENST00000446365.2:c.1255A>C:p.(Asn419His); CDC27:ENST00000527547.1:c.1435A>C:p.(Asn479His); CDC27:ENST00000531206.1:c.1456A>C:p.(Asn486His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.878 (P); Mutation Taster: 1.000 (P); SIFT: 0.019 (D)

Frequency Data:: gnomAD_E_AFR: 0.0138%; gnomAD_E_AMR: 0.0553%; gnomAD_E_EAS: 0.0502%; gnomAD_E_FIN: 0.0185%; gnomAD_E_NFE: 0.0111%; gnomAD_E_OTH: 0.0386%; gnomAD_E_SAS: 0.0034%

MISSENSE_VARIANT SNV 17-45234678-G-C [0/1] rs376818791

Variant score: 0.959

Transcripts:: CDC27:ENST00000066544.3:c.548C>G:p.(Ser183Cys); CDC27:ENST00000446365.2:c.365C>G:p.(Ser122Cys); CDC27:ENST00000527547.1:c.548C>G:p.(Ser183Cys); CDC27:ENST00000531206.1:c.548C>G:p.(Ser183Cys)

Pathogenicity Data:: Best Score: 0.959; Polyphen2: 0.002 (B); Mutation Taster: 0.832; SIFT: 0.041 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45221286-C-T [0/1] rs77440865

Variant score: 0.956

Transcripts:: CDC27:ENST00000066544.3:c.1133G>A:p.(Ser378Asn); CDC27:ENST00000446365.2:c.950G>A:p.(Ser317Asn); CDC27:ENST00000527547.1:c.1133G>A:p.(Ser378Asn); CDC27:ENST00000531206.1:c.1151G>A:p.(Ser384Asn)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.895 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: gnomAD_E_AFR: 0.0087%; gnomAD_E_AMR: 0.2800%; gnomAD_E_EAS: 0.0621%; gnomAD_E_FIN: 0.0330%; gnomAD_E_NFE: 0.0523%; gnomAD_E_OTH: 0.0248%; gnomAD_E_SAS: 0.2146%; gnomAD_G_FIN: 0.0911%

MISSENSE_VARIANT SNV 17-45234658-T-G [0/1] rs368750026

Variant score: 0.952

Transcripts:: CDC27:ENST00000066544.3:c.568A>C:p.(Asn190His); CDC27:ENST00000446365.2:c.385A>C:p.(Asn129His); CDC27:ENST00000527547.1:c.568A>C:p.(Asn190His); CDC27:ENST00000531206.1:c.568A>C:p.(Asn190His)

Pathogenicity Data:: Best Score: 0.954154; Polyphen2: 0.004 (B); Mutation Taster: 0.954 (P); SIFT: 0.056 (D)

Frequency Data:: ExAC FIN: 0.0151%; gnomAD_E_FIN: 0.0045%

MISSENSE_VARIANT SNV 17-45221318-A-C [0/1] rs77739281

Variant score: 0.926

Transcripts:: CDC27:ENST00000066544.3:c.1101T>G:p.(Ile367Met); CDC27:ENST00000446365.2:c.918T>G:p.(Ile306Met); CDC27:ENST00000527547.1:c.1101T>G:p.(Ile367Met); CDC27:ENST00000531206.1:c.1119T>G:p.(Ile373Met)

Pathogenicity Data:: Best Score: 0.999906; Polyphen2: 0.011 (B); Mutation Taster: 1.000 (P); SIFT: 0.077 (T)

Frequency Data:: gnomAD_E_AFR: 0.0181%; gnomAD_E_AMR: 0.4336%; gnomAD_E_EAS: 0.0681%; gnomAD_E_FIN: 0.0430%; gnomAD_E_NFE: 0.0791%; gnomAD_E_OTH: 0.2074%; gnomAD_E_SAS: 0.3257%; gnomAD_G_FIN: 0.0605%

MISSENSE_VARIANT SNV 17-45234430-A-G [0/1] rs78072949

Variant score: 0.916

Transcripts:: CDC27:ENST00000066544.3:c.691T>C:p.(Ser231Pro); CDC27:ENST00000446365.2:c.508T>C:p.(Ser170Pro); CDC27:ENST00000527547.1:c.691T>C:p.(Ser231Pro); CDC27:ENST00000531206.1:c.691T>C:p.(Ser231Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.010 (B); Mutation Taster: 1.000 (P); SIFT: 0.099 (T)

Frequency Data:: gnomAD_E_AFR: 0.0469%; gnomAD_E_AMR: 0.4822%; gnomAD_E_EAS: 0.2092%; gnomAD_E_FIN: 0.1639%; gnomAD_E_NFE: 0.1398%; gnomAD_E_OTH: 0.2127%; gnomAD_E_SAS: 0.4125%; gnomAD_G_AFR: 0.0241%; gnomAD_G_FIN: 0.0314%

DISRUPTIVE_INFRAME_INSERTION INS 17-45221346-G-GCCC [0/1]

Variant score: 0.850

Transcripts:: CDC27:ENST00000066544.3:c.1072_1073insGGG:p.(Thr358delinsArgAla); CDC27:ENST00000446365.2:c.889_890insGGG:p.(Thr297delinsArgAla); CDC27:ENST00000527547.1:c.1072_1073insGGG:p.(Thr358delinsArgAla); CDC27:ENST00000531206.1:c.1090_1091insGGG:p.(Thr364delinsArgAla)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

INFRAME_INSERTION INS 17-45221347-T-TTGTCGGCGGACCAGA [0/1]

Variant score: 0.850

Transcripts:: CDC27:ENST00000066544.3:c.1071_1072insTCTGGTCCGCCGACA:p.(Ser357_Thr358insSerGlyProProThr); CDC27:ENST00000446365.2:c.888_889insTCTGGTCCGCCGACA:p.(Ser296_Thr297insSerGlyProProThr); CDC27:ENST00000527547.1:c.1071_1072insTCTGGTCCGCCGACA:p.(Ser357_Thr358insSerGlyProProThr); CDC27:ENST00000531206.1:c.1089_1090insTCTGGTCCGCCGACA:p.(Ser363_Thr364insSerGlyProProThr)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

INFRAME_INSERTION INS 17-45232085-T-TCTC [0/1]

Variant score: 0.850

Transcripts:: CDC27:ENST00000066544.3:c.909_910insGAG:p.(Asn303_Thr304insGlu); CDC27:ENST00000446365.2:c.726_727insGAG:p.(Asn242_Thr243insGlu); CDC27:ENST00000527547.1:c.909_910insGAG:p.(Asn303_Thr304insGlu); CDC27:ENST00000531206.1:c.909_910insGAG:p.(Asn303_Thr304insGlu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

INFRAME_INSERTION INS 17-45234673-T-TGGC [0/1] rs375653477

Variant score: 0.850

Transcripts:: CDC27:ENST00000066544.3:c.552_553insGCC:p.(Cys184_Thr185insAla); CDC27:ENST00000446365.2:c.369_370insGCC:p.(Cys123_Thr124insAla); CDC27:ENST00000527547.1:c.552_553insGCC:p.(Cys184_Thr185insAla); CDC27:ENST00000531206.1:c.552_553insGCC:p.(Cys184_Thr185insAla)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 17-45214510-C-G [0/1] rs112530322

Variant score: 0.800

Transcripts:: CDC27:ENST00000066544.3:c.1913+8G>C:p.?; CDC27:ENST00000446365.2:c.1730+8G>C:p.?; CDC27:ENST00000527547.1:c.1910+8G>C:p.?; CDC27:ENST00000531206.1:c.1931+8G>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC NFE: 0.0017%

MISSENSE_VARIANT SNV 17-45234665-T-A [0/1] rs374472811

Variant score: 0.665

Transcripts:: CDC27:ENST00000066544.3:c.561A>T:p.(Gln187His); CDC27:ENST00000446365.2:c.378A>T:p.(Gln126His); CDC27:ENST00000527547.1:c.561A>T:p.(Gln187His); CDC27:ENST00000531206.1:c.561A>T:p.(Gln187His)

Pathogenicity Data:: Best Score: 0.66499996; Polyphen2: 0.001 (B); SIFT: 0.335 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45234666-T-A [0/1] rs367644695

Variant score: 0.458

Transcripts:: CDC27:ENST00000066544.3:c.560A>T:p.(Gln187Leu); CDC27:ENST00000446365.2:c.377A>T:p.(Gln126Leu); CDC27:ENST00000527547.1:c.560A>T:p.(Gln187Leu); CDC27:ENST00000531206.1:c.560A>T:p.(Gln187Leu)

Pathogenicity Data:: Best Score: 0.458; SIFT: 0.542 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 17-45221317-T-C [0/1] rs79454290

Variant score: 0.144

Transcripts:: CDC27:ENST00000066544.3:c.1102A>G:p.(Thr368Ala); CDC27:ENST00000446365.2:c.919A>G:p.(Thr307Ala); CDC27:ENST00000527547.1:c.1102A>G:p.(Thr368Ala); CDC27:ENST00000531206.1:c.1120A>G:p.(Thr374Ala)

Pathogenicity Data:: Best Score: 0.144; SIFT: 0.856 (T)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45214616-A-C [0/1]

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1815T>G:p.(=); CDC27:ENST00000446365.2:c.1632T>G:p.(=); CDC27:ENST00000527547.1:c.1812T>G:p.(=); CDC27:ENST00000531206.1:c.1833T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45214673-T-C [0/1] rs62075621

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1758A>G:p.(=); CDC27:ENST00000446365.2:c.1575A>G:p.(=); CDC27:ENST00000527547.1:c.1755A>G:p.(=); CDC27:ENST00000531206.1:c.1776A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45216141-T-G [0/1] rs62075658

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1668A>C:p.(=); CDC27:ENST00000446365.2:c.1485A>C:p.(=); CDC27:ENST00000527547.1:c.1665A>C:p.(=); CDC27:ENST00000531206.1:c.1686A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45216231-T-C [0/1] rs76715333

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1578A>G:p.(=); CDC27:ENST00000446365.2:c.1395A>G:p.(=); CDC27:ENST00000527547.1:c.1575A>G:p.(=); CDC27:ENST00000531206.1:c.1596A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45232074-T-G [0/1] rs78019952

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.921A>C:p.(=); CDC27:ENST00000446365.2:c.738A>C:p.(=); CDC27:ENST00000527547.1:c.921A>C:p.(=); CDC27:ENST00000531206.1:c.921A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45232080-A-C [0/1] rs796641903

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.915T>G:p.(=); CDC27:ENST00000446365.2:c.732T>G:p.(=); CDC27:ENST00000527547.1:c.915T>G:p.(=); CDC27:ENST00000531206.1:c.915T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45232113-A-G [0/1] rs79479079

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.882T>C:p.(=); CDC27:ENST00000446365.2:c.699T>C:p.(=); CDC27:ENST00000527547.1:c.882T>C:p.(=); CDC27:ENST00000531206.1:c.882T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45232119-A-G [0/1] rs76158881

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.876T>C:p.(=); CDC27:ENST00000446365.2:c.693T>C:p.(=); CDC27:ENST00000527547.1:c.876T>C:p.(=); CDC27:ENST00000531206.1:c.876T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234404-T-G [0/1] rs74925848

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.717A>C:p.(=); CDC27:ENST00000446365.2:c.534A>C:p.(=); CDC27:ENST00000527547.1:c.717A>C:p.(=); CDC27:ENST00000531206.1:c.717A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234416-A-G [0/1] rs74628496

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.705T>C:p.(=); CDC27:ENST00000446365.2:c.522T>C:p.(=); CDC27:ENST00000527547.1:c.705T>C:p.(=); CDC27:ENST00000531206.1:c.705T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234434-A-G [0/1] rs75241171

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.687T>C:p.(=); CDC27:ENST00000446365.2:c.504T>C:p.(=); CDC27:ENST00000527547.1:c.687T>C:p.(=); CDC27:ENST00000531206.1:c.687T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234632-A-G [0/1] rs75175938

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.594T>C:p.(=); CDC27:ENST00000446365.2:c.411T>C:p.(=); CDC27:ENST00000527547.1:c.594T>C:p.(=); CDC27:ENST00000531206.1:c.594T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234689-A-G [0/1] rs140171160

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.537T>C:p.(=); CDC27:ENST00000446365.2:c.354T>C:p.(=); CDC27:ENST00000527547.1:c.537T>C:p.(=); CDC27:ENST00000531206.1:c.537T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234709-A-G [0/1] rs142987740

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.517T>C:p.(=); CDC27:ENST00000446365.2:c.334T>C:p.(=); CDC27:ENST00000527547.1:c.517T>C:p.(=); CDC27:ENST00000531206.1:c.517T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45234713-T-G [0/1] rs139751753

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.513A>C:p.(=); CDC27:ENST00000446365.2:c.330A>C:p.(=); CDC27:ENST00000527547.1:c.513A>C:p.(=); CDC27:ENST00000531206.1:c.513A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45249408-A-G [0/1] rs62077272

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.126T>C:p.(=); CDC27:ENST00000527547.1:c.126T>C:p.(=); CDC27:ENST00000531206.1:c.126T>C:p.(=); CDC27:ENST00000446365.2:c.69-2000T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 17-45232068-A-G [0/1] rs74710570

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.927T>C:p.(=); CDC27:ENST00000446365.2:c.744T>C:p.(=); CDC27:ENST00000527547.1:c.927T>C:p.(=); CDC27:ENST00000531206.1:c.927T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC NFE: 0.0016%

SYNONYMOUS_VARIANT SNV 17-45216210-A-G [0/1] rs62075659

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1599T>C:p.(=); CDC27:ENST00000446365.2:c.1416T>C:p.(=); CDC27:ENST00000527547.1:c.1596T>C:p.(=); CDC27:ENST00000531206.1:c.1617T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_SAS: 0.0033%

SYNONYMOUS_VARIANT SNV 17-45216168-T-C [0/1] rs146997390

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1641A>G:p.(=); CDC27:ENST00000446365.2:c.1458A>G:p.(=); CDC27:ENST00000527547.1:c.1638A>G:p.(=); CDC27:ENST00000531206.1:c.1659A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC SAS: 0.0061%; gnomAD_E_SAS: 0.0033%

SYNONYMOUS_VARIANT SNV 17-45249399-T-C [0/1] rs62077271

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.135A>G:p.(=); CDC27:ENST00000527547.1:c.135A>G:p.(=); CDC27:ENST00000531206.1:c.135A>G:p.(=); CDC27:ENST00000446365.2:c.69-1991A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC SAS: 0.0078%; gnomAD_E_NFE: 0.0010%; gnomAD_E_SAS: 0.0039%

SYNONYMOUS_VARIANT SNV 17-45219299-G-A [0/1] rs74929661

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1471C>T:p.(=); CDC27:ENST00000446365.2:c.1288C>T:p.(=); CDC27:ENST00000527547.1:c.1468C>T:p.(=); CDC27:ENST00000531206.1:c.1489C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0067%; gnomAD_E_AMR: 0.0093%; gnomAD_E_EAS: 0.0061%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0066%

SYNONYMOUS_VARIANT SNV 17-45232146-C-G [0/1] rs77277197

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.849G>C:p.(=); CDC27:ENST00000446365.2:c.666G>C:p.(=); CDC27:ENST00000527547.1:c.849G>C:p.(=); CDC27:ENST00000531206.1:c.849G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AMR: 0.0139%; gnomAD_E_SAS: 0.0034%

SYNONYMOUS_VARIANT SNV 17-45214544-T-C [0/1] rs62075619

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.1887A>G:p.(=); CDC27:ENST00000446365.2:c.1704A>G:p.(=); CDC27:ENST00000527547.1:c.1884A>G:p.(=); CDC27:ENST00000531206.1:c.1905A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_OTH: 0.0184%

SYNONYMOUS_VARIANT SNV 17-45249372-T-G [0/1] rs62077269

Variant score: 0.100

Transcripts:: CDC27:ENST00000066544.3:c.162A>C:p.(=); CDC27:ENST00000527547.1:c.162A>C:p.(=); CDC27:ENST00000531206.1:c.162A>C:p.(=); CDC27:ENST00000446365.2:c.69-1964A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0070%; gnomAD_E_AMR: 0.0033%; gnomAD_E_FIN: 0.0245%; gnomAD_E_NFE: 0.0173%; gnomAD_E_OTH: 0.0198%; gnomAD_E_SAS: 0.0036%; gnomAD_G_NFE: 0.0136%

SYNONYMOUS_VARIANT SNV 17-45229261-A-G [0/1] rs111414808

Variant score: 0.099

Transcripts:: CDC27:ENST00000066544.3:c.981T>C:p.(=); CDC27:ENST00000446365.2:c.798T>C:p.(=); CDC27:ENST00000527547.1:c.981T>C:p.(=); CDC27:ENST00000531206.1:c.999T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0011%; ExAC NFE: 0.0045%; ExAC SAS: 0.0061%; gnomAD_E_NFE: 0.0027%; gnomAD_E_OTH: 0.0379%; gnomAD_E_SAS: 0.0171%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 17-45216216-A-G [0/1] rs62077260

Variant score: 0.099

Transcripts:: CDC27:ENST00000066544.3:c.1593T>C:p.(=); CDC27:ENST00000446365.2:c.1410T>C:p.(=); CDC27:ENST00000527547.1:c.1590T>C:p.(=); CDC27:ENST00000531206.1:c.1611T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0031%; gnomAD_G_EAS: 0.0617%

SYNONYMOUS_VARIANT SNV 17-45214582-A-G [0/1] rs75731161

Variant score: 0.097

Transcripts:: CDC27:ENST00000066544.3:c.1849T>C:p.(=); CDC27:ENST00000446365.2:c.1666T>C:p.(=); CDC27:ENST00000527547.1:c.1846T>C:p.(=); CDC27:ENST00000531206.1:c.1867T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0091%; ExAC EAS: 0.1736%; ExAC OTH: 0.1104%; gnomAD_E_EAS: 0.1451%; gnomAD_E_NFE: 0.0009%; gnomAD_G_EAS: 0.0617%

SYNONYMOUS_VARIANT SNV 17-45221303-G-A [0/1] rs76836956

Variant score: 0.096

Transcripts:: CDC27:ENST00000066544.3:c.1116C>T:p.(=); CDC27:ENST00000446365.2:c.933C>T:p.(=); CDC27:ENST00000527547.1:c.1116C>T:p.(=); CDC27:ENST00000531206.1:c.1134C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; gnomAD_E_AFR: 0.0088%; gnomAD_E_AMR: 0.2838%; gnomAD_E_EAS: 0.0362%; gnomAD_E_FIN: 0.0236%; gnomAD_E_NFE: 0.0570%; gnomAD_E_SAS: 0.2353%; gnomAD_G_AFR: 0.0115%; gnomAD_G_FIN: 0.0918%

SYNONYMOUS_VARIANT SNV 17-45214643-A-C [0/1] rs138020641

Variant score: 0.079

Transcripts:: CDC27:ENST00000066544.3:c.1788T>G:p.(=); CDC27:ENST00000446365.2:c.1605T>G:p.(=); CDC27:ENST00000527547.1:c.1785T>G:p.(=); CDC27:ENST00000531206.1:c.1806T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.3692%; gnomAD_E_AMR: 0.9489%; gnomAD_E_EAS: 0.3497%; gnomAD_E_FIN: 0.6602%; gnomAD_E_NFE: 0.3351%; gnomAD_E_OTH: 0.5086%; gnomAD_E_SAS: 0.7459%; gnomAD_G_AFR: 0.0118%; gnomAD_G_NFE: 0.0143%

Exomiser Score: 0.763

Phenotype Score: 0.517

Variant Score: 0.989

Phenotype matches:

Proximity score 0.517 in interactome to HS2ST1 and phenotypic similarity 0.703 to Neurofacioskeletal syndrome with or without renal agenesis associated with HS2ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0011927, Short digit; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger; HP:0010055, Broad hallux - HP:0010186, Broad distal phalanx of the toes

Proximity score 0.517 in interactome to HS2ST1 and phenotypic similarity 0.698 to mouse mutant of HS2ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.763

Phenotype Score: 0.517

Variant Score: 0.989

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 13-96743358-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.989 CONTRIBUTING VARIANT

Transcripts:: HS6ST3:ENST00000376705.2:c.242G>T:p.(Gly81Val)

Pathogenicity Data:: Best Score: 0.989; Polyphen2: 0.017 (B); SIFT: 0.011 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.052

Phenotype Score: 0.517

Variant Score: 0.545

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 13-96743358-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.989 CONTRIBUTING VARIANT

Transcripts:: HS6ST3:ENST00000376705.2:c.242G>T:p.(Gly81Val)

Pathogenicity Data:: Best Score: 0.989; Polyphen2: 0.017 (B); SIFT: 0.011 (D)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 13-96743359-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: HS6ST3:ENST00000376705.2:c.243A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.762

Phenotype Score: 0.507

Variant Score: 1.000

Phenotype matches:

Proximity score 0.507 in interactome to PLOD2 and phenotypic similarity 0.617 to Bruck syndrome 2 associated with PLOD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002980, Femoral bowing; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0002980, Femoral bowing; HP:0010055, Broad hallux - HP:0002980, Femoral bowing

Proximity score 0.507 in interactome to PLOD2 and phenotypic similarity 0.265 to mouse mutant of PLOD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005544, corneal deposits; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.507 in interactome to PLOD2 and phenotypic similarity 0.433 to fish mutant of PLOD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0006781, bone mineralization increased process quality, abnormal; HP:0011304, Broad thumb - ZP:0020434, rib curved, abnormal; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.762

Phenotype Score: 0.507

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-123892186-T-C [0/1] rs61955127

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KMT5A:ENST00000330479.4:c.995T>C:p.(Leu332Pro); KMT5A:ENST00000402868.3:c.995T>C:p.(Leu332Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.014 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.762

Phenotype Score: 0.507

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-123892186-T-C [0/1] rs61955127

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KMT5A:ENST00000330479.4:c.995T>C:p.(Leu332Pro); KMT5A:ENST00000402868.3:c.995T>C:p.(Leu332Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.014 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 12-123889492-A-C [0/1] rs61955124

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KMT5A:ENST00000330479.4:c.719A>C:p.(Asp240Ala); KMT5A:ENST00000402868.3:c.719A>C:p.(Asp240Ala)

Pathogenicity Data:: Best Score: 0.999998; Polyphen2: 0.030 (B); Mutation Taster: 1.000 (P); SIFT: 0.016 (D)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 12-123892095-T-C [0/1] rs61955126

Variant score: 1.000

Transcripts:: KMT5A:ENST00000330479.4:c.904T>C:p.(Cys302Arg); KMT5A:ENST00000402868.3:c.904T>C:p.(Cys302Arg)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.007 (B); Mutation Taster: 1.000 (P); SIFT: 0.352 (T)

Frequency Data:: ExAC NFE: 0.0015%

SPLICE_ACCEPTOR_VARIANT SNV 12-123893416-A-G [0/1] rs142906941

Variant score: 0.985

Transcripts:: KMT5A:ENST00000330479.4:c.*1104-2A>G:p.(=); KMT5A:ENST00000402868.3:c.*1166A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0952%; gnomAD_G_AFR: 0.0459%; gnomAD_G_NFE: 0.0268%; gnomAD_G_OTH: 0.1020%

SYNONYMOUS_VARIANT SNV 12-123892235-G-A [0/1] rs61955128

Variant score: 0.091

Transcripts:: KMT5A:ENST00000330479.4:c.1044G>A:p.(=); KMT5A:ENST00000402868.3:c.1044G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.5192%; TOPMed: 0.0291%; gnomAD_E_AFR: 0.0070%; gnomAD_E_AMR: 0.1789%; gnomAD_E_NFE: 0.0037%; gnomAD_G_AFR: 0.0229%; gnomAD_G_AMR: 0.2387%

Exomiser Score: 0.761

Phenotype Score: 0.508

Variant Score: 0.998

Phenotype matches:

Phenotypic similarity 0.327 to mouse mutant involving PER2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0020039, increased bone ossification; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.508 in interactome to NONO and phenotypic similarity 0.699 to Intellectual developmental disorder, X-linked syndromic 34 associated with NONO.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001822, Hallux valgus; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0001822, Hallux valgus; HP:0010055, Broad hallux - HP:0001822, Hallux valgus

Known diseases:: OMIM:604348 ?Advanced sleep phase syndrome, familial, 1 (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.761

Phenotype Score: 0.508

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-239170917-T-C [0/1] rs781531937

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: PER2:ENST00000254657.3:c.1222A>G:p.(Ile408Val); PER2:ENST00000254658.3:c.1115A>G:p.(His372Arg); PER2:ENST00000355768.2:c.1115A>G:p.(His372Arg); PER2:ENST00000440245.1:c.1222A>G:p.(Ile408Val)

Pathogenicity Data:: Best Score: 0.998143; Polyphen2: 0.074 (B); Mutation Taster: 0.998 (P); SIFT: 0.387 (T)

Frequency Data:: TOPMed: 0.0015%

Exomiser Score: 0.759

Phenotype Score: 0.505

Variant Score: 1.000

Phenotype matches:

Proximity score 0.505 in interactome to APBB1IP and phenotypic similarity 0.755 to mouse mutant of APBB1IP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.759

Phenotype Score: 0.505

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-62939564-A-G [0/1] rs1283559514

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TLN2:ENST00000306829.6:c.55A>G:p.(Met19Val); TLN2:ENST00000561311.1:c.55A>G:p.(Met19Val)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.968 (D); Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: TOPMed: 0.0008%

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.175 to Familial isolated dilated cardiomyopathy associated with TNNI3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0000982, Palmoplantar keratoderma; HP:0010055, Broad hallux - HP:0000982, Palmoplantar keratoderma

Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification; HP:0011304, Broad thumb - MP:0004351, short humerus; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

Known diseases:: OMIM:115210 Cardiomyopathy, familial restrictive, 1 - autosomal dominant; OMIM:611880 ?Cardiomyopathy, dilated, 2A (unconfirmed); OMIM:613286 Cardiomyopathy, dilated, 1FF - unknown; OMIM:613690 Cardiomyopathy, hypertrophic, 7 - autosomal dominant; ORPHA:154 Familial isolated dilated cardiomyopathy - autosomal recessive; ORPHA:154 Familial isolated dilated cardiomyopathy - autosomal dominant/recessive; ORPHA:75249 Familial isolated restrictive cardiomyopathy - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.175 to ORPHA:154 Familial isolated dilated cardiomyopathy

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 19-55665480-T-TAG [0/1]

Exomiser ACMG: PATHOGENIC [PVS1, PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TNNI3:ENST00000344887.5:c.466_467insCT:p.(Gln156Profs*22); TNNI3:ENST00000588882.1:c.391_392insCT:p.(Gln131Profs*22)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.306 to mouse mutant involving FOXD4L5.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to TFAP2A and phenotypic similarity 0.595 to Branchiooculofacial syndrome associated with TFAP2A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

Proximity score 0.504 in interactome to TFAP2A and phenotypic similarity 0.737 to mouse mutant of TFAP2A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Proximity score 0.504 in interactome to TFAP2A and phenotypic similarity 0.330 to fish mutant of TFAP2A.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0001979, ethmoid cartilage split, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 9-70177470-C-T [0/1] rs1392611807

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FOXD4L5:ENST00000377420.1:c.514G>A:p.(Glu172Lys)

Pathogenicity Data:: Best Score: 0.999993; Polyphen2: 0.955 (P); Mutation Taster: 1.000 (P); SIFT: 0.015 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.757

Phenotype Score: 0.516

Variant Score: 0.986

Phenotype matches:

Proximity score 0.516 in interactome to CHST11 and phenotypic similarity 0.832 to ?Osteochondrodysplasia, brachydactyly, and overlapping malformed digits associated with CHST11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009778, Short thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.516 in interactome to CHST11 and phenotypic similarity 0.716 to mouse mutant of CHST11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0000440, domed cranium; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005109, abnormal talus morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.757

Phenotype Score: 0.516

Variant Score: 0.986

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-19356195-C-T [0/1] rs542871862

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.986 CONTRIBUTING VARIANT

Transcripts:: NCAN:ENST00000252575.6:c.3566C>T:p.(Ala1189Val); NCAN:ENST00000538881.1:c.1919C>T:p.(Ala640Val)

Pathogenicity Data:: Best Score: 0.989374; Polyphen2: 0.889 (P); Mutation Taster: 0.989 (P); SIFT: 0.108 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0008%; ExAC AFR: 0.0192%; ExAC EAS: 0.0231%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0065%

Exomiser Score: 0.756

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches:

Proximity score 0.504 in interactome to UBE4B and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with UBE4B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Known diseases:: OMIM:109150 Machado-Joseph disease - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.756

Phenotype Score: 0.504

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 14-92537354-C-CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG [0/1] rs1555397062

Exomiser ACMG: PATHOGENIC [PVS1, PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ATXN3:ENST00000340660.6:c.750_751insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly251Glnfs*39); ATXN3:ENST00000393287.5:c.915_916insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly306Glnfs*39); ATXN3:ENST00000429774.2:c.894_895insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly299Glnfs*39); ATXN3:ENST00000502250.1:c.378_379insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly127Glnfs*39); ATXN3:ENST00000503767.1:c.870_871insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly291Glnfs*39); ATXN3:ENST00000532032.1:c.915_916insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly306Glnfs*39); ATXN3:ENST00000545170.1:c.942_943insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA:p.(Gly315Glnfs*39)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.756

Phenotype Score: 0.505

Variant Score: 0.998

Phenotype matches:

Phenotypic similarity 0.530 to Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies associated with DHX37.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001792, Small nail; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0001792, Small nail; HP:0010055, Broad hallux - HP:0001792, Small nail

Proximity score 0.505 in interactome to DMP1 and phenotypic similarity 0.697 to Autosomal recessive hypophosphatemic rickets associated with DMP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002970, Genu varum; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0002982, Tibial bowing; HP:0010055, Broad hallux - HP:0002970, Genu varum

Proximity score 0.505 in interactome to DMP1 and phenotypic similarity 0.590 to mouse mutant of DMP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000133, abnormal long bone metaphysis morphology; HP:0001363, Craniosynostosis - MP:0000060, delayed bone ossification; HP:0011304, Broad thumb - MP:0000133, abnormal long bone metaphysis morphology; HP:0010055, Broad hallux - MP:0000133, abnormal long bone metaphysis morphology

Known diseases:: OMIM:273250 46, XY sex reversal 11 - autosomal dominant; OMIM:618731 Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies - autosomal recessive; ORPHA:242 46,XY complete gonadal dysgenesis - autosomal dominant/recessive; ORPHA:251510 46,XY partial gonadal dysgenesis - autosomal dominant/recessive; ORPHA:983 Testicular regression syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.756

Phenotype Score: 0.505

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-125438533-C-T [0/1] rs1273451895

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: DHX37:ENST00000308736.2:c.2588G>A:p.(Gly863Glu); DHX37:ENST00000544745.1:c.1949G>A:p.(Gly650Glu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.430 (B); Mutation Taster: 1.000 (P); SIFT: 0.020 (D)

Frequency Data:: TOPMed: 0.0008%; gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.755

Phenotype Score: 0.503

Variant Score: 1.000

Phenotype matches:

Proximity score 0.503 in interactome to PRICKLE1 and phenotypic similarity 0.870 to mouse mutant of PRICKLE1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0030049, prominent forehead; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.755

Phenotype Score: 0.503

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-48691428-C-G [0/1] rs1217703911

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CELSR3:ENST00000164024.4:c.5161G>C:p.(Ala1721Pro); CELSR3:ENST00000544264.1:c.5161G>C:p.(Ala1721Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.943 (P); Mutation Taster: 1.000 (P); SIFT: 0.045 (D)

Frequency Data:: TOPMed: 0.0004%

Exomiser Score: 0.755

Phenotype Score: 0.506

Variant Score: 0.996

Phenotype matches:

Phenotypic similarity 0.498 to mouse mutant involving GGT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006396, decreased long bone epiphyseal plate size; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0003109, short femur; HP:0010055, Broad hallux - MP:0003109, short femur

Proximity score 0.506 in interactome to PCYT1A and phenotypic similarity 0.624 to Spondylometaphyseal dysplasia with cone-rod dystrophy associated with PCYT1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0010049, Short metacarpal; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Known diseases:: OMIM:231950 ?Glutathioninuria (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.755

Phenotype Score: 0.506

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 22-25024072-G-T [0/1] rs199681469

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GGT1:ENST00000248923.4:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000400380.1:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000400382.1:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000400383.1:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000401885.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000403838.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000404223.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000404532.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000404920.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000406383.2:c.1361G>T:p.(Cys454Phe)

Pathogenicity Data:: Best Score: 0.999907; Polyphen2: 0.031 (B); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 22-25023441-C-T [0/1] rs200419006

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.992 CONTRIBUTING VARIANT

Transcripts:: GGT1:ENST00000248923.4:c.1063C>T:p.(Arg355Trp); GGT1:ENST00000400380.1:c.1063C>T:p.(Arg355Trp); GGT1:ENST00000400382.1:c.1063C>T:p.(Arg355Trp); GGT1:ENST00000400383.1:c.1063C>T:p.(Arg355Trp); GGT1:ENST00000401885.1:c.31C>T:p.(Arg11Trp); GGT1:ENST00000403838.1:c.31C>T:p.(Arg11Trp); GGT1:ENST00000404223.1:c.31C>T:p.(Arg11Trp); GGT1:ENST00000404532.1:c.31C>T:p.(Arg11Trp); GGT1:ENST00000404920.1:c.31C>T:p.(Arg11Trp); GGT1:ENST00000406383.2:c.1063C>T:p.(Arg355Trp)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.716 (P); Mutation Taster: 0.945 (P); SIFT: 0.007 (D)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_EAS: 0.0058%; gnomAD_E_SAS: 0.0065%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 22-25024072-G-T [0/1] rs199681469

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GGT1:ENST00000248923.4:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000400380.1:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000400382.1:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000400383.1:c.1361G>T:p.(Cys454Phe); GGT1:ENST00000401885.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000403838.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000404223.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000404532.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000404920.1:c.329G>T:p.(Cys110Phe); GGT1:ENST00000406383.2:c.1361G>T:p.(Cys454Phe)

Pathogenicity Data:: Best Score: 0.999907; Polyphen2: 0.031 (B); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 22-25023540-G-A [0/1] rs761538704

Variant score: 0.967

Transcripts:: GGT1:ENST00000248923.4:c.1162G>A:p.(Ala388Thr); GGT1:ENST00000400380.1:c.1162G>A:p.(Ala388Thr); GGT1:ENST00000400382.1:c.1162G>A:p.(Ala388Thr); GGT1:ENST00000400383.1:c.1162G>A:p.(Ala388Thr); GGT1:ENST00000401885.1:c.130G>A:p.(Ala44Thr); GGT1:ENST00000403838.1:c.130G>A:p.(Ala44Thr); GGT1:ENST00000404223.1:c.130G>A:p.(Ala44Thr); GGT1:ENST00000404532.1:c.130G>A:p.(Ala44Thr); GGT1:ENST00000404920.1:c.130G>A:p.(Ala44Thr); GGT1:ENST00000406383.2:c.1162G>A:p.(Ala388Thr)

Pathogenicity Data:: Best Score: 0.968; Polyphen2: 0.103 (B); Mutation Taster: 0.881; SIFT: 0.032 (D)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_AFR: 0.0083%; gnomAD_E_AMR: 0.0032%; gnomAD_E_NFE: 0.0021%; gnomAD_E_SAS: 0.0035%

MISSENSE_VARIANT SNV 22-25023513-G-A [0/1] rs372075694

Variant score: 0.861

Transcripts:: GGT1:ENST00000248923.4:c.1135G>A:p.(Gly379Arg); GGT1:ENST00000400380.1:c.1135G>A:p.(Gly379Arg); GGT1:ENST00000400382.1:c.1135G>A:p.(Gly379Arg); GGT1:ENST00000400383.1:c.1135G>A:p.(Gly379Arg); GGT1:ENST00000401885.1:c.103G>A:p.(Gly35Arg); GGT1:ENST00000403838.1:c.103G>A:p.(Gly35Arg); GGT1:ENST00000404223.1:c.103G>A:p.(Gly35Arg); GGT1:ENST00000404532.1:c.103G>A:p.(Gly35Arg); GGT1:ENST00000404920.1:c.103G>A:p.(Gly35Arg); GGT1:ENST00000406383.2:c.1135G>A:p.(Gly379Arg)

Pathogenicity Data:: Best Score: 0.862; Polyphen2: 0.005 (B); SIFT: 0.138 (T)

Frequency Data:: TOPMed: 0.0016%; gnomAD_E_AFR: 0.0068%; gnomAD_E_NFE: 0.0036%; gnomAD_E_SAS: 0.0066%

MISSENSE_VARIANT SNV 22-25023471-C-A [0/1] rs201397128

Variant score: 0.846

Transcripts:: GGT1:ENST00000248923.4:c.1093C>A:p.(Pro365Thr); GGT1:ENST00000400380.1:c.1093C>A:p.(Pro365Thr); GGT1:ENST00000400382.1:c.1093C>A:p.(Pro365Thr); GGT1:ENST00000400383.1:c.1093C>A:p.(Pro365Thr); GGT1:ENST00000401885.1:c.61C>A:p.(Pro21Thr); GGT1:ENST00000403838.1:c.61C>A:p.(Pro21Thr); GGT1:ENST00000404223.1:c.61C>A:p.(Pro21Thr); GGT1:ENST00000404532.1:c.61C>A:p.(Pro21Thr); GGT1:ENST00000404920.1:c.61C>A:p.(Pro21Thr); GGT1:ENST00000406383.2:c.1093C>A:p.(Pro365Thr)

Pathogenicity Data:: Best Score: 0.846; Polyphen2: 0.062 (B); SIFT: 0.154 (T)

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 22-25024363-G-A [0/1] rs756886269

Variant score: 0.799

Transcripts:: GGT1:ENST00000248923.4:c.1563+8G>A:p.?; GGT1:ENST00000400380.1:c.1563+8G>A:p.?; GGT1:ENST00000400382.1:c.1563+8G>A:p.?; GGT1:ENST00000400383.1:c.1563+8G>A:p.?; GGT1:ENST00000401885.1:c.531+8G>A:p.?; GGT1:ENST00000403838.1:c.531+8G>A:p.?; GGT1:ENST00000404223.1:c.612+8G>A:p.?; GGT1:ENST00000404532.1:c.531+8G>A:p.?; GGT1:ENST00000404920.1:c.510+8G>A:p.?; GGT1:ENST00000406383.2:c.1563+8G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0026%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0018%; gnomAD_G_NFE: 0.0067%

SPLICE_REGION_VARIANT SNV 22-25024040-G-A [0/1] rs74279113

Variant score: 0.797

Transcripts:: GGT1:ENST00000248923.4:c.1337-8G>A:p.?; GGT1:ENST00000400380.1:c.1337-8G>A:p.?; GGT1:ENST00000400382.1:c.1337-8G>A:p.?; GGT1:ENST00000400383.1:c.1337-8G>A:p.?; GGT1:ENST00000401885.1:c.305-8G>A:p.?; GGT1:ENST00000403838.1:c.305-8G>A:p.?; GGT1:ENST00000404223.1:c.305-8G>A:p.?; GGT1:ENST00000404532.1:c.305-8G>A:p.?; GGT1:ENST00000404920.1:c.305-8G>A:p.?; GGT1:ENST00000406383.2:c.1337-8G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0026%; ESP EA: 0.0234%; ESP All: 0.0155%; ExAC NFE: 0.0032%; gnomAD_E_NFE: 0.0018%

MISSENSE_VARIANT SNV 22-25023537-G-A [0/1] rs768399767

Variant score: 0.785

Transcripts:: GGT1:ENST00000248923.4:c.1159G>A:p.(Val387Ile); GGT1:ENST00000400380.1:c.1159G>A:p.(Val387Ile); GGT1:ENST00000400382.1:c.1159G>A:p.(Val387Ile); GGT1:ENST00000400383.1:c.1159G>A:p.(Val387Ile); GGT1:ENST00000401885.1:c.127G>A:p.(Val43Ile); GGT1:ENST00000403838.1:c.127G>A:p.(Val43Ile); GGT1:ENST00000404223.1:c.127G>A:p.(Val43Ile); GGT1:ENST00000404532.1:c.127G>A:p.(Val43Ile); GGT1:ENST00000404920.1:c.127G>A:p.(Val43Ile); GGT1:ENST00000406383.2:c.1159G>A:p.(Val387Ile)

Pathogenicity Data:: Best Score: 0.786; Polyphen2: 0.006 (B); Mutation Taster: 0.678; SIFT: 0.214 (T)

Frequency Data:: gnomAD_E_AFR: 0.0075%; gnomAD_E_AMR: 0.0093%; gnomAD_E_NFE: 0.0058%

MISSENSE_VARIANT SNV 22-25023459-G-A [0/1] rs138813205

Variant score: 0.693

Transcripts:: GGT1:ENST00000248923.4:c.1081G>A:p.(Asp361Asn); GGT1:ENST00000400380.1:c.1081G>A:p.(Asp361Asn); GGT1:ENST00000400382.1:c.1081G>A:p.(Asp361Asn); GGT1:ENST00000400383.1:c.1081G>A:p.(Asp361Asn); GGT1:ENST00000401885.1:c.49G>A:p.(Asp17Asn); GGT1:ENST00000403838.1:c.49G>A:p.(Asp17Asn); GGT1:ENST00000404223.1:c.49G>A:p.(Asp17Asn); GGT1:ENST00000404532.1:c.49G>A:p.(Asp17Asn); GGT1:ENST00000404920.1:c.49G>A:p.(Asp17Asn); GGT1:ENST00000406383.2:c.1081G>A:p.(Asp361Asn)

Pathogenicity Data:: Best Score: 0.694; Polyphen2: 0.002 (B); SIFT: 0.306 (T)

Frequency Data:: gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0033%; gnomAD_G_AFR: 0.0117%; gnomAD_G_NFE: 0.0141%

MISSENSE_VARIANT SNV 22-25023492-G-A [0/1] rs71318991

Variant score: 0.457

Transcripts:: GGT1:ENST00000248923.4:c.1114G>A:p.(Glu372Lys); GGT1:ENST00000400380.1:c.1114G>A:p.(Glu372Lys); GGT1:ENST00000400382.1:c.1114G>A:p.(Glu372Lys); GGT1:ENST00000400383.1:c.1114G>A:p.(Glu372Lys); GGT1:ENST00000401885.1:c.82G>A:p.(Glu28Lys); GGT1:ENST00000403838.1:c.82G>A:p.(Glu28Lys); GGT1:ENST00000404223.1:c.82G>A:p.(Glu28Lys); GGT1:ENST00000404532.1:c.82G>A:p.(Glu28Lys); GGT1:ENST00000404920.1:c.82G>A:p.(Glu28Lys); GGT1:ENST00000406383.2:c.1114G>A:p.(Glu372Lys)

Pathogenicity Data:: Best Score: 0.798; Polyphen2: 0.069 (B); SIFT: 0.202 (T)

Frequency Data:: 1000Genomes: 0.5990%; TOPMed: 0.8210%; ESP AA: 0.2729%; ESP EA: 1.4109%; ESP All: 1.0251%; gnomAD_E_AFR: 0.2311%; gnomAD_E_AMR: 0.4946%; gnomAD_E_EAS: 0.0464%; gnomAD_E_FIN: 0.5790%; gnomAD_E_NFE: 1.2071%; gnomAD_E_OTH: 0.8775%; gnomAD_E_SAS: 1.4254%; gnomAD_G_AFR: 0.3216%; gnomAD_G_AMR: 0.9592%; gnomAD_G_FIN: 0.6300%; gnomAD_G_NFE: 1.3012%; gnomAD_G_OTH: 0.8180%

SYNONYMOUS_VARIANT SNV 22-25024136-A-G [0/1] rs558411910

Variant score: 0.099

Transcripts:: GGT1:ENST00000248923.4:c.1425A>G:p.(=); GGT1:ENST00000400380.1:c.1425A>G:p.(=); GGT1:ENST00000400382.1:c.1425A>G:p.(=); GGT1:ENST00000400383.1:c.1425A>G:p.(=); GGT1:ENST00000401885.1:c.393A>G:p.(=); GGT1:ENST00000403838.1:c.393A>G:p.(=); GGT1:ENST00000404223.1:c.393A>G:p.(=); GGT1:ENST00000404532.1:c.393A>G:p.(=); GGT1:ENST00000406383.2:c.1425A>G:p.(=); GGT1:ENST00000404920.1:c.360+33A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0072%; gnomAD_E_NFE: 0.0063%; gnomAD_G_AFR: 0.0115%; gnomAD_G_NFE: 0.0134%; gnomAD_G_OTH: 0.1020%

SYNONYMOUS_VARIANT SNV 22-25023903-C-T [0/1] rs1041998

Variant score: 0.095

Transcripts:: GGT1:ENST00000248923.4:c.1293C>T:p.(=); GGT1:ENST00000400380.1:c.1293C>T:p.(=); GGT1:ENST00000400382.1:c.1293C>T:p.(=); GGT1:ENST00000400383.1:c.1293C>T:p.(=); GGT1:ENST00000401885.1:c.261C>T:p.(=); GGT1:ENST00000403838.1:c.261C>T:p.(=); GGT1:ENST00000404223.1:c.261C>T:p.(=); GGT1:ENST00000404532.1:c.261C>T:p.(=); GGT1:ENST00000404920.1:c.261C>T:p.(=); GGT1:ENST00000406383.2:c.1293C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0200%; ESP AA: 0.0227%; ESP EA: 0.1395%; ESP All: 0.1000%; ExAC AFR: 0.0485%; ExAC AMR: 0.1037%; ExAC FIN: 0.1058%; ExAC NFE: 0.3389%; ExAC SAS: 0.1211%; gnomAD_E_AMR: 0.0209%; gnomAD_E_FIN: 0.0494%; gnomAD_E_NFE: 0.0741%; gnomAD_E_SAS: 0.0163%; gnomAD_G_NFE: 0.0402%; gnomAD_G_OTH: 0.1022%

SYNONYMOUS_VARIANT SNV 22-25024076-G-A [0/1] rs369713123

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.085

Transcripts:: GGT1:ENST00000248923.4:c.1365G>A:p.(=); GGT1:ENST00000400380.1:c.1365G>A:p.(=); GGT1:ENST00000400382.1:c.1365G>A:p.(=); GGT1:ENST00000400383.1:c.1365G>A:p.(=); GGT1:ENST00000401885.1:c.333G>A:p.(=); GGT1:ENST00000403838.1:c.333G>A:p.(=); GGT1:ENST00000404223.1:c.333G>A:p.(=); GGT1:ENST00000404532.1:c.333G>A:p.(=); GGT1:ENST00000404920.1:c.333G>A:p.(=); GGT1:ENST00000406383.2:c.1365G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0299%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0106%; ExAC AMR: 0.0087%; ExAC EAS: 0.7548%; gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0119%; gnomAD_E_EAS: 0.6785%; gnomAD_E_NFE: 0.0009%; gnomAD_G_AFR: 0.0115%; gnomAD_G_EAS: 0.6180%

Exomiser Score: 0.754

Phenotype Score: 0.503

Variant Score: 1.000

Phenotype matches:

Proximity score 0.503 in interactome to ARL3 and phenotypic similarity 0.613 to Joubert syndrome associated with ARL3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.503 in interactome to ARL3 and phenotypic similarity 0.265 to mouse mutant of ARL3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0008518, retinal outer nuclear layer degeneration; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.754

Phenotype Score: 0.503

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT INS 13-21734127-C-CACTTTTTTCCAACTGCTGGATGATGGGGCTGGGAGTGGCAAAAACATTATCATTGAGCCTGGATTCTG [0/1] rs770546849

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: SKA3:ENST00000314759.5:c.830-2_830-1insCAGAATCCAGGCTCAATGATAATGTTTTTGCCACTCCCAGCCCCATCATCCAGCAGTTGGAAAAAAGT:p.?; SKA3:ENST00000400018.3:c.830-2_830-1insCAGAATCCAGGCTCAATGATAATGTTTTTGCCACTCCCAGCCCCATCATCCAGCAGTTGGAAAAAAGT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.509

Phenotype Score: 0.503

Variant Score: 0.882

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT INS 13-21734127-C-CACTTTTTTCCAACTGCTGGATGATGGGGCTGGGAGTGGCAAAAACATTATCATTGAGCCTGGATTCTG [0/1] rs770546849

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: SKA3:ENST00000314759.5:c.830-2_830-1insCAGAATCCAGGCTCAATGATAATGTTTTTGCCACTCCCAGCCCCATCATCCAGCAGTTGGAAAAAAGT:p.?; SKA3:ENST00000400018.3:c.830-2_830-1insCAGAATCCAGGCTCAATGATAATGTTTTTGCCACTCCCAGCCCCATCATCCAGCAGTTGGAAAAAAGT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT INS 13-21732267-A-ATGCTGTTCTTTGTAGATGGAATTTTCAAACCAGGAGTACAGAATGTAGGTACCAAAGGAGAG [0/1] rs748913598

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.764 CONTRIBUTING VARIANT

Transcripts:: SKA3:ENST00000314759.5:c.916-4_916-3insCTCTCCTTTGGTACCTACATTCTGTACTCCTGGTTTGAAAATTCCATCTACAAAGAACAGCA:p.?; SKA3:ENST00000400018.3:c.916-4_916-3insCTCTCCTTTGGTACCTACATTCTGTACTCCTGGTTTGAAAATTCCATCTACAAAGAACAGCA:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0118%; gnomAD_E_FIN: 0.0322%; gnomAD_E_NFE: 0.0367%; gnomAD_E_OTH: 0.0186%; gnomAD_E_SAS: 0.0066%; gnomAD_G_EAS: 0.2528%; gnomAD_G_FIN: 0.2900%; gnomAD_G_NFE: 0.0472%; gnomAD_G_OTH: 0.2070%

Exomiser Score: 0.753

Phenotype Score: 0.506

Variant Score: 0.996

Phenotype matches:

Phenotypic similarity 0.274 to Neuronopathy, distal hereditary motor, type IX associated with WARS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb -; HP:0010055, Broad hallux - HP:0001761, Pes cavus

Phenotypic similarity 0.299 to mouse mutant involving WARS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.506 in interactome to TARS1 and phenotypic similarity 0.712 to Trichothiodystrophy associated with TARS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Known diseases:: OMIM:617721 Neuronopathy, distal hereditary motor, type IX - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.753

Phenotype Score: 0.506

Variant Score: 0.996

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.274 to OMIM:617721 Neuronopathy, distal hereditary motor, type IX

Variants contributing to score:

MISSENSE_VARIANT SNV 14-100801285-C-T [0/1] rs751453486

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: WARS1:ENST00000344102.5:c.1220G>A:p.(Arg407Gln); WARS1:ENST00000355338.2:c.1343G>A:p.(Arg448Gln); WARS1:ENST00000358655.4:c.1220G>A:p.(Arg407Gln); WARS1:ENST00000392882.2:c.1343G>A:p.(Arg448Gln); WARS1:ENST00000556645.1:c.1220G>A:p.(Arg407Gln); WARS1:ENST00000557135.1:c.1343G>A:p.(Arg448Gln)

Pathogenicity Data:: Best Score: 0.999993; Polyphen2: 0.048 (B); Mutation Taster: 1.000 (P); SIFT: 0.015 (D)

Frequency Data:: TOPMed: 0.0019%; UK10K: 0.0132%; ExAC FIN: 0.0302%; ExAC NFE: 0.0030%; gnomAD_E_EAS: 0.0058%; gnomAD_E_FIN: 0.0224%; gnomAD_E_NFE: 0.0037%; gnomAD_E_OTH: 0.0183%

Exomiser Score: 0.752

Phenotype Score: 0.502

Variant Score: 1.000

Phenotype matches:

Proximity score 0.502 in interactome to PRKCZ and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with PRKCZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.502 in interactome to PRKCZ and phenotypic similarity 0.276 to mouse mutant of PRKCZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.752

Phenotype Score: 0.502

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-165381543-C-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GRB14:ENST00000263915.3:c.649G>T:p.(Gly217Cys); GRB14:ENST00000543549.1:c.388G>T:p.(Gly130Cys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.827 (P); Mutation Taster: 1.000 (P); SIFT: 0.003 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.751

Phenotype Score: 0.516

Variant Score: 0.983

Phenotype matches:

Proximity score 0.516 in interactome to SPRY4 and phenotypic similarity 0.295 to Kallmann syndrome associated with SPRY4.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb -; HP:0010055, Broad hallux - HP:0001761, Pes cavus

Proximity score 0.516 in interactome to SPRY4 and phenotypic similarity 0.911 to mouse mutant of SPRY4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.751

Phenotype Score: 0.516

Variant Score: 0.983

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-70965039-C-T [0/1] rs370761961

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.983 CONTRIBUTING VARIANT

Transcripts:: PTPRB:ENST00000261266.5:c.2483G>A:p.(Arg828His); PTPRB:ENST00000334414.6:c.3137G>A:p.(Arg1046His); PTPRB:ENST00000451516.2:c.2213G>A:p.(Arg738His); PTPRB:ENST00000538708.1:c.2483G>A:p.(Arg828His); PTPRB:ENST00000550358.1:c.2873G>A:p.(Arg958His); PTPRB:ENST00000550857.1:c.2213G>A:p.(Arg738His); PTPRB:ENST00000551525.1:c.3134G>A:p.(Arg1045His)

Pathogenicity Data:: Best Score: 0.992; Polyphen2: 0.707 (P); SIFT: 0.008 (D)

Frequency Data:: TOPMed: 0.0034%; ExAC AFR: 0.0104%; ExAC EAS: 0.0235%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0174%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0366%; gnomAD_G_AFR: 0.0115%; gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.611

Phenotype Score: 0.516

Variant Score: 0.912

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-70965039-C-T [0/1] rs370761961

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.983 CONTRIBUTING VARIANT

Transcripts:: PTPRB:ENST00000261266.5:c.2483G>A:p.(Arg828His); PTPRB:ENST00000334414.6:c.3137G>A:p.(Arg1046His); PTPRB:ENST00000451516.2:c.2213G>A:p.(Arg738His); PTPRB:ENST00000538708.1:c.2483G>A:p.(Arg828His); PTPRB:ENST00000550358.1:c.2873G>A:p.(Arg958His); PTPRB:ENST00000550857.1:c.2213G>A:p.(Arg738His); PTPRB:ENST00000551525.1:c.3134G>A:p.(Arg1045His)

Pathogenicity Data:: Best Score: 0.992; Polyphen2: 0.707 (P); SIFT: 0.008 (D)

Frequency Data:: TOPMed: 0.0034%; ExAC AFR: 0.0104%; ExAC EAS: 0.0235%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0174%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0366%; gnomAD_G_AFR: 0.0115%; gnomAD_G_EAS: 0.0617%

MISSENSE_VARIANT SNV 12-70932745-G-A [0/1] rs138916804

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.841 CONTRIBUTING VARIANT

Transcripts:: PTPRB:ENST00000261266.5:c.5174C>T:p.(Pro1725Leu); PTPRB:ENST00000334414.6:c.5828C>T:p.(Pro1943Leu); PTPRB:ENST00000451516.2:c.4904C>T:p.(Pro1635Leu); PTPRB:ENST00000538708.1:c.4904C>T:p.(Pro1635Leu); PTPRB:ENST00000550358.1:c.5564C>T:p.(Pro1855Leu); PTPRB:ENST00000550857.1:c.4904C>T:p.(Pro1635Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.260 (B); Mutation Taster: 1.000 (P); SIFT: 0.070 (T)

Frequency Data:: 1000Genomes: 0.0998%; TOPMed: 0.0249%; ExAC EAS: 0.7773%; ExAC NFE: 0.0048%; gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.6796%; gnomAD_E_NFE: 0.0018%; gnomAD_G_AFR: 0.0115%; gnomAD_G_EAS: 0.6173%; gnomAD_G_OTH: 0.1018%

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:

Proximity score 0.501 in interactome to PIBF1 and phenotypic similarity 0.613 to Joubert syndrome associated with PIBF1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.501 in interactome to PIBF1 and phenotypic similarity 0.278 to mouse mutant of PIBF1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_VARIANT DEL 19-9012897-AG-A [0/1] rs1269236781

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: MUC16:ENST00000397910.4:c.38546del:p.(Ser12849Leufs*61)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.638

Phenotype Score: 0.501

Variant Score: 0.941

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_VARIANT DEL 19-9012897-AG-A [0/1] rs1269236781

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: MUC16:ENST00000397910.4:c.38546del:p.(Ser12849Leufs*61)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-9000169-C-T [0/1] rs1419006271

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.883 CONTRIBUTING VARIANT

Transcripts:: MUC16:ENST00000380951.5:c.511G>A:p.(Gly171Ser); MUC16:ENST00000397910.4:c.40588G>A:p.(Gly13530Ser)

Pathogenicity Data:: Best Score: 0.947; SIFT: 0.053 (D)

Frequency Data:: gnomAD_G_AFR: 0.2033%; gnomAD_G_AMR: 0.1462%; gnomAD_G_EAS: 0.4058%; gnomAD_G_FIN: 0.0353%; gnomAD_G_NFE: 0.0369%

Other passed variants:

MISSENSE_VARIANT SNV 19-9015374-C-T [0/1] rs762855876

Variant score: 0.699

Transcripts:: MUC16:ENST00000397910.4:c.38214G>A:p.(Met12738Ile)

Pathogenicity Data:: Best Score: 0.849; SIFT: 0.151 (T)

Frequency Data:: gnomAD_G_AFR: 0.5814%; gnomAD_G_AMR: 0.3268%; gnomAD_G_EAS: 0.1471%; gnomAD_G_FIN: 0.8368%; gnomAD_G_NFE: 0.2994%; gnomAD_G_OTH: 0.2370%

MISSENSE_VARIANT SNV 19-9000187-C-T [0/1] rs994308141

Variant score: 0.286

Transcripts:: MUC16:ENST00000380951.5:c.493G>A:p.(Val165Ile); MUC16:ENST00000397910.4:c.40570G>A:p.(Val13524Ile)

Pathogenicity Data:: Best Score: 0.30900002; SIFT: 0.691 (T)

Frequency Data:: gnomAD_G_AFR: 0.3492%; gnomAD_G_AMR: 0.3106%; gnomAD_G_EAS: 0.4401%; gnomAD_G_FIN: 0.1130%; gnomAD_G_NFE: 0.0908%; gnomAD_G_OTH: 0.1214%

SYNONYMOUS_VARIANT SNV 19-9000170-A-G [0/1] rs1160287047

Variant score: 0.093

Transcripts:: MUC16:ENST00000380951.5:c.510T>C:p.(=); MUC16:ENST00000397910.4:c.40587T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.2472%; gnomAD_G_AMR: 0.1458%; gnomAD_G_EAS: 0.4052%; gnomAD_G_FIN: 0.0355%; gnomAD_G_NFE: 0.0516%

SYNONYMOUS_VARIANT SNV 19-9000185-A-G [0/1] rs1467863711

Variant score: 0.093

Transcripts:: MUC16:ENST00000380951.5:c.495T>C:p.(=); MUC16:ENST00000397910.4:c.40572T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.3268%; gnomAD_G_AMR: 0.3021%; gnomAD_G_EAS: 0.4244%; gnomAD_G_FIN: 0.0738%; gnomAD_G_NFE: 0.0748%; gnomAD_G_OTH: 0.1214%

SYNONYMOUS_VARIANT SNV 19-9000194-G-A [0/1] rs1295951744

Variant score: 0.090

Transcripts:: MUC16:ENST00000380951.5:c.486C>T:p.(=); MUC16:ENST00000397910.4:c.40563C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.5561%; gnomAD_G_AMR: 0.3268%; gnomAD_G_EAS: 0.3559%; gnomAD_G_FIN: 0.2268%; gnomAD_G_NFE: 0.0764%; gnomAD_G_OTH: 0.1256%

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:

Proximity score 0.501 in interactome to ATF4 and phenotypic similarity 0.648 to mouse mutant of ATF4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005298, abnormal clavicle morphology; HP:0001363, Craniosynostosis - MP:0030388, large fontanelles; HP:0011304, Broad thumb - MP:0005298, abnormal clavicle morphology; HP:0010055, Broad hallux - MP:0005298, abnormal clavicle morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-64275858-C-T [0/1] rs922516659

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: DAPK2:ENST00000261891.3:c.188G>A:p.(Arg63Gln); DAPK2:ENST00000457488.1:c.188G>A:p.(Arg63Gln); DAPK2:ENST00000558069.1:c.188G>A:p.(Arg63Gln)

Pathogenicity Data:: Best Score: 0.999989; Polyphen2: 0.536 (P); Mutation Taster: 1.000 (P); SIFT: 0.003 (D)

Frequency Data:: TOPMed: 0.0019%; gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 0.999

Phenotype matches:

Proximity score 0.501 in interactome to PRKCZ and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with PRKCZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.501 in interactome to PRKCZ and phenotypic similarity 0.276 to mouse mutant of PRKCZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-73566284-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: LLGL2:ENST00000167462.5:c.1822A>G:p.(Ser608Gly); LLGL2:ENST00000392550.3:c.1822A>G:p.(Ser608Gly); LLGL2:ENST00000577200.1:c.1822A>G:p.(Ser608Gly)

Pathogenicity Data:: Best Score: 0.99909; Polyphen2: 0.212 (B); Mutation Taster: 0.999 (P); SIFT: 0.082 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:

Proximity score 0.501 in interactome to TRIO and phenotypic similarity 0.681 to Intellectual developmental disorder, autosomal dominant 44, with microcephaly associated with TRIO.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-25492246-C-G [0/1] rs1803287195

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CARMIL1:ENST00000329474.6:c.1214C>G:p.(Ser405Cys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.944 (P); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.280 to mouse mutant involving PAK1IP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000455, abnormal maxilla morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to PLCB3 and phenotypic similarity 0.614 to Spondylometaphyseal dysplasia with corneal dystrophy associated with PLCB3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.501 in interactome to PLCB3 and phenotypic similarity 0.332 to fish mutant of PLCB3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0005101, palatoquadrate cartilage curved lateral, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-10704998-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: PAK1IP1:ENST00000379568.3:c.661G>T:p.(Ala221Ser)

Pathogenicity Data:: Best Score: 0.999998; Polyphen2: 0.464 (P); Mutation Taster: 1.000 (P); SIFT: 0.020 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.387 to mouse mutant involving ST18.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003345, decreased rib number; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0003345, decreased rib number; HP:0010055, Broad hallux - MP:0003345, decreased rib number

Proximity score 0.500 in interactome to SOX14 and phenotypic similarity 0.755 to mouse mutant of SOX14.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-53025894-G-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ST18:ENST00000276480.7:c.3008C>T:p.(Pro1003Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.998 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:

Proximity score 0.501 in interactome to SCARF2 and phenotypic similarity 0.704 to Van den Ende-Gupta syndrome associated with SCARF2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0006236, Slender metacarpals; HP:0010055, Broad hallux - HP:0001847, Long hallux

Proximity score 0.501 in interactome to SCARF2 and phenotypic similarity 0.487 to mouse mutant of SCARF2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004357, long tibia; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0004357, long tibia; HP:0010055, Broad hallux - MP:0004357, long tibia

Known diseases:: OMIM:617027 Hyperaldosteronism, familial, type IV - autosomal dominant; ORPHA:64280 Childhood absence epilepsy - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-1268220-G-A [0/1] rs1244044913

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CACNA1H:ENST00000348261.5:c.5456G>A:p.(Arg1819His); CACNA1H:ENST00000358590.4:c.5438G>A:p.(Arg1813His); CACNA1H:ENST00000565831.1:c.5438G>A:p.(Arg1813His)

Pathogenicity Data:: Best Score: 0.999947; Polyphen2: 0.991 (D); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: TOPMed: 0.0008%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.250

Variant Score: 0.514

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-1268220-G-A [0/1] rs1244044913

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CACNA1H:ENST00000348261.5:c.5456G>A:p.(Arg1819His); CACNA1H:ENST00000358590.4:c.5438G>A:p.(Arg1813His); CACNA1H:ENST00000565831.1:c.5438G>A:p.(Arg1813His)

Pathogenicity Data:: Best Score: 0.999947; Polyphen2: 0.991 (D); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: TOPMed: 0.0008%

SYNONYMOUS_VARIANT SNV 16-1270256-C-T [0/1] rs57670193

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]

ClinVar: BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.028 CONTRIBUTING VARIANT

Transcripts:: CACNA1H:ENST00000348261.5:c.6324C>T:p.(=); CACNA1H:ENST00000358590.4:c.6306C>T:p.(=); CACNA1H:ENST00000565831.1:c.6306C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.4593%; TOPMed: 0.0816%; ExAC AMR: 0.0093%; ExAC EAS: 1.8416%; ExAC OTH: 0.1458%; ExAC SAS: 0.0072%; gnomAD_E_AMR: 0.0063%; gnomAD_E_EAS: 1.7876%; gnomAD_E_OTH: 0.0205%; gnomAD_E_SAS: 0.0104%; gnomAD_G_EAS: 1.8496%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to NEK1 and phenotypic similarity 0.813 to Orofaciodigital syndrome type 2 associated with NEK1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0006101, Finger syndactyly; HP:0001363, Craniosynostosis - HP:0410033, Unilateral alveolar cleft of maxilla; HP:0011304, Broad thumb - HP:0010068, Broad first metatarsal; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.500 in interactome to NEK1 and phenotypic similarity 0.541 to mouse mutant of NEK1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology; HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology; HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology; HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-44684481-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZNF197:ENST00000344387.4:c.1859A>G:p.(Lys620Arg); ZNF197:ENST00000396058.1:c.1859A>G:p.(Lys620Arg); ZNF197:ENST00000383744.4:c.770-3502A>G:p.(=); ZNF197:ENST00000383745.2:c.770-3502A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.333 (B); Mutation Taster: 1.000 (P); SIFT: 0.038 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to NHS and phenotypic similarity 0.623 to Nance-Horan syndrome associated with NHS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001500, Broad finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001500, Broad finger; HP:0010055, Broad hallux - HP:0001500, Broad finger

Proximity score 0.500 in interactome to NHS and phenotypic similarity 0.346 to mouse mutant of NHS.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-927016-C-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GET4:ENST00000265857.3:c.326C>G:p.(Ala109Gly); GET4:ENST00000407192.1:c.167C>G:p.(Ala56Gly)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.011 (B); Mutation Taster: 1.000 (P); SIFT: 0.129 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

Phenotype matches:

Proximity score 0.501 in interactome to B3GAT3 and phenotypic similarity 0.761 to Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects associated with B3GAT3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001822, Hallux valgus; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001222, Spatulate thumbs; HP:0010055, Broad hallux - HP:0001822, Hallux valgus

Proximity score 0.501 in interactome to B3GAT3 and phenotypic similarity 0.407 to fish mutant of B3GAT3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0001216, head cuboid, abnormal; HP:0011304, Broad thumb - ZP:0000875, cleithrum malformed, abnormal; HP:0010055, Broad hallux -

Known diseases:: OMIM:138500 Hyperglycinuria - autosomal dominant; OMIM:242600 Iminoglycinuria, digenic - autosomal recessive; ORPHA:42062 Iminoglycinuria - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-45817401-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: SLC6A20:ENST00000353278.4:c.434C>G:p.(Thr145Arg); SLC6A20:ENST00000358525.4:c.434C>G:p.(Thr145Arg); SLC6A20:ENST00000456124.2:c.434C>G:p.(Thr145Arg)

Pathogenicity Data:: Best Score: 0.999254; Polyphen2: 0.974 (D); Mutation Taster: 0.999 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.046

Phenotype Score: 0.501

Variant Score: 0.549

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-45817401-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: SLC6A20:ENST00000353278.4:c.434C>G:p.(Thr145Arg); SLC6A20:ENST00000358525.4:c.434C>G:p.(Thr145Arg); SLC6A20:ENST00000456124.2:c.434C>G:p.(Thr145Arg)

Pathogenicity Data:: Best Score: 0.999254; Polyphen2: 0.974 (D); Mutation Taster: 0.999 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-45817268-G-A [0/1] rs146942696

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.098 CONTRIBUTING VARIANT

Transcripts:: SLC6A20:ENST00000353278.4:c.567C>T:p.(=); SLC6A20:ENST00000358525.4:c.567C>T:p.(=); SLC6A20:ENST00000456124.2:c.567C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0042%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0194%; ExAC NFE: 0.0015%; ExAC OTH: 0.1111%; gnomAD_E_AFR: 0.0065%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0183%; gnomAD_G_AFR: 0.0115%; gnomAD_G_OTH: 0.1018%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to COLGALT1 and phenotypic similarity 0.670 to mouse mutant of COLGALT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000554, abnormal carpal bone morphology; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb - MP:0000554, abnormal carpal bone morphology; HP:0010055, Broad hallux - MP:0000554, abnormal carpal bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-53150581-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ERO1A:ENST00000395686.3:c.159T>G:p.(Ile53Met)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.977 (D); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.245 to mouse mutant involving LEPROT.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0010123, increased bone mineral content; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to RDH10 and phenotypic similarity 0.880 to mouse mutant of RDH10.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0001286, abnormal eye development; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-65886412-C-G [0/1] rs1056216892

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: LEPROT:ENST00000371065.4:c.5C>G:p.(Ala2Gly); LEPROT:ENST00000344610.8:c.-108C>G:p.(=); LEPROT:ENST00000349533.6:c.-108C>G:p.(=); LEPROT:ENST00000371059.3:c.-108C>G:p.(=); LEPROT:ENST00000371060.3:c.-108C>G:p.(=); LEPROT:ENST00000406510.3:c.-728C>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.982 (D); Mutation Taster: 1.000 (P); SIFT: 0.118 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.247 to mouse mutant involving MAL.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001330, abnormal optic nerve morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to ALX3 and phenotypic similarity 0.685 to Frontonasal dysplasia 1 associated with ALX3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0009099, Median cleft palate; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.500 in interactome to ALX3 and phenotypic similarity 0.270 to mouse mutant of ALX3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0009264, failure of eyelid fusion; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-95691550-G-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: MAL:ENST00000309988.4:c.13G>A:p.(Ala5Thr); MAL:ENST00000349807.3:c.13G>A:p.(Ala5Thr); MAL:ENST00000353004.3:c.13G>A:p.(Ala5Thr); MAL:ENST00000354078.3:c.13G>A:p.(Ala5Thr)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.090 (B); Mutation Taster: 0.822; SIFT: 0.000 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to RASA2 and phenotypic similarity 0.642 to Noonan syndrome associated with RASA2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 7-144059763-A-ATGGAGGCTGAGGAGGCCCAGCG [0/1] rs766185415

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ARHGEF5:ENST00000056217.5:c.7_28dup:p.(Ala10Glyfs*2)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to LEMD3 and phenotypic similarity 0.709 to Buschke-Ollendorff syndrome associated with LEMD3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010554, Cutaneous finger syndactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0010554, Cutaneous finger syndactyly; HP:0010055, Broad hallux - HP:0010554, Cutaneous finger syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-58220823-C-T [0/1] rs111346934

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CTDSP2:ENST00000398073.2:c.310G>A:p.(Val104Met); CTDSP2:ENST00000548823.1:c.117+2504G>A:p.(=); CTDSP2:ENST00000547701.1:c.-147G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.316 (B); Mutation Taster: 1.000 (P); SIFT: 0.233 (T)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-58220823-C-T [0/1] rs111346934

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CTDSP2:ENST00000398073.2:c.310G>A:p.(Val104Met); CTDSP2:ENST00000548823.1:c.117+2504G>A:p.(=); CTDSP2:ENST00000547701.1:c.-147G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.316 (B); Mutation Taster: 1.000 (P); SIFT: 0.233 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 12-58220841-C-T [0/1] rs74343811

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CTDSP2:ENST00000398073.2:c.292G>A:p.(Asp98Asn); CTDSP2:ENST00000548823.1:c.117+2486G>A:p.(=); CTDSP2:ENST00000547701.1:c.-165G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.792 (P); Mutation Taster: 1.000 (P); SIFT: 0.063 (T)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 12-58220844-C-T [0/1] rs75591888

Variant score: 0.999

Transcripts:: CTDSP2:ENST00000398073.2:c.289G>A:p.(Glu97Lys); CTDSP2:ENST00000548823.1:c.117+2483G>A:p.(=); CTDSP2:ENST00000547701.1:c.-168G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.000 (B); Mutation Taster: 1.000 (P); SIFT: 0.585 (T)

Frequency Data:: ExAC SAS: 0.0061%; gnomAD_E_SAS: 0.0032%

MISSENSE_VARIANT SNV 12-58220816-A-G [0/1] rs76940645

Variant score: 0.999

Transcripts:: CTDSP2:ENST00000398073.2:c.317T>C:p.(Ile106Thr); CTDSP2:ENST00000548823.1:c.117+2511T>C:p.(=); CTDSP2:ENST00000547701.1:c.-140T>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.766 (P); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: TOPMed: 0.0011%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0065%; gnomAD_E_SAS: 0.0032%

SYNONYMOUS_VARIANT SNV 12-58220809-G-C [0/1] rs78691025

Variant score: 0.100

Transcripts:: CTDSP2:ENST00000398073.2:c.324C>G:p.(=); CTDSP2:ENST00000548823.1:c.117+2518C>G:p.(=); CTDSP2:ENST00000547701.1:c.-133C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

Phenotype matches:

Phenotypic similarity 0.253 to mouse mutant involving PMEL.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0010192, abnormal retinal melanin granule morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.665 to Okur-Chung neurodevelopmental syndrome associated with CSNK2A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0030084, Clinodactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.535 to mouse mutant of CSNK2A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology; HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape; HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology; HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-56351044-G-T [0/1] rs1289606418

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: PMEL:ENST00000360714.4:c.1043C>A:p.(Thr348Asn); PMEL:ENST00000449260.2:c.1043C>A:p.(Thr348Asn); PMEL:ENST00000536427.1:c.1043C>A:p.(Thr348Asn); PMEL:ENST00000539511.1:c.785C>A:p.(Thr262Asn); PMEL:ENST00000548493.1:c.1043C>A:p.(Thr348Asn); PMEL:ENST00000548747.1:c.1043C>A:p.(Thr348Asn); PMEL:ENST00000550464.1:c.785C>A:p.(Thr262Asn); PMEL:ENST00000552882.1:c.1043C>A:p.(Thr348Asn); PMEL:ENST00000550447.1:c.358+1213C>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.895 (P); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.712 to Trichothiodystrophy associated with RNF113A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.262 to mouse mutant of RNF113A.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-95542416-A-G [0/1] rs142133592

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TEKT4:ENST00000295201.4:c.1210A>G:p.(Ile404Val); TEKT4:ENST00000568768.1:n.644-3122T>C:

Pathogenicity Data:: Best Score: 0.999993; Polyphen2: 0.770 (P); Mutation Taster: 1.000 (P); SIFT: 0.014 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.356

Phenotype Score: 0.500

Variant Score: 0.817

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-95542416-A-G [0/1] rs142133592

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TEKT4:ENST00000295201.4:c.1210A>G:p.(Ile404Val); TEKT4:ENST00000568768.1:n.644-3122T>C:

Pathogenicity Data:: Best Score: 0.999993; Polyphen2: 0.770 (P); Mutation Taster: 1.000 (P); SIFT: 0.014 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 2-95542419-G-A [0/1] rs75603622

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.633 CONTRIBUTING VARIANT

Transcripts:: TEKT4:ENST00000295201.4:c.1213G>A:p.(Ala405Thr); TEKT4:ENST00000568768.1:n.644-3125C>T:

Pathogenicity Data:: Best Score: 0.899; Polyphen2: 0.013 (B); SIFT: 0.101 (T)

Frequency Data:: 1000Genomes: 1.1580%; TOPMed: 1.1580%; gnomAD_E_AFR: 0.0133%; gnomAD_E_EAS: 0.0180%; gnomAD_E_FIN: 0.0943%; gnomAD_E_NFE: 0.0036%; gnomAD_E_SAS: 0.0066%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to PRKAR1A and phenotypic similarity 0.684 to Acrodysostosis 1, with or without hormone resistance associated with PRKAR1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0004490, Calvarial hyperostosis; HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger; HP:0010055, Broad hallux - HP:0001847, Long hallux

Proximity score 0.500 in interactome to PRKAR1A and phenotypic similarity 0.852 to mouse mutant of PRKAR1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0003419, delayed endochondral bone ossification; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Known diseases:: OMIM:149700 ?Lacrimal duct defect (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-117156459-C-T [0/1] rs61786651

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: IGSF3:ENST00000318837.6:c.760G>A:p.(Asp254Asn); IGSF3:ENST00000369483.1:c.760G>A:p.(Asp254Asn); IGSF3:ENST00000369486.3:c.760G>A:p.(Asp254Asn)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 1-117156584-T-C [0/1] rs143106517

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: IGSF3:ENST00000318837.6:c.635A>G:p.(Gln212Arg); IGSF3:ENST00000369483.1:c.635A>G:p.(Gln212Arg); IGSF3:ENST00000369486.3:c.635A>G:p.(Gln212Arg)

Pathogenicity Data:: Best Score: 0.999978; Polyphen2: 0.485 (P); Mutation Taster: 1.000 (P); SIFT: 0.137 (T)

Frequency Data:: gnomAD_E_NFE: 0.0009%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-117156459-C-T [0/1] rs61786651

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: IGSF3:ENST00000318837.6:c.760G>A:p.(Asp254Asn); IGSF3:ENST00000369483.1:c.760G>A:p.(Asp254Asn); IGSF3:ENST00000369486.3:c.760G>A:p.(Asp254Asn)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: No frequency data

Other passed variants:

STOP_GAINED SNV 1-117156585-G-A [0/1] rs139013364

Variant score: 1.000

Transcripts:: IGSF3:ENST00000318837.6:c.634C>T:p.(Gln212*); IGSF3:ENST00000369483.1:c.634C>T:p.(Gln212*); IGSF3:ENST00000369486.3:c.634C>T:p.(Gln212*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0009%

MISSENSE_VARIANT SNV 1-117146504-G-A [0/1] rs61786577

Variant score: 1.000

Transcripts:: IGSF3:ENST00000318837.6:c.1426C>T:p.(Arg476Cys); IGSF3:ENST00000369483.1:c.1426C>T:p.(Arg476Cys); IGSF3:ENST00000369486.3:c.1366C>T:p.(Arg456Cys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.007 (D)

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_NFE: 0.0018%

MISSENSE_VARIANT SNV 1-117158909-C-T [0/1] rs201676764

Variant score: 0.999

Transcripts:: IGSF3:ENST00000318837.6:c.214G>A:p.(Val72Ile); IGSF3:ENST00000369483.1:c.214G>A:p.(Val72Ile); IGSF3:ENST00000369486.3:c.214G>A:p.(Val72Ile)

Pathogenicity Data:: Best Score: 0.999686; Polyphen2: 0.060 (B); Mutation Taster: 1.000 (P); SIFT: 0.831 (T)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_AMR: 0.0030%; gnomAD_E_SAS: 0.0033%

MISSENSE_VARIANT SNV 1-117142700-C-A [0/1] rs75947003

Variant score: 0.999

Transcripts:: IGSF3:ENST00000318837.6:c.1952G>T:p.(Ser651Ile); IGSF3:ENST00000369483.1:c.1952G>T:p.(Ser651Ile); IGSF3:ENST00000369486.3:c.1892G>T:p.(Ser631Ile)

Pathogenicity Data:: Best Score: 0.999878; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.230 (T)

Frequency Data:: gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0036%

STOP_GAINED SNV 1-117142868-C-T [0/1] rs61730489

ClinVar: PATHOGENIC (criteria provided, single submitter)

Variant score: 0.998

Transcripts:: IGSF3:ENST00000318837.6:c.1784G>A:p.(Trp595*); IGSF3:ENST00000369483.1:c.1784G>A:p.(Trp595*); IGSF3:ENST00000369486.3:c.1724G>A:p.(Trp575*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0016%; gnomAD_E_NFE: 0.0009%; gnomAD_G_AFR: 0.0114%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 1-117146563-G-A [0/1] rs61786578

Variant score: 0.997

Transcripts:: IGSF3:ENST00000318837.6:c.1367C>T:p.(Thr456Met); IGSF3:ENST00000369483.1:c.1367C>T:p.(Thr456Met); IGSF3:ENST00000369486.3:c.1307C>T:p.(Thr436Met)

Pathogenicity Data:: Best Score: 0.997634; Polyphen2: 0.293 (B); Mutation Taster: 0.998 (P); SIFT: 0.051 (D)

Frequency Data:: TOPMed: 0.0045%; gnomAD_E_NFE: 0.0045%; gnomAD_E_SAS: 0.0032%

MISSENSE_VARIANT SNV 1-117146592-C-G [0/1] rs532709767

Variant score: 0.995

Transcripts:: IGSF3:ENST00000318837.6:c.1338G>C:p.(Glu446Asp); IGSF3:ENST00000369483.1:c.1338G>C:p.(Glu446Asp); IGSF3:ENST00000369486.3:c.1278G>C:p.(Glu426Asp)

Pathogenicity Data:: Best Score: 0.995157; Polyphen2: 0.014 (B); Mutation Taster: 0.995 (P); SIFT: 0.307 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 1-117146585-G-A [0/1] rs968366784

Variant score: 0.995

Transcripts:: IGSF3:ENST00000318837.6:c.1345C>T:p.(Arg449Cys); IGSF3:ENST00000369483.1:c.1345C>T:p.(Arg449Cys); IGSF3:ENST00000369486.3:c.1285C>T:p.(Arg429Cys)

Pathogenicity Data:: Best Score: 0.99601; Polyphen2: 0.790 (P); Mutation Taster: 0.996 (P); SIFT: 0.050 (D)

Frequency Data:: TOPMed: 0.0015%; gnomAD_E_SAS: 0.0065%

MISSENSE_VARIANT SNV 1-117158972-A-G [0/1] rs3965246

Variant score: 0.995

Transcripts:: IGSF3:ENST00000318837.6:c.151T>C:p.(Ser51Pro); IGSF3:ENST00000369483.1:c.151T>C:p.(Ser51Pro); IGSF3:ENST00000369486.3:c.151T>C:p.(Ser51Pro)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.035 (B); SIFT: 0.005 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 1-117150736-C-G [0/1] rs61786589

Variant score: 0.984

Transcripts:: IGSF3:ENST00000318837.6:c.1050G>C:p.(Lys350Asn); IGSF3:ENST00000369483.1:c.1050G>C:p.(Lys350Asn); IGSF3:ENST00000369486.3:c.1050G>C:p.(Lys350Asn)

Pathogenicity Data:: Best Score: 0.984; Polyphen2: 0.024 (B); SIFT: 0.016 (D)

Frequency Data:: gnomAD_E_AMR: 0.0030%; gnomAD_E_SAS: 0.0032%

MISSENSE_VARIANT SNV 1-117146629-T-C [0/1] rs1553213423

Variant score: 0.973

Transcripts:: IGSF3:ENST00000318837.6:c.1301A>G:p.(Glu434Gly); IGSF3:ENST00000369483.1:c.1301A>G:p.(Glu434Gly); IGSF3:ENST00000369486.3:c.1241A>G:p.(Glu414Gly)

Pathogenicity Data:: Best Score: 0.973426; Polyphen2: 0.403 (B); Mutation Taster: 0.973 (P); SIFT: 0.124 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 1-117142736-A-G [0/1] rs75067537

Variant score: 0.946

Transcripts:: IGSF3:ENST00000318837.6:c.1916T>C:p.(Ile639Thr); IGSF3:ENST00000369483.1:c.1916T>C:p.(Ile639Thr); IGSF3:ENST00000369486.3:c.1856T>C:p.(Ile619Thr)

Pathogenicity Data:: Best Score: 0.999675; Polyphen2: 0.164 (B); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: 1000Genomes: 0.1997%; TOPMed: 0.1997%; ExAC AFR: 0.0971%; ExAC AMR: 0.0699%; ExAC EAS: 0.0701%; ExAC FIN: 0.0156%; ExAC NFE: 0.0347%; ExAC OTH: 0.3348%; ExAC SAS: 0.0489%; gnomAD_E_AFR: 0.0393%; gnomAD_E_AMR: 0.1074%; gnomAD_E_EAS: 0.0466%; gnomAD_E_NFE: 0.0243%; gnomAD_E_OTH: 0.0913%; gnomAD_E_SAS: 0.0261%; gnomAD_G_AFR: 0.1048%; gnomAD_G_AMR: 0.1205%; gnomAD_G_EAS: 0.0623%

MISSENSE_VARIANT SNV 1-117142641-G-A [0/1] rs76417519

Variant score: 0.897

Transcripts:: IGSF3:ENST00000318837.6:c.2011C>T:p.(Arg671Trp); IGSF3:ENST00000369483.1:c.2011C>T:p.(Arg671Trp); IGSF3:ENST00000369486.3:c.1951C>T:p.(Arg651Trp)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.003 (D)

Frequency Data:: gnomAD_E_AFR: 0.1326%; gnomAD_E_AMR: 0.1387%; gnomAD_E_EAS: 0.1428%; gnomAD_E_FIN: 0.5665%; gnomAD_E_NFE: 0.3553%; gnomAD_E_OTH: 0.1934%; gnomAD_E_SAS: 0.1694%; gnomAD_G_AFR: 0.0235%; gnomAD_G_AMR: 0.2488%; gnomAD_G_FIN: 0.3088%; gnomAD_G_NFE: 0.1333%

MISSENSE_VARIANT SNV 1-117158898-C-T [0/1] rs186152746

Variant score: 0.785

Transcripts:: IGSF3:ENST00000318837.6:c.225G>A:p.(Met75Ile); IGSF3:ENST00000369483.1:c.225G>A:p.(Met75Ile); IGSF3:ENST00000369486.3:c.225G>A:p.(Met75Ile)

Pathogenicity Data:: Best Score: 0.78499997; Polyphen2: 0.001 (B); SIFT: 0.215 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 1-117156600-T-C [0/1] rs547741844

Variant score: 0.728

Transcripts:: IGSF3:ENST00000318837.6:c.619A>G:p.(Ser207Gly); IGSF3:ENST00000369483.1:c.619A>G:p.(Ser207Gly); IGSF3:ENST00000369486.3:c.619A>G:p.(Ser207Gly)

Pathogenicity Data:: Best Score: 0.728636; Polyphen2: 0.004 (B); Mutation Taster: 0.729

Frequency Data:: TOPMed: 0.0023%; gnomAD_E_AFR: 0.0065%; gnomAD_E_NFE: 0.0018%

MISSENSE_VARIANT SNV 1-117142613-C-T [0/1] rs76151115

Variant score: 0.683

Transcripts:: IGSF3:ENST00000318837.6:c.2039G>A:p.(Arg680Gln); IGSF3:ENST00000369483.1:c.2039G>A:p.(Arg680Gln); IGSF3:ENST00000369486.3:c.1979G>A:p.(Arg660Gln)

Pathogenicity Data:: Best Score: 0.905; Polyphen2: 0.476 (P); Mutation Taster: 0.840; SIFT: 0.095 (T)

Frequency Data:: gnomAD_E_AFR: 0.3207%; gnomAD_E_AMR: 0.1427%; gnomAD_E_EAS: 0.4202%; gnomAD_E_FIN: 1.0340%; gnomAD_E_NFE: 0.3358%; gnomAD_E_OTH: 0.1567%; gnomAD_E_SAS: 0.0703%; gnomAD_G_AFR: 0.1404%; gnomAD_G_AMR: 0.3713%; gnomAD_G_EAS: 0.1918%; gnomAD_G_FIN: 0.2158%; gnomAD_G_NFE: 0.2035%

MISSENSE_VARIANT SNV 1-117142869-A-G [0/1] rs78806598

Variant score: 0.151

Transcripts:: IGSF3:ENST00000318837.6:c.1783T>C:p.(Trp595Arg); IGSF3:ENST00000369483.1:c.1783T>C:p.(Trp595Arg); IGSF3:ENST00000369486.3:c.1723T>C:p.(Trp575Arg)

Pathogenicity Data:: Best Score: 0.15100002; Polyphen2: 0.006 (B); SIFT: 0.849 (T)

Frequency Data:: TOPMed: 0.0068%; ESP EA: 0.0116%; ESP All: 0.0077%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0162%; gnomAD_G_AFR: 0.0115%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 1-117150928-C-T [0/1] rs150982249

Variant score: 0.100

Transcripts:: IGSF3:ENST00000318837.6:c.858G>A:p.(=); IGSF3:ENST00000369483.1:c.858G>A:p.(=); IGSF3:ENST00000369486.3:c.858G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 1-117150933-G-A [0/1] rs115837117

Variant score: 0.100

Transcripts:: IGSF3:ENST00000318837.6:c.853C>T:p.(=); IGSF3:ENST00000369483.1:c.853C>T:p.(=); IGSF3:ENST00000369486.3:c.853C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 1-117146571-A-G [0/1] rs61786579

Variant score: 0.100

Transcripts:: IGSF3:ENST00000318837.6:c.1359T>C:p.(=); IGSF3:ENST00000369483.1:c.1359T>C:p.(=); IGSF3:ENST00000369486.3:c.1299T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_NFE: 0.0009%

SYNONYMOUS_VARIANT SNV 1-117159024-C-T [0/1] rs201692914

Variant score: 0.100

Transcripts:: IGSF3:ENST00000318837.6:c.99G>A:p.(=); IGSF3:ENST00000369483.1:c.99G>A:p.(=); IGSF3:ENST00000369486.3:c.99G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0019%; gnomAD_E_AMR: 0.0030%; gnomAD_E_SAS: 0.0037%

SYNONYMOUS_VARIANT SNV 1-117158934-C-T [0/1] rs200177381

Variant score: 0.100

Transcripts:: IGSF3:ENST00000318837.6:c.189G>A:p.(=); IGSF3:ENST00000369483.1:c.189G>A:p.(=); IGSF3:ENST00000369486.3:c.189G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ExAC AMR: 0.0089%; gnomAD_E_AFR: 0.0069%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0009%

SYNONYMOUS_VARIANT SNV 1-117156418-G-A [0/1] rs111880595

Variant score: 0.100

Transcripts:: IGSF3:ENST00000318837.6:c.801C>T:p.(=); IGSF3:ENST00000369483.1:c.801C>T:p.(=); IGSF3:ENST00000369486.3:c.801C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0034%; ExAC AFR: 0.0105%; ExAC AMR: 0.0087%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0068%; gnomAD_E_AMR: 0.0060%; gnomAD_E_NFE: 0.0018%

SYNONYMOUS_VARIANT SNV 1-117156490-T-C [0/1] rs61786652

Variant score: 0.099

Transcripts:: IGSF3:ENST00000318837.6:c.729A>G:p.(=); IGSF3:ENST00000369483.1:c.729A>G:p.(=); IGSF3:ENST00000369486.3:c.729A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0196%; UK10K: 0.0132%; gnomAD_E_NFE: 0.0269%; gnomAD_G_AFR: 0.0458%; gnomAD_G_NFE: 0.0533%

SYNONYMOUS_VARIANT SNV 1-117142855-C-T [0/1] rs61786568

Variant score: 0.097

Transcripts:: IGSF3:ENST00000318837.6:c.1797G>A:p.(=); IGSF3:ENST00000369483.1:c.1797G>A:p.(=); IGSF3:ENST00000369486.3:c.1737G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0159%; ESP AA: 0.1135%; ESP All: 0.0384%; ExAC AFR: 0.1785%; ExAC AMR: 0.0087%; ExAC EAS: 0.0232%; ExAC NFE: 0.0121%; ExAC SAS: 0.0304%; gnomAD_E_AFR: 0.0655%; gnomAD_E_AMR: 0.0089%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0072%; gnomAD_E_SAS: 0.0097%; gnomAD_G_AFR: 0.0344%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to MMP2 and phenotypic similarity 0.638 to Multicentric osteolysis-nodulosis-arthropathy spectrum associated with MMP2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001230, Broad metacarpals; HP:0001363, Craniosynostosis - HP:0005441, Sclerotic cranial sutures; HP:0011304, Broad thumb - HP:0001230, Broad metacarpals; HP:0010055, Broad hallux - HP:0006234, Osteolysis involving tarsal bones

Proximity score 0.500 in interactome to MMP2 and phenotypic similarity 0.707 to mouse mutant of MMP2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004686, decreased length of long bones; HP:0001363, Craniosynostosis - MP:0003840, abnormal coronal suture morphology; HP:0011304, Broad thumb - MP:0004686, decreased length of long bones; HP:0010055, Broad hallux - MP:0004686, decreased length of long bones

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-36904401-C-T [0/1] rs756663980

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: OSCP1:ENST00000235532.5:c.223G>A:p.(Ala75Thr); OSCP1:ENST00000315643.9:c.253G>A:p.(Ala85Thr); OSCP1:ENST00000354267.3:c.223G>A:p.(Ala75Thr); OSCP1:ENST00000356637.5:c.253G>A:p.(Ala85Thr); OSCP1:ENST00000433045.2:c.88G>A:p.(Ala30Thr)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.855 (P); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to USP7 and phenotypic similarity 0.721 to Hao-Fountain syndrome associated with USP7.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001822, Hallux valgus; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001822, Hallux valgus

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-119037548-C-T [0/1] rs765490964

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: AKAP14:ENST00000334356.2:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371422.1:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371423.2:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371425.4:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371431.3:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000394594.2:c.260C>T:p.(Ser87Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.034 (B); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC NFE: 0.0024%; gnomAD_E_NFE: 0.0025%

X_DOMINANT

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-119037548-C-T [0/1] rs765490964

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: AKAP14:ENST00000334356.2:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371422.1:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371423.2:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371425.4:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000371431.3:c.260C>T:p.(Ser87Leu); AKAP14:ENST00000394594.2:c.260C>T:p.(Ser87Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.034 (B); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC NFE: 0.0024%; gnomAD_E_NFE: 0.0025%

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to PALS1 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with PALS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.500 in interactome to PALS1 and phenotypic similarity 0.331 to fish mutant of PALS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0001253, head surface feature shape, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-132915100-G-A [0/1] rs759083298

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TCERG1L:ENST00000368642.4:c.1357C>T:p.(Arg453Cys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.998 (D); Mutation Taster: 1.000 (P); SIFT: 0.026 (D)

Frequency Data:: TOPMed: 0.0034%

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches:

Phenotypic similarity 0.331 to mouse mutant involving ADAL.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to ADA2 and phenotypic similarity 0.670 to Blackfan-Diamond anemia associated with ADA2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001199, Triphalangeal thumb

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-43641162-G-A [0/1] rs775451578

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: ADAL:ENST00000389651.4:c.691G>A:p.(Gly231Arg); ADAL:ENST00000422466.2:c.691G>A:p.(Gly231Arg); ADAL:ENST00000428046.3:c.610G>A:p.(Gly204Arg); ADAL:ENST00000562188.1:c.691G>A:p.(Gly231Arg)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.998 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC AFR: 0.0097%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0030%; gnomAD_E_SAS: 0.0032%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-43641162-G-A [0/1] rs775451578

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: ADAL:ENST00000389651.4:c.691G>A:p.(Gly231Arg); ADAL:ENST00000422466.2:c.691G>A:p.(Gly231Arg); ADAL:ENST00000428046.3:c.610G>A:p.(Gly204Arg); ADAL:ENST00000562188.1:c.691G>A:p.(Gly231Arg)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.998 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC AFR: 0.0097%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0030%; gnomAD_E_SAS: 0.0032%

SPLICE_DONOR_VARIANT DEL 15-43643240-GTA-G [0/1] rs1312152135

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: ADAL:ENST00000422466.2:c.873+2_873+3del:p.?; ADAL:ENST00000428046.3:c.792+2_792+3del:p.?; ADAL:ENST00000562188.1:c.873+2_873+3del:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_EAS: 0.0098%

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches:

Phenotypic similarity 0.359 to Monilethrix associated with KRT83.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001597, Abnormality of the nail; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001597, Abnormality of the nail; HP:0010055, Broad hallux - HP:0001597, Abnormality of the nail

Proximity score 0.500 in interactome to TGFBR1 and phenotypic similarity 0.749 to Loeys-Dietz syndrome 1 associated with TGFBR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0001166, Arachnodactyly

Proximity score 0.500 in interactome to TGFBR1 and phenotypic similarity 0.952 to mouse mutant of TGFBR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:158000 Monilethrix - autosomal dominant; OMIM:617756 Erythrokeratodermia variabilis et progressiva 5 - autosomal recessive; ORPHA:316 Progressive symmetric erythrokeratodermia - autosomal recessive; ORPHA:573 Monilethrix - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.359 to ORPHA:573 Monilethrix
Phenotypic similarity 0.349 to OMIM:158000 Monilethrix

Variants contributing to score:

MISSENSE_VARIANT SNV 12-52708591-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: KRT83:ENST00000293670.3:c.1306T>C:p.(Ser436Pro)

Pathogenicity Data:: Best Score: 0.999; Polyphen2: 0.999 (D); Mutation Taster: 0.562; SIFT: 0.003 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches:

Proximity score 0.500 in interactome to PRKRA and phenotypic similarity 0.629 to mouse mutant of PRKRA.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-76062366-A-C [0/1] rs1381841956

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: THAP12:ENST00000260045.3:c.1828T>G:p.(Ser610Ala)

Pathogenicity Data:: Best Score: 0.998991; Polyphen2: 0.004 (B); Mutation Taster: 0.999 (P); SIFT: 0.539 (T)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_NFE: 0.0010%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.745

Phenotype Score: 0.500

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-76062366-A-C [0/1] rs1381841956

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: THAP12:ENST00000260045.3:c.1828T>G:p.(Ser610Ala)

Pathogenicity Data:: Best Score: 0.998991; Polyphen2: 0.004 (B); Mutation Taster: 0.999 (P); SIFT: 0.539 (T)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_NFE: 0.0010%

MISSENSE_VARIANT SNV 11-76062520-T-A [0/1] rs1157005460

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: THAP12:ENST00000260045.3:c.1674A>T:p.(Arg558Ser)

Pathogenicity Data:: Best Score: 0.996463; Polyphen2: 0.295 (B); Mutation Taster: 0.996 (P); SIFT: 0.017 (D)

Frequency Data:: gnomAD_E_AMR: 0.0038%

Exomiser Score: 0.747

Phenotype Score: 0.502

Variant Score: 0.997

Phenotype matches:

Phenotypic similarity 0.317 to mouse mutant involving ARHGAP25.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.621 to Mental retardation, X-linked syndromic 16 associated with FGD1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.272 to mouse mutant of FGD1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001297, microphthalmia; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.502

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-69049787-G-T [0/1] rs145839401

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: ARHGAP25:ENST00000295381.3:c.1513G>T:p.(Val505Phe); ARHGAP25:ENST00000409030.3:c.1492G>T:p.(Val498Phe); ARHGAP25:ENST00000409202.3:c.1516G>T:p.(Val506Phe); ARHGAP25:ENST00000409220.1:c.1495G>T:p.(Val499Phe); ARHGAP25:ENST00000467265.1:c.1396G>T:p.(Val466Phe); ARHGAP25:ENST00000479844.1:c.595G>T:p.(Val199Phe)

Pathogenicity Data:: Best Score: 0.999709; Polyphen2: 0.541 (P); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: ExAC EAS: 0.0232%; gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:

Proximity score 0.501 in interactome to YY1 and phenotypic similarity 0.751 to Gabriele-de Vries syndrome associated with YY1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001822, Hallux valgus; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0006094, Finger joint hypermobility; HP:0010055, Broad hallux - HP:0001822, Hallux valgus

Known diseases:: OMIM:110800 Adult i phenotype without cataract - autosomal dominant; OMIM:116700 Cataract 13 with adult i phenotype - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-10529910-C-T [0/1] rs757161386

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: GCNT2:ENST00000379597.3:c.766C>T:p.(His256Tyr); GCNT2:ENST00000495262.1:c.766C>T:p.(His256Tyr); GCNT2:ENST00000410107.1:c.67+20519C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.463 (P); Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0008%; ExAC SAS: 0.0121%; gnomAD_E_SAS: 0.0195%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:

Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003109, short femur; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0003109, short femur; HP:0010055, Broad hallux - MP:0003109, short femur

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-19735202-G-A [0/1] rs767222783

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: LPAR2:ENST00000407877.3:c.919C>T:p.(Arg307Cys); LPAR2:ENST00000542587.1:c.919C>T:p.(Arg307Cys); LPAR2:ENST00000586703.1:c.919C>T:p.(Arg307Cys)

Pathogenicity Data:: Best Score: 0.999621; Polyphen2: 0.899 (P); Mutation Taster: 1.000 (P); SIFT: 0.177 (T)

Frequency Data:: TOPMed: 0.0008%; ExAC NFE: 0.0060%; gnomAD_E_NFE: 0.0054%; gnomAD_E_OTH: 0.0182%; gnomAD_G_NFE: 0.0067%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.044

Phenotype Score: 0.501

Variant Score: 0.544

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-19735202-G-A [0/1] rs767222783

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: LPAR2:ENST00000407877.3:c.919C>T:p.(Arg307Cys); LPAR2:ENST00000542587.1:c.919C>T:p.(Arg307Cys); LPAR2:ENST00000586703.1:c.919C>T:p.(Arg307Cys)

Pathogenicity Data:: Best Score: 0.999621; Polyphen2: 0.899 (P); Mutation Taster: 1.000 (P); SIFT: 0.177 (T)

Frequency Data:: TOPMed: 0.0008%; ExAC NFE: 0.0060%; gnomAD_E_NFE: 0.0054%; gnomAD_E_OTH: 0.0182%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 19-19737422-C-T [0/1] rs202194790

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.090 CONTRIBUTING VARIANT

Transcripts:: LPAR2:ENST00000407877.3:c.672G>A:p.(=); LPAR2:ENST00000542587.1:c.672G>A:p.(=); LPAR2:ENST00000586703.1:c.672G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0189%; ExAC AMR: 0.0087%; ExAC EAS: 0.5389%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.4948%; gnomAD_G_EAS: 0.3083%

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:

Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003109, short femur; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0003109, short femur; HP:0010055, Broad hallux - MP:0003109, short femur

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-85279584-T-G [0/1] rs545074182

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: LPAR3:ENST00000370611.3:c.1007A>C:p.(Gln336Pro); LPAR3:ENST00000440886.1:c.1007A>C:p.(Gln336Pro)

Pathogenicity Data:: Best Score: 0.999853; Polyphen2: 0.368 (B); Mutation Taster: 1.000 (P); SIFT: 0.140 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0200%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.746

Phenotype Score: 0.500

Variant Score: 0.998

Phenotype matches:

Phenotypic similarity 0.296 to mouse mutant involving SCAMP2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001304, cataract; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to ANKH and phenotypic similarity 0.389 to Craniometaphyseal dysplasia associated with ANKH.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004975, Erlenmeyer flask deformity of the femurs; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0004975, Erlenmeyer flask deformity of the femurs; HP:0010055, Broad hallux - HP:0004975, Erlenmeyer flask deformity of the femurs

Proximity score 0.500 in interactome to ANKH and phenotypic similarity 0.698 to mouse mutant of ANKH.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0002932, abnormal joint morphology; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.500

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-75143750-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: SCAMP2:ENST00000268099.9:c.416C>G:p.(Thr139Arg)

Pathogenicity Data:: Best Score: 0.998; Polyphen2: 0.251 (B); SIFT: 0.002 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.745

Phenotype Score: 0.498

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.498 to mouse mutant involving GGT3P.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006396, decreased long bone epiphyseal plate size; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0003109, short femur; HP:0010055, Broad hallux - MP:0003109, short femur

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.745

Phenotype Score: 0.498

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT DEL 22-18769100-AC-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GGT3P:ENST00000412448.1:n.1185+1del:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.745

Phenotype Score: 0.498

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT DEL 22-18769100-AC-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GGT3P:ENST00000412448.1:n.1185+1del:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_DONOR_VARIANT SNV 22-18769650-A-G [0/1] rs62229901

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GGT3P:ENST00000412448.1:n.1027+2T>C:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SPLICE_REGION_VARIANT SNV 22-18767057-A-G [0/1] rs62229896

Variant score: 0.800

Transcripts:: GGT3P:ENST00000412448.1:n.1186-5T>C:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 22-18767059-T-C [0/1] rs62229897

Variant score: 0.800

Transcripts:: GGT3P:ENST00000412448.1:n.1186-7A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 22-18769103-A-G [0/1] rs201251610

Variant score: 0.800

Transcripts:: GGT3P:ENST00000412448.1:n.1184T>C:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.745

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:

Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.656 to Noonan syndrome 1 associated with PTPN11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.540 to mouse mutant of PTPN11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0012514, pectus excavatum; HP:0001363, Craniosynostosis - MP:0010031, abnormal cranium size; HP:0011304, Broad thumb - MP:0012514, pectus excavatum; HP:0010055, Broad hallux - MP:0012514, pectus excavatum

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.745

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55284943-C-A [0/1] rs200854975

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: KIR2DL1:ENST00000291633.7:c.229C>A:p.(His77Asn); KIR2DL1:ENST00000336077.6:c.229C>A:p.(His77Asn); KIR2DL1:ENST00000402254.2:c.35-44046C>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-44046C>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-44046C>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-30403C>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-9431C>A:p.(=)

Pathogenicity Data:: Best Score: 0.999; Polyphen2: 0.710 (P); SIFT: 0.001 (D)

Frequency Data:: ExAC AFR: 0.0098%; ExAC NFE: 0.0016%; gnomAD_E_AFR: 0.0066%; gnomAD_E_NFE: 0.0028%; gnomAD_G_AFR: 0.0131%; gnomAD_G_NFE: 0.0077%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.744

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55284943-C-A [0/1] rs200854975

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: KIR2DL1:ENST00000291633.7:c.229C>A:p.(His77Asn); KIR2DL1:ENST00000336077.6:c.229C>A:p.(His77Asn); KIR2DL1:ENST00000402254.2:c.35-44046C>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-44046C>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-44046C>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-30403C>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-9431C>A:p.(=)

Pathogenicity Data:: Best Score: 0.999; Polyphen2: 0.710 (P); SIFT: 0.001 (D)

Frequency Data:: ExAC AFR: 0.0098%; ExAC NFE: 0.0016%; gnomAD_E_AFR: 0.0066%; gnomAD_E_NFE: 0.0028%; gnomAD_G_AFR: 0.0131%; gnomAD_G_NFE: 0.0077%

MISSENSE_VARIANT SNV 19-55284944-A-T [0/1] rs150190837

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: KIR2DL1:ENST00000291633.7:c.230A>T:p.(His77Leu); KIR2DL1:ENST00000336077.6:c.230A>T:p.(His77Leu); KIR2DL1:ENST00000402254.2:c.35-44045A>T:p.(=); KIR2DL1:ENST00000538269.1:c.35-44045A>T:p.(=); KIR2DL1:ENST00000541392.1:c.35-44045A>T:p.(=); KIR2DL1:ENST00000396284.2:c.35-30402A>T:p.(=); KIR2DL1:ENST00000434419.2:c.716-9430A>T:p.(=)

Pathogenicity Data:: Best Score: 0.998; Polyphen2: 0.147 (B); SIFT: 0.002 (D)

Frequency Data:: ExAC AFR: 0.0098%; ExAC NFE: 0.0016%; gnomAD_E_AFR: 0.0066%; gnomAD_E_NFE: 0.0028%; gnomAD_G_AFR: 0.0131%; gnomAD_G_NFE: 0.0077%

Other passed variants:

MISSENSE_VARIANT SNV 19-55284962-C-G [0/1] rs530076007

Variant score: 0.955

Transcripts:: KIR2DL1:ENST00000291633.7:c.248C>G:p.(Ala83Gly); KIR2DL1:ENST00000336077.6:c.248C>G:p.(Ala83Gly); KIR2DL1:ENST00000402254.2:c.35-44027C>G:p.(=); KIR2DL1:ENST00000538269.1:c.35-44027C>G:p.(=); KIR2DL1:ENST00000541392.1:c.35-44027C>G:p.(=); KIR2DL1:ENST00000396284.2:c.35-30384C>G:p.(=); KIR2DL1:ENST00000434419.2:c.716-9412C>G:p.(=)

Pathogenicity Data:: Best Score: 0.955; Polyphen2: 0.330 (B); SIFT: 0.045 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55284916-G-C [0/1] rs745536485

Variant score: 0.945

Transcripts:: KIR2DL1:ENST00000291633.7:c.202G>C:p.(Asp68His); KIR2DL1:ENST00000336077.6:c.202G>C:p.(Asp68His); KIR2DL1:ENST00000402254.2:c.35-44073G>C:p.(=); KIR2DL1:ENST00000538269.1:c.35-44073G>C:p.(=); KIR2DL1:ENST00000541392.1:c.35-44073G>C:p.(=); KIR2DL1:ENST00000396284.2:c.35-30430G>C:p.(=); KIR2DL1:ENST00000434419.2:c.716-9458G>C:p.(=)

Pathogenicity Data:: Best Score: 0.945; Polyphen2: 0.198 (B); SIFT: 0.055 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55284986-C-A [0/1] rs687485

Variant score: 0.915

Transcripts:: KIR2DL1:ENST00000291633.7:c.272C>A:p.(Thr91Lys); KIR2DL1:ENST00000336077.6:c.272C>A:p.(Thr91Lys); KIR2DL1:ENST00000402254.2:c.35-44003C>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-44003C>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-44003C>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-30360C>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-9388C>A:p.(=)

Pathogenicity Data:: Best Score: 0.921; Polyphen2: 0.841 (P); SIFT: 0.079 (T)

Frequency Data:: ExAC AFR: 0.0392%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0466%; gnomAD_E_NFE: 0.0018%

MISSENSE_VARIANT SNV 19-55286796-G-A [0/1] rs147072532

Variant score: 0.873

Transcripts:: KIR2DL1:ENST00000291633.7:c.550G>A:p.(Asp184Asn); KIR2DL1:ENST00000336077.6:c.550G>A:p.(Asp184Asn); KIR2DL1:ENST00000402254.2:c.35-42193G>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-42193G>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-42193G>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-28550G>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-7578G>A:p.(=)

Pathogenicity Data:: Best Score: 0.878; Polyphen2: 0.014 (B); SIFT: 0.122 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; ExAC SAS: 0.0073%

MISSENSE_VARIANT SNV 19-55286809-G-A [0/1] rs2916003

Variant score: 0.866

Transcripts:: KIR2DL1:ENST00000291633.7:c.563G>A:p.(Gly188Asp); KIR2DL1:ENST00000336077.6:c.563G>A:p.(Gly188Asp); KIR2DL1:ENST00000402254.2:c.35-42180G>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-42180G>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-42180G>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-28537G>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-7565G>A:p.(=)

Pathogenicity Data:: Best Score: 0.949; Polyphen2: 0.369 (B); SIFT: 0.051 (D)

Frequency Data:: 1000Genomes: 0.4992%; TOPMed: 0.4992%; gnomAD_E_AFR: 0.0793%; gnomAD_E_AMR: 0.0032%; gnomAD_G_AFR: 0.0141%

MISSENSE_VARIANT SNV 19-55290108-A-G [0/1] rs75232650

Variant score: 0.840

Transcripts:: KIR2DL1:ENST00000291633.7:c.709A>G:p.(Lys237Glu); KIR2DL1:ENST00000336077.6:c.709A>G:p.(Lys237Glu); KIR2DL1:ENST00000402254.2:c.35-38881A>G:p.(=); KIR2DL1:ENST00000538269.1:c.35-38881A>G:p.(=); KIR2DL1:ENST00000541392.1:c.35-38881A>G:p.(=); KIR2DL1:ENST00000396284.2:c.35-25238A>G:p.(=); KIR2DL1:ENST00000434419.2:c.716-4266A>G:p.(=)

Pathogenicity Data:: Best Score: 0.865; Polyphen2: 0.010 (B); SIFT: 0.135 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0200%; gnomAD_E_AMR: 0.0064%; gnomAD_E_EAS: 0.0710%; gnomAD_E_FIN: 0.0048%; gnomAD_E_NFE: 0.0030%; gnomAD_E_SAS: 0.0120%; gnomAD_G_EAS: 0.1928%

MISSENSE_VARIANT SNV 19-55286769-C-A [0/1] rs111799279

Variant score: 0.828

Transcripts:: KIR2DL1:ENST00000291633.7:c.523C>A:p.(Pro175Thr); KIR2DL1:ENST00000336077.6:c.523C>A:p.(Pro175Thr); KIR2DL1:ENST00000402254.2:c.35-42220C>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-42220C>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-42220C>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-28577C>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-7605C>A:p.(=)

Pathogenicity Data:: Best Score: 0.86300004; Polyphen2: 0.002 (B); SIFT: 0.137 (T)

Frequency Data:: ESP AA: 0.0239%; ESP All: 0.0081%; gnomAD_E_AMR: 0.0257%; gnomAD_E_EAS: 0.0059%; gnomAD_E_NFE: 0.0049%; gnomAD_E_OTH: 0.0206%; gnomAD_E_SAS: 0.0159%; gnomAD_G_AFR: 0.0142%; gnomAD_G_AMR: 0.2653%

MISSENSE_VARIANT SNV 19-55286781-G-A [0/1] rs62121640

Variant score: 0.598

Transcripts:: KIR2DL1:ENST00000291633.7:c.535G>A:p.(Gly179Arg); KIR2DL1:ENST00000336077.6:c.535G>A:p.(Gly179Arg); KIR2DL1:ENST00000402254.2:c.35-42208G>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-42208G>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-42208G>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-28565G>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-7593G>A:p.(=)

Pathogenicity Data:: Best Score: 0.601; Polyphen2: 0.274 (B); SIFT: 0.399 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; ESP EA: 0.0241%; ESP All: 0.0159%; gnomAD_E_AFR: 0.0074%; gnomAD_E_AMR: 0.0064%; gnomAD_E_NFE: 0.0010%; gnomAD_E_SAS: 0.0279%; gnomAD_G_AFR: 0.0141%

MISSENSE_VARIANT SNV 19-55285045-G-T [0/1] rs687885

Variant score: 0.594

Transcripts:: KIR2DL1:ENST00000291633.7:c.331G>T:p.(Val111Leu); KIR2DL1:ENST00000336077.6:c.331G>T:p.(Val111Leu); KIR2DL1:ENST00000402254.2:c.35-43944G>T:p.(=); KIR2DL1:ENST00000538269.1:c.35-43944G>T:p.(=); KIR2DL1:ENST00000541392.1:c.35-43944G>T:p.(=); KIR2DL1:ENST00000396284.2:c.35-30301G>T:p.(=); KIR2DL1:ENST00000434419.2:c.716-9329G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0532%; gnomAD_E_AMR: 0.0031%; gnomAD_E_NFE: 0.0075%; gnomAD_E_SAS: 0.0067%; gnomAD_G_AFR: 0.0749%; gnomAD_G_FIN: 0.0597%; gnomAD_G_NFE: 0.0219%

MISSENSE_VARIANT SNV 19-55286854-A-G [0/1] rs666590

Variant score: 0.584

Transcripts:: KIR2DL1:ENST00000291633.7:c.608A>G:p.(His203Arg); KIR2DL1:ENST00000336077.6:c.608A>G:p.(His203Arg); KIR2DL1:ENST00000402254.2:c.35-42135A>G:p.(=); KIR2DL1:ENST00000538269.1:c.35-42135A>G:p.(=); KIR2DL1:ENST00000541392.1:c.35-42135A>G:p.(=); KIR2DL1:ENST00000396284.2:c.35-28492A>G:p.(=); KIR2DL1:ENST00000434419.2:c.716-7520A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0799%; gnomAD_E_AFR: 0.0707%; gnomAD_E_AMR: 0.0127%; gnomAD_E_NFE: 0.0047%; gnomAD_G_AFR: 0.1781%; gnomAD_G_NFE: 0.0226%

MISSENSE_VARIANT SNV 19-55284976-A-G [0/1] rs79002558

Variant score: 0.583

Transcripts:: KIR2DL1:ENST00000291633.7:c.262A>G:p.(Ser88Gly); KIR2DL1:ENST00000336077.6:c.262A>G:p.(Ser88Gly); KIR2DL1:ENST00000402254.2:c.35-44013A>G:p.(=); KIR2DL1:ENST00000538269.1:c.35-44013A>G:p.(=); KIR2DL1:ENST00000541392.1:c.35-44013A>G:p.(=); KIR2DL1:ENST00000396284.2:c.35-30370A>G:p.(=); KIR2DL1:ENST00000434419.2:c.716-9398A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0799%; ExAC AFR: 0.1371%; ExAC AMR: 0.0355%; ExAC EAS: 0.1868%; ExAC FIN: 0.0312%; ExAC NFE: 0.1022%; ExAC OTH: 0.1147%; gnomAD_E_AFR: 0.0998%; gnomAD_E_AMR: 0.0370%; gnomAD_E_EAS: 0.1348%; gnomAD_E_FIN: 0.0092%; gnomAD_E_NFE: 0.1480%; gnomAD_E_OTH: 0.0566%; gnomAD_G_AFR: 0.0249%; gnomAD_G_EAS: 0.1913%; gnomAD_G_NFE: 0.1622%

FRAMESHIFT_ELONGATION INS 19-55286775-G-GCA [0/1] rs537689412

Variant score: 0.380

Transcripts:: KIR2DL1:ENST00000291633.7:c.529_530insCA:p.(Val177Alafs*75); KIR2DL1:ENST00000336077.6:c.529_530insCA:p.(Val177Alafs*72); KIR2DL1:ENST00000402254.2:c.35-42214_35-42213insCA:p.(=); KIR2DL1:ENST00000538269.1:c.35-42214_35-42213insCA:p.(=); KIR2DL1:ENST00000541392.1:c.35-42214_35-42213insCA:p.(=); KIR2DL1:ENST00000396284.2:c.35-28571_35-28570insCA:p.(=); KIR2DL1:ENST00000434419.2:c.716-7599_716-7598insCA:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 1.1725%; gnomAD_E_AMR: 0.6766%; gnomAD_E_EAS: 0.6586%; gnomAD_E_FIN: 1.7201%; gnomAD_E_NFE: 0.1655%; gnomAD_E_OTH: 0.3689%; gnomAD_E_SAS: 0.2002%; gnomAD_G_AFR: 0.1202%; gnomAD_G_AMR: 0.2778%; gnomAD_G_EAS: 0.2019%; gnomAD_G_FIN: 0.0323%; gnomAD_G_NFE: 0.1043%; gnomAD_G_OTH: 0.1190%

FRAMESHIFT_TRUNCATION DEL 19-55286772-AAG-A [0/1] rs781738613

Variant score: 0.372

Transcripts:: KIR2DL1:ENST00000291633.7:c.527_528del:p.(Lys176Serfs*8); KIR2DL1:ENST00000336077.6:c.527_528del:p.(Lys176Serfs*8); KIR2DL1:ENST00000402254.2:c.35-42216_35-42215del:p.(=); KIR2DL1:ENST00000538269.1:c.35-42216_35-42215del:p.(=); KIR2DL1:ENST00000541392.1:c.35-42216_35-42215del:p.(=); KIR2DL1:ENST00000396284.2:c.35-28573_35-28572del:p.(=); KIR2DL1:ENST00000434419.2:c.716-7601_716-7600del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 1.1449%; gnomAD_E_AMR: 0.6713%; gnomAD_E_EAS: 0.6555%; gnomAD_E_FIN: 1.7296%; gnomAD_E_NFE: 0.1753%; gnomAD_E_OTH: 0.4076%; gnomAD_E_SAS: 0.1871%; gnomAD_G_AFR: 0.1155%; gnomAD_G_AMR: 0.1362%; gnomAD_G_EAS: 0.1948%; gnomAD_G_FIN: 0.0319%; gnomAD_G_NFE: 0.0868%; gnomAD_G_OTH: 0.1157%

MISSENSE_VARIANT SNV 19-55286665-T-A [0/1] rs199644153

Variant score: 0.308

Transcripts:: KIR2DL1:ENST00000291633.7:c.419T>A:p.(Leu140Gln); KIR2DL1:ENST00000336077.6:c.419T>A:p.(Leu140Gln); KIR2DL1:ENST00000402254.2:c.35-42324T>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-42324T>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-42324T>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-28681T>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-7709T>A:p.(=)

Pathogenicity Data:: Best Score: 0.39999998; Polyphen2: 0.001 (B); SIFT: 0.600 (T)

Frequency Data:: gnomAD_E_AFR: 0.0234%; gnomAD_E_AMR: 0.0472%; gnomAD_E_EAS: 0.0305%; gnomAD_E_FIN: 0.9915%; gnomAD_E_NFE: 0.0275%; gnomAD_E_OTH: 0.1511%; gnomAD_E_SAS: 0.0124%; gnomAD_G_AFR: 0.0315%; gnomAD_G_EAS: 0.0684%; gnomAD_G_FIN: 0.0339%; gnomAD_G_NFE: 0.0269%

MISSENSE_VARIANT SNV 19-55284908-T-C [0/1] rs200839187

Variant score: 0.220

Transcripts:: KIR2DL1:ENST00000291633.7:c.194T>C:p.(Met65Thr); KIR2DL1:ENST00000336077.6:c.194T>C:p.(Met65Thr); KIR2DL1:ENST00000402254.2:c.35-44081T>C:p.(=); KIR2DL1:ENST00000538269.1:c.35-44081T>C:p.(=); KIR2DL1:ENST00000541392.1:c.35-44081T>C:p.(=); KIR2DL1:ENST00000396284.2:c.35-30438T>C:p.(=); KIR2DL1:ENST00000434419.2:c.716-9466T>C:p.(=)

Pathogenicity Data:: Best Score: 0.22000003; SIFT: 0.780 (T)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55285053-T-G [0/1] rs76991396

Variant score: 0.100

Transcripts:: KIR2DL1:ENST00000291633.7:c.339T>G:p.(=); KIR2DL1:ENST00000336077.6:c.339T>G:p.(=); KIR2DL1:ENST00000402254.2:c.35-43936T>G:p.(=); KIR2DL1:ENST00000538269.1:c.35-43936T>G:p.(=); KIR2DL1:ENST00000541392.1:c.35-43936T>G:p.(=); KIR2DL1:ENST00000396284.2:c.35-30293T>G:p.(=); KIR2DL1:ENST00000434419.2:c.716-9321T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55284939-A-G [0/1] rs201793527

Variant score: 0.099

Transcripts:: KIR2DL1:ENST00000291633.7:c.225A>G:p.(=); KIR2DL1:ENST00000336077.6:c.225A>G:p.(=); KIR2DL1:ENST00000402254.2:c.35-44050A>G:p.(=); KIR2DL1:ENST00000538269.1:c.35-44050A>G:p.(=); KIR2DL1:ENST00000541392.1:c.35-44050A>G:p.(=); KIR2DL1:ENST00000396284.2:c.35-30407A>G:p.(=); KIR2DL1:ENST00000434419.2:c.716-9435A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0465%; gnomAD_E_AMR: 0.0062%; gnomAD_E_FIN: 0.0046%; gnomAD_E_NFE: 0.0037%; gnomAD_E_SAS: 0.0034%; gnomAD_G_AFR: 0.0133%; gnomAD_G_NFE: 0.0078%

SYNONYMOUS_VARIANT SNV 19-55286822-C-T [0/1] rs28465191

Variant score: 0.099

Transcripts:: KIR2DL1:ENST00000291633.7:c.576C>T:p.(=); KIR2DL1:ENST00000336077.6:c.576C>T:p.(=); KIR2DL1:ENST00000402254.2:c.35-42167C>T:p.(=); KIR2DL1:ENST00000538269.1:c.35-42167C>T:p.(=); KIR2DL1:ENST00000541392.1:c.35-42167C>T:p.(=); KIR2DL1:ENST00000396284.2:c.35-28524C>T:p.(=); KIR2DL1:ENST00000434419.2:c.716-7552C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC EAS: 0.0118%; ExAC NFE: 0.0016%; ExAC SAS: 0.0206%; gnomAD_E_EAS: 0.0062%; gnomAD_E_NFE: 0.0011%; gnomAD_E_SAS: 0.0588%

SYNONYMOUS_VARIANT SNV 19-55284987-G-A [0/1] rs74415453

Variant score: 0.099

Transcripts:: KIR2DL1:ENST00000291633.7:c.273G>A:p.(=); KIR2DL1:ENST00000336077.6:c.273G>A:p.(=); KIR2DL1:ENST00000402254.2:c.35-44002G>A:p.(=); KIR2DL1:ENST00000538269.1:c.35-44002G>A:p.(=); KIR2DL1:ENST00000541392.1:c.35-44002G>A:p.(=); KIR2DL1:ENST00000396284.2:c.35-30359G>A:p.(=); KIR2DL1:ENST00000434419.2:c.716-9387G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; ExAC AFR: 0.0293%; ExAC AMR: 0.0178%; ExAC EAS: 0.0233%; ExAC NFE: 0.0046%; ExAC SAS: 0.0939%; gnomAD_E_AFR: 0.0199%; gnomAD_E_AMR: 0.0092%; gnomAD_E_EAS: 0.0117%; gnomAD_E_NFE: 0.0065%; gnomAD_E_SAS: 0.0907%; gnomAD_G_AFR: 0.0617%; gnomAD_G_NFE: 0.0219%

MISSENSE_VARIANT SNV 19-55285082-T-C [0/1] rs80323556

Variant score: 0.001

Transcripts:: KIR2DL1:ENST00000291633.7:c.368T>C:p.(Ile123Thr); KIR2DL1:ENST00000336077.6:c.368T>C:p.(Ile123Thr); KIR2DL1:ENST00000402254.2:c.35-43907T>C:p.(=); KIR2DL1:ENST00000538269.1:c.35-43907T>C:p.(=); KIR2DL1:ENST00000541392.1:c.35-43907T>C:p.(=); KIR2DL1:ENST00000396284.2:c.35-30264T>C:p.(=); KIR2DL1:ENST00000434419.2:c.716-9292T>C:p.(=)

Pathogenicity Data:: Best Score: 0.001; Polyphen2: 0.001 (B)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; gnomAD_E_AFR: 0.0202%; gnomAD_E_AMR: 0.0159%; gnomAD_G_AFR: 0.0399%

Exomiser Score: 0.745

Phenotype Score: 0.505

Variant Score: 0.991

Phenotype matches:

Proximity score 0.505 in interactome to COL10A1 and phenotypic similarity 0.658 to Metaphyseal chondrodysplasia, Schmid type associated with COL10A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0005819, Short middle phalanx of finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009844, Broad middle phalanx of finger; HP:0010055, Broad hallux - HP:0009844, Broad middle phalanx of finger

Proximity score 0.505 in interactome to COL10A1 and phenotypic similarity 0.579 to mouse mutant of COL10A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology; HP:0001363, Craniosynostosis - MP:0008272, abnormal endochondral bone ossification; HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology; HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.745

Phenotype Score: 0.505

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-139825250-G-A [0/1] rs143147850

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: COL22A1:ENST00000303045.6:c.1258C>T:p.(Arg420Trp); COL22A1:ENST00000435777.1:c.1258C>T:p.(Arg420Trp)

Pathogenicity Data:: Best Score: 0.999879; Polyphen2: 0.990 (D); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: TOPMed: 0.0096%; ESP AA: 0.0454%; ESP All: 0.0154%; ExAC AFR: 0.0192%; ExAC AMR: 0.0086%; ExAC EAS: 0.0231%; ExAC NFE: 0.0030%; ExAC SAS: 0.0182%; gnomAD_E_AFR: 0.0131%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0290%; gnomAD_E_NFE: 0.0027%; gnomAD_E_SAS: 0.0097%; gnomAD_G_EAS: 0.0617%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.744

Phenotype Score: 0.502

Variant Score: 0.996

Phenotype matches:

Proximity score 0.502 in interactome to TAF6 and phenotypic similarity 0.812 to Alazami-Yuan syndrome associated with TAF6.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0010055, Broad hallux; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.502 in interactome to TAF6 and phenotypic similarity 0.257 to mouse mutant of TAF6.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0011965, decreased total retina thickness; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.502

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-105255228-G-A [0/1] rs531335953

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: ATXN7L1:ENST00000388807.4:c.533C>T:p.(Ser178Leu); ATXN7L1:ENST00000419735.3:c.1553C>T:p.(Ser518Leu); ATXN7L1:ENST00000477775.1:c.1181C>T:p.(Ser394Leu)

Pathogenicity Data:: Best Score: 0.998368; Polyphen2: 0.594 (P); Mutation Taster: 0.998 (P); SIFT: 0.005 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0064%; ExAC SAS: 0.0132%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0098%; gnomAD_E_FIN: 0.0133%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0088%

Exomiser Score: 0.744

Phenotype Score: 0.503

Variant Score: 0.994

Phenotype matches:

Proximity score 0.503 in interactome to PTH1R and phenotypic similarity 0.688 to Eiken syndrome associated with PTH1R.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009371, Type A1 brachydactyly; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0001783, Broad metatarsal; HP:0010055, Broad hallux - HP:0001847, Long hallux

Proximity score 0.503 in interactome to PTH1R and phenotypic similarity 0.589 to mouse mutant of PTH1R.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003662, abnormal long bone epiphyseal plate proliferative zone; HP:0001363, Craniosynostosis - MP:0000440, domed cranium; HP:0011304, Broad thumb - MP:0003662, abnormal long bone epiphyseal plate proliferative zone; HP:0010055, Broad hallux - MP:0003662, abnormal long bone epiphyseal plate proliferative zone

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.503

Variant Score: 0.994

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-47041748-A-G [0/1] rs551204127

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.994 CONTRIBUTING VARIANT

Transcripts:: GIP:ENST00000357424.2:c.181T>C:p.(Tyr61His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 0.978 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0023%; ExAC EAS: 0.0347%; gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.744

Phenotype Score: 0.500

Variant Score: 0.997

Phenotype matches:

Proximity score 0.500 in interactome to FGFRL1 and phenotypic similarity 0.778 to mouse mutant of FGFRL1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology; HP:0001363, Craniosynostosis - MP:0010743, delayed cranial suture closure; HP:0011304, Broad thumb - MP:0012514, pectus excavatum; HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology

Proximity score 0.500 in interactome to FGFRL1 and phenotypic similarity 0.313 to fish mutant of FGFRL1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0005133, palatoquadrate cartilage shape, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.500

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-45811650-C-T [0/1] rs201222735

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: TESK2:ENST00000341771.6:c.809G>A:p.(Arg270His); TESK2:ENST00000372084.1:c.809G>A:p.(Arg270His); TESK2:ENST00000372086.3:c.896G>A:p.(Arg299His); TESK2:ENST00000538496.1:c.647G>A:p.(Arg216His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.987 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0011%; ExAC EAS: 0.0232%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.744

Phenotype Score: 0.504

Variant Score: 0.992

Phenotype matches:

Proximity score 0.504 in interactome to RRAS2 and phenotypic similarity 0.642 to Noonan syndrome associated with RRAS2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.504 in interactome to RRAS2 and phenotypic similarity 0.309 to mouse mutant of RRAS2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001326, retinal degeneration; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.504

Variant Score: 0.992

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-49242252-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.992 CONTRIBUTING VARIANT

Transcripts:: RASIP1:ENST00000222145.4:c.788T>G:p.(Leu263Arg)

Pathogenicity Data:: Best Score: 0.992; Polyphen2: 0.638 (P); Mutation Taster: 0.953 (P); SIFT: 0.008 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.743

Phenotype Score: 0.500

Variant Score: 0.996

Phenotype matches:

Proximity score 0.500 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.500 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification; HP:0011304, Broad thumb - MP:0004351, short humerus; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.743

Phenotype Score: 0.500

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

STOP_GAINED SNV 1-151143037-G-A [0/1] rs762963849

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: TMOD4:ENST00000416280.2:c.766C>T:p.(Arg256*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0030%; UK10K: 0.0264%; ExAC AFR: 0.0096%; ExAC NFE: 0.0015%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0027%; gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.742

Phenotype Score: 0.541

Variant Score: 0.950

Phenotype matches:

Phenotypic similarity 0.541 to X-linked non-syndromic intellectual disability associated with FRMPD4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Phenotypic similarity 0.399 to mouse mutant involving FRMPD4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002764, short tibia; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002764, short tibia; HP:0010055, Broad hallux - MP:0002764, short tibia

Known diseases:: OMIM:300983 Intellectual developmental disorder, X-linked 104 - X-linked recessive; ORPHA:777 X-linked non-syndromic intellectual disability - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.742

Phenotype Score: 0.541

Variant Score: 0.950

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to ORPHA:777 X-linked non-syndromic intellectual disability

Variants contributing to score:

MISSENSE_VARIANT SNV X-12734214-C-T [0/1] rs200271818

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.950 CONTRIBUTING VARIANT

Transcripts:: FRMPD4:ENST00000380682.1:c.1636C>T:p.(Leu546Phe)

Pathogenicity Data:: Best Score: 0.964; Polyphen2: 0.075 (B); SIFT: 0.036 (D)

Frequency Data:: 1000Genomes: 0.0795%; TOPMed: 0.0060%; ExAC EAS: 0.0611%; gnomAD_E_EAS: 0.0806%; gnomAD_G_EAS: 0.1041%

Exomiser Score: 0.741

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:

Proximity score 0.500 in interactome to AHSG and phenotypic similarity 0.645 to Alopecia-intellectual disability syndrome associated with AHSG.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to AHSG and phenotypic similarity 0.399 to mouse mutant of AHSG.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002764, short tibia; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002764, short tibia; HP:0010055, Broad hallux - MP:0002764, short tibia

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.741

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-100676720-G-T [1/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: MUC17:ENST00000306151.4:c.2023G>T:p.(Gly675Cys)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.129 (B); SIFT: 0.005 (D)

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.712

Phenotype Score: 0.500

Variant Score: 0.979

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-100684422-T-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.979 CONTRIBUTING VARIANT

Transcripts:: MUC17:ENST00000306151.4:c.9725T>C:p.(Leu3242Pro)

Pathogenicity Data:: Best Score: 0.979; Polyphen2: 0.979 (D); SIFT: 0.098 (T)

Frequency Data:: No frequency data

Other passed variants:

SYNONYMOUS_VARIANT SNV 7-100676713-T-C [0/1] rs140333451

Variant score: 0.100

Transcripts:: MUC17:ENST00000306151.4:c.2016T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0129%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0288%; ExAC AMR: 0.0259%; gnomAD_E_AFR: 0.0261%; gnomAD_E_AMR: 0.0179%; gnomAD_G_AFR: 0.0230%

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:

Proximity score 0.500 in interactome to TFPI and phenotypic similarity 0.614 to mouse mutant of TFPI.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000585, kinked tail; HP:0001363, Craniosynostosis - MP:0000084, abnormal fontanelle morphology; HP:0011304, Broad thumb - MP:0000585, kinked tail; HP:0010055, Broad hallux - MP:0000585, kinked tail

Known diseases:: OMIM:612926 Hemolytic uremic syndrome, atypical, susceptibility to, 6 (susceptibility); OMIM:614486 Thrombophilia due to thrombomodulin defect - unknown

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 20-23028910-G-A [0/1] rs1984633904

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: THBD:ENST00000377103.2:c.1232C>T:p.(Thr411Ile)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.592 (P); SIFT: 0.005 (D)

Frequency Data:: TOPMed: 0.0008%

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:

Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.703 to Neurofacioskeletal syndrome with or without renal agenesis associated with HS2ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0011927, Short digit; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger; HP:0010055, Broad hallux - HP:0010186, Broad distal phalanx of the toes

Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.698 to mouse mutant of HS2ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-53155439-G-A [0/1] rs765793724

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: STXBP4:ENST00000376352.2:c.1189G>A:p.(Glu397Lys); STXBP4:ENST00000434978.2:c.1123G>A:p.(Glu375Lys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.711 (P); Mutation Taster: 1.000 (P); SIFT: 0.021 (D)

Frequency Data:: TOPMed: 0.0019%; ExAC EAS: 0.0233%; ExAC SAS: 0.0063%; gnomAD_E_EAS: 0.0359%; gnomAD_E_SAS: 0.0034%

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:

Proximity score 0.500 in interactome to SEC24C and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with SEC24C.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: KIR3DL1:ENST00000402254.2:c.1089G>C:p.(Trp363Cys)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.995 (D); SIFT: 0.011 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.738

Phenotype Score: 0.500

Variant Score: 0.994

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: KIR3DL1:ENST00000402254.2:c.1089G>C:p.(Trp363Cys)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.995 (D); SIFT: 0.011 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377325-C-T [0/1] rs1338748485

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.993 CONTRIBUTING VARIANT

Transcripts:: KIR3DL1:ENST00000402254.2:c.1066C>T:p.(Leu356Phe)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.993 (D); SIFT: 0.630 (T)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 19-55377343-C-T [0/1] rs138402445

Variant score: 0.982

Transcripts:: KIR3DL1:ENST00000402254.2:c.1084C>T:p.(Arg362Cys)

Pathogenicity Data:: Best Score: 0.982; Polyphen2: 0.724 (P); SIFT: 0.018 (D)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0027%

MISSENSE_VARIANT SNV 19-55331287-G-T [0/1] rs652641

Variant score: 0.981

Transcripts:: KIR3DL1:ENST00000326542.7:c.475G>T:p.(Gly159Trp); KIR3DL1:ENST00000358178.4:c.190G>T:p.(Gly64Trp); KIR3DL1:ENST00000391728.4:c.475G>T:p.(Gly159Trp); KIR3DL1:ENST00000402254.2:c.475G>T:p.(Gly159Trp); KIR3DL1:ENST00000538269.1:c.475G>T:p.(Gly159Trp); KIR3DL1:ENST00000541392.1:c.475G>T:p.(Gly159Trp)

Pathogenicity Data:: Best Score: 0.981; Polyphen2: 0.651 (P); SIFT: 0.019 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377302-T-C [0/1] rs1224475740

Variant score: 0.966

Transcripts:: KIR3DL1:ENST00000402254.2:c.1043T>C:p.(Val348Ala)

Pathogenicity Data:: Best Score: 0.966; Polyphen2: 0.966 (D); SIFT: 0.105 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377265-T-C [0/1] rs796466301

Variant score: 0.866

Transcripts:: KIR3DL1:ENST00000402254.2:c.1006T>C:p.(Cys336Arg)

Pathogenicity Data:: Best Score: 0.866; SIFT: 0.134 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377280-G-A [0/1] rs796782943

Variant score: 0.848

Transcripts:: KIR3DL1:ENST00000402254.2:c.1021G>A:p.(Val341Ile)

Pathogenicity Data:: Best Score: 0.848; Polyphen2: 0.010 (B); SIFT: 0.152 (T)

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 19-55377255-T-C [0/1] rs371490654

Variant score: 0.800

Transcripts:: KIR3DL1:ENST00000402254.2:c.1001-5T>C:p.?; KIR3DL1:ENST00000270442.5:c.950-5T>C:p.?; KIR3DL1:ENST00000326321.3:c.1001-5T>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 19-55377884-C-T [0/1] rs920394404

Variant score: 0.800

Transcripts:: KIR3DL1:ENST00000402254.2:c.1158+7C>T:p.?; KIR3DL1:ENST00000270442.5:c.1107+7C>T:p.?; KIR3DL1:ENST00000326321.3:c.1158+7C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377875-C-G [0/1] rs973541788

Variant score: 0.600

Transcripts:: KIR3DL1:ENST00000402254.2:c.1156C>G:p.(Gln386Glu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377319-C-A [0/1] rs1296399738

Variant score: 0.491

Transcripts:: KIR3DL1:ENST00000402254.2:c.1060C>A:p.(Leu354Ile)

Pathogenicity Data:: Best Score: 0.491; Polyphen2: 0.009 (B); SIFT: 0.509 (T)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55377279-T-C [0/1] rs779666933

Variant score: 0.100

Transcripts:: KIR3DL1:ENST00000402254.2:c.1020T>C:p.(=); KIR3DL1:ENST00000270442.5:c.969T>C:p.(=); KIR3DL1:ENST00000326321.3:c.1020T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55377303-C-T [0/1] rs1359951579

Variant score: 0.100

Transcripts:: KIR3DL1:ENST00000402254.2:c.1044C>T:p.(=); KIR3DL1:ENST00000270442.5:c.993C>T:p.(=); KIR3DL1:ENST00000326321.3:c.1044C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55377853-G-C [0/1] rs540202245

Variant score: 0.100

Transcripts:: KIR3DL1:ENST00000402254.2:c.1134G>C:p.(=); KIR3DL1:ENST00000270442.5:c.1083G>C:p.(=); KIR3DL1:ENST00000326321.3:c.1134G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55377871-T-C [0/1] rs941565211

Variant score: 0.100

Transcripts:: KIR3DL1:ENST00000402254.2:c.1152T>C:p.(=); KIR3DL1:ENST00000270442.5:c.1101T>C:p.(=); KIR3DL1:ENST00000326321.3:c.1152T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377340-T-C [0/1] rs2915987

Variant score: 0.004

Transcripts:: KIR3DL1:ENST00000402254.2:c.1081T>C:p.(Tyr361His)

Pathogenicity Data:: Best Score: 0.004; Polyphen2: 0.004 (B)

Frequency Data:: gnomAD_E_AMR: 0.0060%

MISSENSE_VARIANT SNV 19-55377307-T-A [0/1] rs2915986

Variant score: 0.001

Transcripts:: KIR3DL1:ENST00000402254.2:c.1048T>A:p.(Phe350Ile)

Pathogenicity Data:: Best Score: 0.001; Polyphen2: 0.001 (B)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.740

Phenotype Score: 0.503

Variant Score: 0.992

Phenotype matches:

Proximity score 0.503 in interactome to CANT1 and phenotypic similarity 0.638 to Desbuquois dysplasia 1 associated with CANT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009611, Bifid distal phalanx of the thumb; HP:0010055, Broad hallux - HP:0010097, Partial duplication of the distal phalanx of the hallux

Proximity score 0.503 in interactome to CANT1 and phenotypic similarity 0.315 to mouse mutant of CANT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002111, abnormal tail morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002111, abnormal tail morphology; HP:0010055, Broad hallux - MP:0002111, abnormal tail morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.503

Variant Score: 0.992

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-72495523-G-A [0/1] rs199599246

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.992 CONTRIBUTING VARIANT

Transcripts:: PKM:ENST00000319622.6:c.1147C>T:p.(Arg383Cys); PKM:ENST00000389093.3:c.1147C>T:p.(Arg383Cys); PKM:ENST00000565154.1:c.1147C>T:p.(Arg383Cys); PKM:ENST00000565184.1:c.1147C>T:p.(Arg383Cys); PKM:ENST00000568459.1:c.1147C>T:p.(Arg383Cys); PKM:ENST00000568883.1:c.652C>T:p.(Arg218Cys); PKM:ENST00000335181.5:c.1141-562C>T:p.(=); PKM:ENST00000449901.2:c.1096-562C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.013 (B); Mutation Taster: 1.000 (P); SIFT: 0.081 (T)

Frequency Data:: TOPMed: 0.0072%; ExAC EAS: 0.0579%; ExAC NFE: 0.0015%; ExAC SAS: 0.0061%; gnomAD_E_EAS: 0.0406%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0032%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.739

Phenotype Score: 0.503

Variant Score: 0.991

Phenotype matches:

Proximity score 0.503 in interactome to LMBR1 and phenotypic similarity 0.714 to Triphalangeal thumb, type I associated with LMBR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001830, Postaxial foot polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0005866, Opposable triphalangeal thumb; HP:0010055, Broad hallux - HP:0001841, Preaxial foot polydactyly

Proximity score 0.503 in interactome to LMBR1 and phenotypic similarity 0.806 to mouse mutant of LMBR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis - MP:0000554, abnormal carpal bone morphology; HP:0011304, Broad thumb - MP:0002543, brachyphalangia; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.739

Phenotype Score: 0.503

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-111963935-T-C [0/1] rs758370402

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: OVGP1:ENST00000369732.3:c.866A>G:p.(Lys289Arg); OVGP1:ENST00000540696.1:c.429-1587A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.356 (B); Mutation Taster: 1.000 (P); SIFT: 0.132 (T)

Frequency Data:: TOPMed: 0.0015%; ExAC EAS: 0.0347%; gnomAD_E_EAS: 0.0524%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.738

Phenotype Score: 0.506

Variant Score: 0.987

Phenotype matches:

Proximity score 0.506 in interactome to ASAP1 and phenotypic similarity 0.712 to mouse mutant of ASAP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0003420, delayed intramembranous bone ossification; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.738

Phenotype Score: 0.506

Variant Score: 0.987

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-27309003-C-T [0/1] rs774185140

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.987 CONTRIBUTING VARIANT

Transcripts:: PTK2B:ENST00000338238.4:c.2399C>T:p.(Thr800Met); PTK2B:ENST00000346049.5:c.2525C>T:p.(Thr842Met); PTK2B:ENST00000397497.4:c.1637C>T:p.(Thr546Met); PTK2B:ENST00000397501.1:c.2525C>T:p.(Thr842Met); PTK2B:ENST00000420218.2:c.2399C>T:p.(Thr800Met); PTK2B:ENST00000517339.1:c.2399C>T:p.(Thr800Met); PTK2B:ENST00000544172.1:c.2525C>T:p.(Thr842Met)

Pathogenicity Data:: Best Score: 0.988593; Polyphen2: 0.329 (B); Mutation Taster: 0.989 (P); SIFT: 0.125 (T)

Frequency Data:: TOPMed: 0.0023%; ExAC EAS: 0.0116%; ExAC NFE: 0.0030%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.737

Phenotype Score: 0.500

Variant Score: 0.993

Phenotype matches:

Proximity score 0.500 in interactome to RAC3 and phenotypic similarity 0.624 to Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies associated with RAC3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0030084, Clinodactyly; HP:0001363, Craniosynostosis - HP:0011320, Unilambdoid synostosis; HP:0011304, Broad thumb - HP:0030084, Clinodactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.737

Phenotype Score: 0.500

Variant Score: 0.993

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-74657488-G-A [0/1] rs759179515

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.993 CONTRIBUTING VARIANT

Transcripts:: RTKN:ENST00000233330.6:c.286C>T:p.(Arg96Cys); RTKN:ENST00000272430.5:c.436C>T:p.(Arg146Cys); RTKN:ENST00000305557.5:c.397C>T:p.(Arg133Cys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.946 (P); Mutation Taster: 1.000 (P); SIFT: 0.012 (D)

Frequency Data:: TOPMed: 0.0026%; ExAC EAS: 0.0116%; ExAC SAS: 0.0303%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0520%

Exomiser Score: 0.736

Phenotype Score: 0.501

Variant Score: 0.991

Phenotype matches:

Phenotypic similarity 0.305 to zebrafish mutant involving DDX18.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0000407, head decreased width, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to BMS1 and phenotypic similarity 0.602 to Aplasia cutis congenita associated with BMS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.501 in interactome to BMS1 and phenotypic similarity 0.299 to mouse mutant of BMS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.736

Phenotype Score: 0.501

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-118579477-C-T [0/1] rs1296368068

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: DDX18:ENST00000263239.2:c.791C>T:p.(Ala264Val)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.345 (B); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.044

Phenotype Score: 0.501

Variant Score: 0.545

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-118579477-C-T [0/1] rs1296368068

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: DDX18:ENST00000263239.2:c.791C>T:p.(Ala264Val)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.345 (B); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: gnomAD_G_EAS: 0.0617%

SYNONYMOUS_VARIANT SNV 2-118587005-G-C [0/1] rs751071991

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: DDX18:ENST00000263239.2:c.1833G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0231%; ExAC NFE: 0.0030%; gnomAD_E_EAS: 0.0175%; gnomAD_E_NFE: 0.0018%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.735

Phenotype Score: 0.500

Variant Score: 0.992

Phenotype matches:

Phenotypic similarity 0.318 to mouse mutant involving BAZ2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to BPTF and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with BPTF.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.500 in interactome to BPTF and phenotypic similarity 0.330 to mouse mutant of BPTF.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.735

Phenotype Score: 0.500

Variant Score: 0.992

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-160285729-C-T [0/1] rs991973729

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.992 CONTRIBUTING VARIANT

Transcripts:: BAZ2B:ENST00000343439.5:c.1937G>A:p.(Arg646His); BAZ2B:ENST00000355831.2:c.2237G>A:p.(Arg746His); BAZ2B:ENST00000392782.1:c.2231G>A:p.(Arg744His); BAZ2B:ENST00000392783.2:c.2237G>A:p.(Arg746His)

Pathogenicity Data:: Best Score: 0.993144; Polyphen2: 0.306 (B); Mutation Taster: 0.993 (P); SIFT: 0.028 (D)

Frequency Data:: TOPMed: 0.0096%; gnomAD_E_EAS: 0.0061%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.734

Phenotype Score: 0.500

Variant Score: 0.991

Phenotype matches:

Proximity score 0.500 in interactome to TRIP13 and phenotypic similarity 0.446 to Mosaic variegated aneuploidy syndrome associated with TRIP13.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

Proximity score 0.500 in interactome to TRIP13 and phenotypic similarity 0.695 to mouse mutant of TRIP13.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.734

Phenotype Score: 0.500

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-20846959-G-A [0/1] rs778578770

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: TEP1:ENST00000262715.5:c.5306C>T:p.(Pro1769Leu); TEP1:ENST00000545983.1:c.320C>T:p.(Pro107Leu); TEP1:ENST00000556935.1:c.4982C>T:p.(Pro1661Leu)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.397 (B); Mutation Taster: 1.000 (P); SIFT: 0.011 (D)

Frequency Data:: TOPMed: 0.0011%; ExAC EAS: 0.0347%; ExAC NFE: 0.0015%; ExAC SAS: 0.0121%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0027%; gnomAD_E_SAS: 0.0097%; gnomAD_G_EAS: 0.0617%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.732

Phenotype Score: 0.500

Variant Score: 0.990

Phenotype matches:

Proximity score 0.500 in interactome to AMMECR1 and phenotypic similarity 0.667 to Midface hypoplasia, hearing impairment, elliptocytosis, and nephrocalcinosis associated with AMMECR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.732

Phenotype Score: 0.500

Variant Score: 0.990

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-118196364-C-T [0/1] rs577563045

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.990 CONTRIBUTING VARIANT

Transcripts:: PNLIPRP3:ENST00000369230.3:c.191C>T:p.(Pro64Leu)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.128 (B); SIFT: 0.007 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0015%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0237%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.198

Phenotype Score: 0.500

Variant Score: 0.728

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-118196364-C-T [0/1] rs577563045

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.990 CONTRIBUTING VARIANT

Transcripts:: PNLIPRP3:ENST00000369230.3:c.191C>T:p.(Pro64Leu)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.128 (B); SIFT: 0.007 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0015%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0237%

MISSENSE_VARIANT SNV 10-118228755-G-C [0/1] rs143512460

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.466 CONTRIBUTING VARIANT

Transcripts:: PNLIPRP3:ENST00000369230.3:c.986G>C:p.(Arg329Thr)

Pathogenicity Data:: Best Score: 0.923; Polyphen2: 0.063 (B); SIFT: 0.077 (T)

Frequency Data:: 1000Genomes: 0.2596%; TOPMed: 0.0612%; UK10K: 0.0264%; ESP AA: 0.0227%; ESP EA: 0.0814%; ESP All: 0.0615%; ExAC AFR: 0.0097%; ExAC EAS: 1.5390%; ExAC FIN: 0.0455%; ExAC NFE: 0.0330%; ExAC OTH: 0.3319%; ExAC SAS: 0.0667%; gnomAD_E_EAS: 1.2411%; gnomAD_E_FIN: 0.0314%; gnomAD_E_NFE: 0.0314%; gnomAD_E_OTH: 0.1835%; gnomAD_E_SAS: 0.0661%; gnomAD_G_EAS: 0.9259%; gnomAD_G_NFE: 0.0267%; gnomAD_G_OTH: 0.2037%

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

Phenotype matches:

Proximity score 0.500 in interactome to CPLANE2 and phenotypic similarity 0.744 to mouse mutant of CPLANE2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0002639, micrognathia; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-39583424-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.989 CONTRIBUTING VARIANT

Transcripts:: MAP4K3:ENST00000263881.3:c.211C>G:p.(Pro71Ala); MAP4K3:ENST00000341681.5:c.211C>G:p.(Pro71Ala); MAP4K3:ENST00000437545.1:c.22C>G:p.(Pro8Ala); MAP4K3:ENST00000484274.1:c.211C>G:p.(Pro71Ala)

Pathogenicity Data:: Best Score: 0.989303; Polyphen2: 0.002 (B); Mutation Taster: 0.989 (P); SIFT: 0.318 (T)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.530

Phenotype Score: 0.500

Variant Score: 0.894

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-39583424-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.989 CONTRIBUTING VARIANT

Transcripts:: MAP4K3:ENST00000263881.3:c.211C>G:p.(Pro71Ala); MAP4K3:ENST00000341681.5:c.211C>G:p.(Pro71Ala); MAP4K3:ENST00000437545.1:c.22C>G:p.(Pro8Ala); MAP4K3:ENST00000484274.1:c.211C>G:p.(Pro71Ala)

Pathogenicity Data:: Best Score: 0.989303; Polyphen2: 0.002 (B); Mutation Taster: 0.989 (P); SIFT: 0.318 (T)

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT DEL 2-39564661-AT-A [0/1] rs768190902

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.798 CONTRIBUTING VARIANT

Transcripts:: MAP4K3:ENST00000263881.3:c.366+5del:p.?; MAP4K3:ENST00000341681.5:c.366+5del:p.?; MAP4K3:ENST00000437545.1:c.177+5del:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

Phenotype matches:

Phenotypic similarity 0.286 to mouse mutant involving NEMP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to LEMD2 and phenotypic similarity 0.629 to Marbach-Rustad progeroid syndrome associated with LEMD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0031846, Femur fracture; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0031846, Femur fracture; HP:0010055, Broad hallux - HP:0031846, Femur fracture

Proximity score 0.500 in interactome to LEMD2 and phenotypic similarity 0.257 to mouse mutant of LEMD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0006069, abnormal retinal neuronal layer morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-57454690-C-T [0/1] rs201453766

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.989 CONTRIBUTING VARIANT

Transcripts:: NEMP1:ENST00000300128.4:c.1019G>A:p.(Arg340His); NEMP1:ENST00000379391.3:c.800G>A:p.(Arg267His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.021 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0068%; ExAC EAS: 0.0695%; gnomAD_E_EAS: 0.0754%; gnomAD_G_EAS: 0.0618%

Exomiser Score: 0.727

Phenotype Score: 0.501

Variant Score: 0.987

Phenotype matches:

Proximity score 0.501 in interactome to ANXA1 and phenotypic similarity 0.631 to mouse mutant of ANXA1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.727

Phenotype Score: 0.501

Variant Score: 0.987

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 12-11244067-A-ATT [0/1] rs760672236

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.987 CONTRIBUTING VARIANT

Transcripts:: TAS2R43:ENST00000531678.1:c.761_762insAA:p.(Ser254Argfs*27)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0375%; gnomAD_E_AMR: 0.0512%; gnomAD_E_FIN: 0.0900%; gnomAD_E_NFE: 0.0908%

Exomiser Score: 0.726

Phenotype Score: 0.500

Variant Score: 0.987

Phenotype matches:

Proximity score 0.500 in interactome to CITED2 and phenotypic similarity 0.703 to Tetralogy of Fallot associated with CITED2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to CITED2 and phenotypic similarity 0.320 to mouse mutant of CITED2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000074, abnormal neurocranium morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.726

Phenotype Score: 0.500

Variant Score: 0.987

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-461507-G-A [0/1] rs202106031

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.987 CONTRIBUTING VARIANT

Transcripts:: DECR2:ENST00000219481.5:c.808G>A:p.(Gly270Arg); DECR2:ENST00000424398.2:c.772G>A:p.(Gly258Arg)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: TOPMed: 0.0104%; ExAC AFR: 0.0097%; ExAC AMR: 0.0260%; ExAC EAS: 0.0811%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0476%; gnomAD_E_EAS: 0.0928%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0366%

Exomiser Score: 0.725

Phenotype Score: 0.500

Variant Score: 0.986

Phenotype matches:

Proximity score 0.500 in interactome to HERC1 and phenotypic similarity 0.604 to Megalencephaly-severe kyphoscoliosis-overgrowth syndrome associated with HERC1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly; HP:0001363, Craniosynostosis - HP:0011330, Metopic synostosis; HP:0011304, Broad thumb - HP:0001166, Arachnodactyly; HP:0010055, Broad hallux - HP:0001166, Arachnodactyly

Proximity score 0.500 in interactome to HERC1 and phenotypic similarity 0.332 to mouse mutant of HERC1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.725

Phenotype Score: 0.500

Variant Score: 0.986

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 22-37708154-G-A [0/1] rs749693397

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.986 CONTRIBUTING VARIANT

Transcripts:: CYTH4:ENST00000248901.6:c.1051G>A:p.(Glu351Lys)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.067 (B); Mutation Taster: 1.000 (P); SIFT: 0.367 (T)

Frequency Data:: TOPMed: 0.0370%; gnomAD_E_AMR: 0.0983%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.721

Phenotype Score: 0.500

Variant Score: 0.984

Phenotype matches:

Proximity score 0.500 in interactome to ARVCF and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with ARVCF.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.500 in interactome to ARVCF and phenotypic similarity 0.299 to mouse mutant of ARVCF.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.721

Phenotype Score: 0.500

Variant Score: 0.984

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-52733209-A-G [0/1] rs202074278

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.985 CONTRIBUTING VARIANT

Transcripts:: PCMTD1:ENST00000360540.5:c.776T>C:p.(Ile259Thr); PCMTD1:ENST00000522514.1:c.776T>C:p.(Ile259Thr); PCMTD1:ENST00000544451.1:c.548T>C:p.(Ile183Thr)

Pathogenicity Data:: Best Score: 0.999929; Polyphen2: 0.591 (P); Mutation Taster: 1.000 (P); SIFT: 0.019 (D)

Frequency Data:: gnomAD_E_AFR: 0.0066%; gnomAD_G_OTH: 0.1068%

MISSENSE_VARIANT SNV 8-52733214-A-C [0/1] rs200377849

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.984 CONTRIBUTING VARIANT

Transcripts:: PCMTD1:ENST00000360540.5:c.771T>G:p.(Asn257Lys); PCMTD1:ENST00000522514.1:c.771T>G:p.(Asn257Lys); PCMTD1:ENST00000544451.1:c.543T>G:p.(Asn181Lys)

Pathogenicity Data:: Best Score: 0.999961; Polyphen2: 0.880 (P); Mutation Taster: 1.000 (P); SIFT: 0.477 (T)

Frequency Data:: ExAC AFR: 0.0201%; ExAC AMR: 0.0086%; ExAC NFE: 0.0015%; ExAC OTH: 0.1104%; ExAC SAS: 0.0121%

Other passed variants:

MISSENSE_VARIANT SNV 8-52733054-C-T [0/1] rs116852339

Variant score: 0.841

Transcripts:: PCMTD1:ENST00000360540.5:c.931G>A:p.(Asp311Asn); PCMTD1:ENST00000522514.1:c.931G>A:p.(Asp311Asn); PCMTD1:ENST00000544451.1:c.703G>A:p.(Asp235Asn)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.910 (P); Mutation Taster: 1.000 (P); SIFT: 0.051 (D)

Frequency Data:: gnomAD_E_AFR: 0.0173%; gnomAD_E_AMR: 0.0596%; gnomAD_E_EAS: 0.0615%; gnomAD_E_FIN: 0.0624%; gnomAD_E_NFE: 0.0925%; gnomAD_E_OTH: 0.0225%; gnomAD_E_SAS: 0.0267%; gnomAD_G_AFR: 0.1270%; gnomAD_G_AMR: 0.7782%; gnomAD_G_EAS: 0.7075%; gnomAD_G_FIN: 0.1679%; gnomAD_G_NFE: 0.1013%; gnomAD_G_OTH: 0.1420%

Exomiser Score: 0.716

Phenotype Score: 0.500

Variant Score: 0.981

Phenotype matches:

Proximity score 0.500 in interactome to TOMM6 and phenotypic similarity 0.755 to mouse mutant of TOMM6.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.716

Phenotype Score: 0.500

Variant Score: 0.981

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-1718302-G-A [0/1] rs758932131

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.981 CONTRIBUTING VARIANT

Transcripts:: AKAP17A:ENST00000313871.3:c.1129G>A:p.(Ala377Thr); AKAP17A:ENST00000381261.3:c.1129G>A:p.(Ala377Thr)

Pathogenicity Data:: Best Score: 0.992; Polyphen2: 0.992 (D); SIFT: 0.346 (T)

Frequency Data:: TOPMed: 0.0053%; ExAC NFE: 0.0137%; gnomAD_E_EAS: 0.0762%; gnomAD_E_FIN: 0.0060%; gnomAD_E_NFE: 0.0043%

X_DOMINANT

Exomiser Score: 0.716

Phenotype Score: 0.500

Variant Score: 0.981

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-1718302-G-A [0/1] rs758932131

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.981 CONTRIBUTING VARIANT

Transcripts:: AKAP17A:ENST00000313871.3:c.1129G>A:p.(Ala377Thr); AKAP17A:ENST00000381261.3:c.1129G>A:p.(Ala377Thr)

Pathogenicity Data:: Best Score: 0.992; Polyphen2: 0.992 (D); SIFT: 0.346 (T)

Frequency Data:: TOPMed: 0.0053%; ExAC NFE: 0.0137%; gnomAD_E_EAS: 0.0762%; gnomAD_E_FIN: 0.0060%; gnomAD_E_NFE: 0.0043%

Exomiser Score: 0.715

Phenotype Score: 0.500

Variant Score: 0.981

Phenotype matches:

Phenotypic similarity 0.487 to Multiple pterygium syndrome, lethal type associated with CHRND.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009381, Short finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009381, Short finger; HP:0010055, Broad hallux - HP:0009381, Short finger

Phenotypic similarity 0.272 to mouse mutant involving CHRND.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001297, microphthalmia; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to LAMA5 and phenotypic similarity 0.739 to mouse mutant of LAMA5.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases:: OMIM:253290 Multiple pterygium syndrome, lethal type - autosomal recessive; OMIM:616321 ?Myasthenic syndrome, congenital, 3A, slow-channel (unconfirmed); OMIM:616322 Myasthenic syndrome, congenital, 3B, fast-channel - autosomal recessive; OMIM:616323 ?Myasthenic syndrome, congenital, 3C, associated with acetylcholine receptor deficiency (unconfirmed); ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal dominant; ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive; ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive; ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal dominant; ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive; ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.715

Phenotype Score: 0.500

Variant Score: 0.981

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.170 to ORPHA:98913 Postsynaptic congenital myasthenic syndromes

Variants contributing to score:

MISSENSE_VARIANT SNV 2-233399991-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.981 CONTRIBUTING VARIANT

Transcripts:: CHRND:ENST00000258385.3:c.1523C>T:p.(Ser508Phe); CHRND:ENST00000457943.2:c.941C>T:p.(Ser314Phe); CHRND:ENST00000543200.1:c.1478C>T:p.(Ser493Phe)

Pathogenicity Data:: Best Score: 0.981024; Polyphen2: 0.380 (B); Mutation Taster: 0.981 (P); SIFT: 0.044 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.714

Phenotype Score: 0.503

Variant Score: 0.977

Phenotype matches:

Proximity score 0.503 in interactome to CTCF and phenotypic similarity 0.750 to CTCF-related neurodevelopmental disorder associated with CTCF.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0010059, Broad hallux phalanx; HP:0010055, Broad hallux - HP:0010059, Broad hallux phalanx

Proximity score 0.503 in interactome to CTCF and phenotypic similarity 0.335 to fish mutant of CTCF.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0002314, head shape, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.714

Phenotype Score: 0.503

Variant Score: 0.977

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-1858453-G-A [0/1] rs201187761

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.984 CONTRIBUTING VARIANT

Transcripts:: SYT8:ENST00000341958.3:c.956G>A:p.(Arg319His); SYT8:ENST00000381968.3:c.998G>A:p.(Arg333His); SYT8:ENST00000535046.1:c.*620G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.002 (B); Mutation Taster: 1.000 (P); SIFT: 0.174 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0088%; ESP AA: 0.0228%; ESP All: 0.0077%; ExAC AFR: 0.0112%; ExAC EAS: 0.0846%; ExAC NFE: 0.0017%; gnomAD_E_EAS: 0.1085%; gnomAD_E_NFE: 0.0011%; gnomAD_G_AFR: 0.0115%

MISSENSE_VARIANT SNV 11-1858638-C-T [0/1] rs201288743

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.969 CONTRIBUTING VARIANT

Transcripts:: SYT8:ENST00000341958.3:c.1141C>T:p.(Arg381Cys); SYT8:ENST00000381968.3:c.1183C>T:p.(Arg395Cys); SYT8:ENST00000535046.1:c.*805C>T:p.(=)

Pathogenicity Data:: Best Score: 0.986; Polyphen2: 0.001 (B); SIFT: 0.014 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0080%; ExAC EAS: 0.0835%; gnomAD_E_EAS: 0.1169%; gnomAD_G_AFR: 0.0115%

Other passed variants:

MISSENSE_VARIANT SNV 11-1856670-G-A [0/1] rs3741238

Variant score: 0.797

Transcripts:: SYT8:ENST00000341958.3:c.239G>A:p.(Gly80Asp); SYT8:ENST00000381968.3:c.281G>A:p.(Gly94Asp); SYT8:ENST00000436964.2:c.239G>A:p.(Gly80Asp); SYT8:ENST00000535046.1:c.695G>A:p.(Gly232Asp)

Pathogenicity Data:: Best Score: 0.952; Polyphen2: 0.357 (B); SIFT: 0.048 (D)

Frequency Data:: 1000Genomes: 0.2196%; TOPMed: 0.0265%; ExAC EAS: 0.7884%; ExAC OTH: 0.1289%; ExAC SAS: 0.0132%; gnomAD_E_EAS: 0.7221%; gnomAD_E_OTH: 0.0376%; gnomAD_E_SAS: 0.0066%; gnomAD_G_EAS: 0.4932%

Exomiser Score: 0.713

Phenotype Score: 0.500

Variant Score: 0.980

Phenotype matches:

Proximity score 0.500 in interactome to CPLX1 and phenotypic similarity 0.628 to Wolf-Hirschhorn syndrome associated with CPLX1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly; HP:0010055, Broad hallux - HP:0010109, Short hallux

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.713

Phenotype Score: 0.500

Variant Score: 0.980

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-37961641-C-T [0/1] rs763867304

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.980 CONTRIBUTING VARIANT

Transcripts:: SYTL5:ENST00000297875.2:c.1109C>T:p.(Ser370Leu); SYTL5:ENST00000357972.5:c.1109C>T:p.(Ser370Leu); SYTL5:ENST00000456733.2:c.1109C>T:p.(Ser370Leu); SYTL5:ENST00000465127.1:c.172-563734C>T:p.(=)

Pathogenicity Data:: Best Score: 0.993676; Polyphen2: 0.003 (B); Mutation Taster: 0.994 (P); SIFT: 0.018 (D)

Frequency Data:: TOPMed: 0.0019%; ExAC EAS: 0.0302%; gnomAD_E_EAS: 0.0467%; gnomAD_G_EAS: 0.0986%

X_DOMINANT

Exomiser Score: 0.713

Phenotype Score: 0.500

Variant Score: 0.980

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-37961641-C-T [0/1] rs763867304

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.980 CONTRIBUTING VARIANT

Transcripts:: SYTL5:ENST00000297875.2:c.1109C>T:p.(Ser370Leu); SYTL5:ENST00000357972.5:c.1109C>T:p.(Ser370Leu); SYTL5:ENST00000456733.2:c.1109C>T:p.(Ser370Leu); SYTL5:ENST00000465127.1:c.172-563734C>T:p.(=)

Pathogenicity Data:: Best Score: 0.993676; Polyphen2: 0.003 (B); Mutation Taster: 0.994 (P); SIFT: 0.018 (D)

Frequency Data:: TOPMed: 0.0019%; ExAC EAS: 0.0302%; gnomAD_E_EAS: 0.0467%; gnomAD_G_EAS: 0.0986%

Exomiser Score: 0.706

Phenotype Score: 0.769

Variant Score: 0.672

Phenotype matches:

Phenotypic similarity 0.769 to mouse mutant involving FBXW12.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0005270, abnormal zygomatic bone morphology; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.706

Phenotype Score: 0.769

Variant Score: 0.672

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-48423515-A-G [0/1] rs199820482

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.672 CONTRIBUTING VARIANT

Transcripts:: FBXW12:ENST00000296438.5:c.1235A>G:p.(His412Arg); FBXW12:ENST00000415155.1:c.1025A>G:p.(His342Arg); FBXW12:ENST00000436231.1:c.764A>G:p.(His255Arg); FBXW12:ENST00000445170.1:c.1178A>G:p.(His393Arg)

Pathogenicity Data:: Best Score: 0.678; Polyphen2: 0.030 (B); SIFT: 0.322 (T)

Frequency Data:: TOPMed: 0.0019%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.706

Phenotype Score: 0.487

Variant Score: 0.991

Phenotype matches:

Phenotypic similarity 0.487 to mouse mutant involving HHIPL1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004357, long tibia; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0004357, long tibia; HP:0010055, Broad hallux - MP:0004357, long tibia

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.706

Phenotype Score: 0.487

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-100125925-C-G [0/1] rs1455851664

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: HHIPL1:ENST00000330710.5:c.1207C>G:p.(Arg403Gly); HHIPL1:ENST00000357223.2:c.1207C>G:p.(Arg403Gly)

Pathogenicity Data:: Best Score: 0.999671; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0008%; gnomAD_G_EAS: 0.0618%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.033

Phenotype Score: 0.487

Variant Score: 0.529

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-100125925-C-G [0/1] rs1455851664

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: HHIPL1:ENST00000330710.5:c.1207C>G:p.(Arg403Gly); HHIPL1:ENST00000357223.2:c.1207C>G:p.(Arg403Gly)

Pathogenicity Data:: Best Score: 0.999671; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0008%; gnomAD_G_EAS: 0.0618%

SYNONYMOUS_VARIANT SNV 14-100126622-T-C [0/1] rs75448994

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.067 CONTRIBUTING VARIANT

Transcripts:: HHIPL1:ENST00000330710.5:c.1381T>C:p.(=); HHIPL1:ENST00000357223.2:c.1381T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.2196%; TOPMed: 0.0412%; ExAC EAS: 0.9718%; ExAC OTH: 0.1111%; ExAC SAS: 0.0061%; gnomAD_E_EAS: 0.8699%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0182%; gnomAD_E_SAS: 0.0032%; gnomAD_G_EAS: 1.2346%

Exomiser Score: 0.699

Phenotype Score: 0.503

Variant Score: 0.969

Phenotype matches:

Phenotypic similarity 0.320 to mouse mutant involving AKAP13.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.503 in interactome to ARHGAP31 and phenotypic similarity 0.698 to Adams-Oliver syndrome 1 associated with ARHGAP31.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.699

Phenotype Score: 0.503

Variant Score: 0.969

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-86261321-C-T [0/1] rs148718462

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.969 CONTRIBUTING VARIANT

Transcripts:: AKAP13:ENST00000361243.2:c.5944C>T:p.(Arg1982Trp); AKAP13:ENST00000394510.2:c.667C>T:p.(Arg223Trp); AKAP13:ENST00000394518.2:c.5932C>T:p.(Arg1978Trp)

Pathogenicity Data:: Best Score: 0.972; Polyphen2: 0.897 (P); SIFT: 0.028 (D)

Frequency Data:: TOPMed: 0.0045%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0096%; gnomAD_E_AFR: 0.0065%; gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.684

Phenotype Score: 0.500

Variant Score: 0.965

Phenotype matches:

Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.684

Phenotype Score: 0.500

Variant Score: 0.965

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-6816225-G-A [0/1] rs778988808

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.965 CONTRIBUTING VARIANT

Transcripts:: OR6A2:ENST00000332601.3:c.715C>T:p.(Arg239Cys)

Pathogenicity Data:: Best Score: 0.967; Polyphen2: 0.051 (B); SIFT: 0.033 (D)

Frequency Data:: TOPMed: 0.0042%; UK10K: 0.0132%; ExAC AFR: 0.0096%; ExAC AMR: 0.0087%; ExAC NFE: 0.0015%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0131%; gnomAD_E_AMR: 0.0030%; gnomAD_E_FIN: 0.0090%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0065%; gnomAD_G_AFR: 0.0115%; gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.676

Phenotype Score: 0.500

Variant Score: 0.961

Phenotype matches:

Proximity score 0.500 in interactome to MYOZ1 and phenotypic similarity 0.737 to mouse mutant of MYOZ1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000565, oligodactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000565, oligodactyly; HP:0010055, Broad hallux - MP:0000565, oligodactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.676

Phenotype Score: 0.500

Variant Score: 0.961

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-4411265-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.961 CONTRIBUTING VARIANT

Transcripts:: TRIM21:ENST00000254436.7:c.375G>A:p.(Met125Ile); TRIM21:ENST00000543625.1:c.375G>A:p.(Met125Ile)

Pathogenicity Data:: Best Score: 0.961; Polyphen2: 0.004 (B); SIFT: 0.039 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.665

Phenotype Score: 0.500

Variant Score: 0.955

Phenotype matches:

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput; HP:0011304, Broad thumb - HP:0010557, Overlapping fingers; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.665

Phenotype Score: 0.500

Variant Score: 0.955

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-141803139-T-C [0/1] rs763414236

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.955 CONTRIBUTING VARIANT

Transcripts:: MGAM:ENST00000475668.2:c.8084T>C:p.(Ile2695Thr); MGAM:ENST00000549489.2:c.5396T>C:p.(Ile1799Thr)

Pathogenicity Data:: Best Score: 0.957; Polyphen2: 0.082 (B); SIFT: 0.043 (D)

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0128%; gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.661

Phenotype Score: 0.500

Variant Score: 0.954

Phenotype matches:

Proximity score 0.500 in interactome to ACTG1 and phenotypic similarity 0.706 to Baraitser-Winter cerebrofrontofacial syndrome associated with ACTG1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009942, Duplication of thumb phalanx; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0009942, Duplication of thumb phalanx; HP:0010055, Broad hallux - HP:0009942, Duplication of thumb phalanx

Proximity score 0.500 in interactome to ACTG1 and phenotypic similarity 0.215 to mouse mutant of ACTG1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004521, abnormal cochlear hair cell stereociliary bundle morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.661

Phenotype Score: 0.500

Variant Score: 0.954

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-201195057-A-G [0/1] rs542708405

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.979 CONTRIBUTING VARIANT

Transcripts:: IGFN1:ENST00000335211.4:c.10592A>G:p.(His3531Arg); IGFN1:ENST00000295591.8:c.*49A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.011 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0091%; ExAC AMR: 0.0879%; gnomAD_E_AMR: 0.1443%; gnomAD_E_OTH: 0.0580%; gnomAD_G_AMR: 0.1193%

MISSENSE_VARIANT SNV 1-201181220-C-T [0/1] rs370325809

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.928 CONTRIBUTING VARIANT

Transcripts:: IGFN1:ENST00000335211.4:c.7199C>T:p.(Thr2400Met); IGFN1:ENST00000451870.2:c.1242-1414C>T:p.(=); IGFN1:ENST00000295591.8:c.-1322C>T:p.(=)

Pathogenicity Data:: Best Score: 0.982; SIFT: 0.018 (D)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0518%; ESP AA: 0.0723%; ESP All: 0.0219%; ExAC AFR: 0.1105%; gnomAD_E_AFR: 0.0684%; gnomAD_E_AMR: 0.0126%; gnomAD_E_EAS: 0.3389%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0269%; gnomAD_E_SAS: 0.0044%; gnomAD_G_AFR: 0.0923%; gnomAD_G_EAS: 0.1235%

Exomiser Score: 0.649

Phenotype Score: 0.500

Variant Score: 0.948

Phenotype matches:

Proximity score 0.500 in interactome to SIK3 and phenotypic similarity 0.670 to ?Spondyloepimetaphyseal dysplasia, Krakow type associated with SIK3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002691, Platybasia; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Proximity score 0.500 in interactome to SIK3 and phenotypic similarity 0.812 to mouse mutant of SIK3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0011504, abnormal limb long bone morphology; HP:0001363, Craniosynostosis - MP:0010743, delayed cranial suture closure; HP:0011304, Broad thumb - MP:0011504, abnormal limb long bone morphology; HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.649

Phenotype Score: 0.500

Variant Score: 0.948

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-20430717-A-T [0/1] rs771212949

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.948 CONTRIBUTING VARIANT

Transcripts:: ACSM5:ENST00000331849.4:c.583A>T:p.(Ser195Cys); ACSM5:ENST00000575584.1:c.583A>T:p.(Ser195Cys)

Pathogenicity Data:: Best Score: 0.956; Polyphen2: 0.684 (P); SIFT: 0.044 (D)

Frequency Data:: TOPMed: 0.0072%; ExAC EAS: 0.0232%; ExAC NFE: 0.0030%; ExAC SAS: 0.0121%; gnomAD_E_EAS: 0.0406%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0182%; gnomAD_E_SAS: 0.0195%; gnomAD_G_EAS: 0.0617%; gnomAD_G_NFE: 0.0400%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.595

Phenotype Score: 0.500

Variant Score: 0.923

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-20430717-A-T [0/1] rs771212949

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.948 CONTRIBUTING VARIANT

Transcripts:: ACSM5:ENST00000331849.4:c.583A>T:p.(Ser195Cys); ACSM5:ENST00000575584.1:c.583A>T:p.(Ser195Cys)

Pathogenicity Data:: Best Score: 0.956; Polyphen2: 0.684 (P); SIFT: 0.044 (D)

Frequency Data:: TOPMed: 0.0072%; ExAC EAS: 0.0232%; ExAC NFE: 0.0030%; ExAC SAS: 0.0121%; gnomAD_E_EAS: 0.0406%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0182%; gnomAD_E_SAS: 0.0195%; gnomAD_G_EAS: 0.0617%; gnomAD_G_NFE: 0.0400%

MISSENSE_VARIANT SNV 16-20435371-G-C [0/1] rs190666032

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.898 CONTRIBUTING VARIANT

Transcripts:: ACSM5:ENST00000331849.4:c.901G>C:p.(Asp301His)

Pathogenicity Data:: Best Score: 0.998; Polyphen2: 0.972 (D); Mutation Taster: 0.960 (P); SIFT: 0.002 (D)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0350%; ExAC EAS: 0.3934%; gnomAD_E_EAS: 0.4177%; gnomAD_G_EAS: 0.5556%

Exomiser Score: 0.647

Phenotype Score: 0.527

Variant Score: 0.917

Phenotype matches:

Phenotypic similarity 0.449 to ?Immunodeficiency 59 and hypoglycemia associated with HYOU1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001238, Slender finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001238, Slender finger; HP:0010055, Broad hallux - HP:0001238, Slender finger

Proximity score 0.527 in interactome to SIL1 and phenotypic similarity 0.631 to Marinesco-Sjögren syndrome associated with SIL1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0010508, Metatarsus valgus; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Known diseases:: OMIM:233600 ?Immunodeficiency 59 and hypoglycemia (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.647

Phenotype Score: 0.527

Variant Score: 0.917

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.449 to OMIM:233600 ?Immunodeficiency 59 and hypoglycemia

Variants contributing to score:

MISSENSE_VARIANT SNV 11-118919033-C-T [0/1] rs144328288

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.982 CONTRIBUTING VARIANT

Transcripts:: HYOU1:ENST00000404233.3:c.2303G>A:p.(Arg768His); HYOU1:ENST00000525859.1:c.2117G>A:p.(Arg706His); HYOU1:ENST00000529972.1:c.2117G>A:p.(Arg706His)

Pathogenicity Data:: Best Score: 0.99958; Polyphen2: 0.975 (D); Mutation Taster: 1.000 (P)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0083%; ExAC AMR: 0.0519%; ExAC EAS: 0.0928%; ExAC FIN: 0.0454%; ExAC NFE: 0.0045%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0238%; gnomAD_E_EAS: 0.0986%; gnomAD_E_FIN: 0.0202%; gnomAD_E_NFE: 0.0027%; gnomAD_G_EAS: 0.1233%; gnomAD_G_FIN: 0.0286%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 11-118924855-G-C [0/1] rs144079825

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3, BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.851 CONTRIBUTING VARIANT

Transcripts:: HYOU1:ENST00000404233.3:c.772C>G:p.(Gln258Glu); HYOU1:ENST00000525859.1:c.772C>G:p.(Gln258Glu); HYOU1:ENST00000529972.1:c.772C>G:p.(Gln258Glu); HYOU1:ENST00000543287.1:c.511C>G:p.(Gln171Glu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.998 (D); Mutation Taster: 1.000 (P); SIFT: 0.189 (T)

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0193%; ExAC EAS: 0.4397%; ExAC SAS: 0.0372%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.4290%; gnomAD_E_SAS: 0.0325%; gnomAD_G_EAS: 0.7417%

Exomiser Score: 0.644

Phenotype Score: 0.500

Variant Score: 0.945

Phenotype matches:

Proximity score 0.500 in interactome to CPLX1 and phenotypic similarity 0.628 to Wolf-Hirschhorn syndrome associated with CPLX1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly; HP:0010055, Broad hallux - HP:0010109, Short hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.644

Phenotype Score: 0.500

Variant Score: 0.945

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-56386195-G-A [0/1] rs765836371

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.945 CONTRIBUTING VARIANT

Transcripts:: TSPOAP1:ENST00000268893.6:c.4258C>T:p.(Arg1420Trp); TSPOAP1:ENST00000343736.4:c.4438C>T:p.(Arg1480Trp); TSPOAP1:ENST00000355701.3:c.4438C>T:p.(Arg1480Trp)

Pathogenicity Data:: Best Score: 0.958; Polyphen2: 0.002 (B); SIFT: 0.042 (D)

Frequency Data:: TOPMed: 0.0064%; ExAC EAS: 0.0833%; gnomAD_E_EAS: 0.0937%; gnomAD_E_SAS: 0.0033%

Exomiser Score: 0.631

Phenotype Score: 0.508

Variant Score: 0.930

Phenotype matches:

Phenotypic similarity 0.265 to mouse mutant involving PER1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005605, increased bone mass; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.508 in interactome to NONO and phenotypic similarity 0.699 to Intellectual developmental disorder, X-linked syndromic 34 associated with NONO.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001822, Hallux valgus; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0001822, Hallux valgus; HP:0010055, Broad hallux - HP:0001822, Hallux valgus

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.631

Phenotype Score: 0.508

Variant Score: 0.930

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-8046972-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.930 CONTRIBUTING VARIANT

Transcripts:: PER1:ENST00000317276.4:c.2684C>A:p.(Pro895His); PER1:ENST00000581082.1:c.2615C>A:p.(Pro872His)

Pathogenicity Data:: Best Score: 0.93; Polyphen2: 0.007 (B); SIFT: 0.070 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.623

Phenotype Score: 0.510

Variant Score: 0.925

Phenotype matches:

Phenotypic similarity 0.670 to Blackfan-Diamond anemia associated with GATA1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001199, Triphalangeal thumb

Phenotypic similarity 0.344 to mouse mutant involving GATA1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0020039, increased bone ossification; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.510 in interactome to ZFPM2 and phenotypic similarity 0.703 to Tetralogy of Fallot associated with ZFPM2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Known diseases:: OMIM:190685 Leukemia, megakaryoblastic, with or without Down syndrome, somatic - unknown; OMIM:300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia - X-linked recessive; OMIM:300835 Anemia, X-linked, with/without neutropenia and/or platelet abnormalities - X-linked recessive; OMIM:314050 Thrombocytopenia with beta-thalassemia, X-linked - X-linked recessive; ORPHA:124 Blackfan-Diamond anemia - autosomal dominant; ORPHA:231393 Beta-thalassemia-X-linked thrombocytopenia syndrome - X-linked recessive; ORPHA:67044 Thrombocytopenia with congenital dyserythropoietic anemia - X-linked recessive; ORPHA:79277 Congenital erythropoietic porphyria - autosomal recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.623

Phenotype Score: 0.510

Variant Score: 0.925

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-48650368-G-T [0/1] rs782208453

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.925 CONTRIBUTING VARIANT

Transcripts:: GATA1:ENST00000376665.3:c.338G>T:p.(Arg113Leu); GATA1:ENST00000376670.3:c.338G>T:p.(Arg113Leu)

Pathogenicity Data:: Best Score: 0.935; Polyphen2: 0.026 (B); SIFT: 0.065 (T)

Frequency Data:: 1000Genomes: 0.0265%; TOPMed: 0.0120%; ExAC EAS: 0.0754%; gnomAD_E_EAS: 0.0777%

X_DOMINANT

Exomiser Score: 0.105

Phenotype Score: 0.255

Variant Score: 0.925

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-48650368-G-T [0/1] rs782208453

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.925 CONTRIBUTING VARIANT

Transcripts:: GATA1:ENST00000376665.3:c.338G>T:p.(Arg113Leu); GATA1:ENST00000376670.3:c.338G>T:p.(Arg113Leu)

Pathogenicity Data:: Best Score: 0.935; Polyphen2: 0.026 (B); SIFT: 0.065 (T)

Frequency Data:: 1000Genomes: 0.0265%; TOPMed: 0.0120%; ExAC EAS: 0.0754%; gnomAD_E_EAS: 0.0777%

Exomiser Score: 0.622

Phenotype Score: 0.500

Variant Score: 0.935

Phenotype matches:

Proximity score 0.500 in interactome to UBE4B and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with UBE4B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Known diseases:: OMIM:164400 Spinocerebellar ataxia 1 - autosomal dominant; ORPHA:98755 Spinocerebellar ataxia type 1 - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.622

Phenotype Score: 0.500

Variant Score: 0.935

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-16327915-A-C [-/1] rs11969612

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

ClinVar: UNCERTAIN_SIGNIFICANCE (no assertion criteria provided)

Variant score: 0.935 CONTRIBUTING VARIANT

Transcripts:: ATXN1:ENST00000244769.4:c.627T>G:p.(His209Gln); ATXN1:ENST00000436367.1:c.627T>G:p.(His209Gln)

Pathogenicity Data:: Best Score: 0.935; Polyphen2: 0.227 (B); SIFT: 0.065 (T)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.076

Phenotype Score: 0.250

Variant Score: 0.893

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-16327915-A-C [-/1] rs11969612

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

ClinVar: UNCERTAIN_SIGNIFICANCE (no assertion criteria provided)

Variant score: 0.935 CONTRIBUTING VARIANT

Transcripts:: ATXN1:ENST00000244769.4:c.627T>G:p.(His209Gln); ATXN1:ENST00000436367.1:c.627T>G:p.(His209Gln)

Pathogenicity Data:: Best Score: 0.935; Polyphen2: 0.227 (B); SIFT: 0.065 (T)

Frequency Data:: No frequency data

DISRUPTIVE_INFRAME_DELETION DEL 6-16327915-ATGC-A [-/1] rs193922926

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: ATXN1:ENST00000244769.4:c.624_626del:p.(Gln208del); ATXN1:ENST00000436367.1:c.624_626del:p.(Gln208del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.615

Phenotype Score: 0.502

Variant Score: 0.929

Phenotype matches:

Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.662 to Adams-Oliver syndrome associated with RBPJ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0010760, Absent toe

Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.245 to mouse mutant of RBPJ.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0010124, decreased bone mineral content; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.615

Phenotype Score: 0.502

Variant Score: 0.929

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 4-140640752-T-C [0/1] rs534986978

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.943 CONTRIBUTING VARIANT

Transcripts:: MAML3:ENST00000509479.2:c.3142A>G:p.(Met1048Val)

Pathogenicity Data:: Best Score: 0.992; Mutation Taster: 0.968 (P); SIFT: 0.008 (D)

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0129%; ExAC EAS: 0.2514%; ExAC NFE: 0.0031%; ExAC SAS: 0.0441%; gnomAD_E_EAS: 0.2507%; gnomAD_E_NFE: 0.0027%; gnomAD_E_SAS: 0.0294%; gnomAD_G_EAS: 0.3090%

MISSENSE_VARIANT SNV 4-140811238-G-A [0/1] rs565189281

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.915 CONTRIBUTING VARIANT

Transcripts:: MAML3:ENST00000327122.5:c.884C>T:p.(Ala295Val); MAML3:ENST00000509479.2:c.1352C>T:p.(Ala451Val)

Pathogenicity Data:: Best Score: 0.932; Polyphen2: 0.022 (B); SIFT: 0.068 (T)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0026%; ExAC AFR: 0.0116%; ExAC EAS: 0.0302%; gnomAD_E_AFR: 0.0067%; gnomAD_E_EAS: 0.0237%; gnomAD_E_SAS: 0.0033%; gnomAD_G_EAS: 0.1233%

Exomiser Score: 0.614

Phenotype Score: 0.506

Variant Score: 0.925

Phenotype matches:

Proximity score 0.506 in interactome to SIAH1 and phenotypic similarity 0.858 to Buratti-Harel syndrome associated with SIAH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.614

Phenotype Score: 0.506

Variant Score: 0.925

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-57327738-C-T [0/1] rs56332142

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.925 CONTRIBUTING VARIANT

Transcripts:: PEG3:ENST00000326441.9:c.2072G>A:p.(Arg691Gln); PEG3:ENST00000423103.2:c.2072G>A:p.(Arg691Gln); PEG3:ENST00000593695.1:c.1694G>A:p.(Arg565Gln); PEG3:ENST00000598410.1:c.1700G>A:p.(Arg567Gln); PEG3:ENST00000221722.5:c.397+2230G>A:p.(=); PEG3:ENST00000391708.3:c.397+2230G>A:p.(=); PEG3:ENST00000593711.1:c.397+2230G>A:p.(=); PEG3:ENST00000599935.1:c.397+2230G>A:p.(=); PEG3:ENST00000601070.1:c.397+2230G>A:p.(=)

Pathogenicity Data:: Best Score: 0.93; Polyphen2: 0.428 (B); SIFT: 0.070 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0087%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC AFR: 0.0098%; ExAC EAS: 0.0116%; ExAC NFE: 0.0060%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0060%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0108%; gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.612

Phenotype Score: 0.501

Variant Score: 0.930

Phenotype matches:

Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.656 to Noonan syndrome 1 associated with PTPN11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.540 to mouse mutant of PTPN11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0012514, pectus excavatum; HP:0001363, Craniosynostosis - MP:0010031, abnormal cranium size; HP:0011304, Broad thumb - MP:0012514, pectus excavatum; HP:0010055, Broad hallux - MP:0012514, pectus excavatum

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.612

Phenotype Score: 0.501

Variant Score: 0.930

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55258792-C-T [0/1] rs72487164

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.930 CONTRIBUTING VARIANT

Transcripts:: KIR2DL3:ENST00000342376.3:c.670C>T:p.(Pro224Ser); KIR2DL3:ENST00000402254.2:c.34+22757C>T:p.(=); KIR2DL3:ENST00000538269.1:c.34+22757C>T:p.(=); KIR2DL3:ENST00000541392.1:c.34+22757C>T:p.(=); KIR2DL3:ENST00000396284.2:c.34+22757C>T:p.(=); KIR2DL3:ENST00000434419.2:c.664+3256C>T:p.(=)

Pathogenicity Data:: Best Score: 0.93; Polyphen2: 0.001 (B); SIFT: 0.070 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.606

Phenotype Score: 0.500

Variant Score: 0.928

Phenotype matches:

Proximity score 0.500 in interactome to RFWD3 and phenotypic similarity 0.676 to Fanconi anemia associated with RFWD3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.606

Phenotype Score: 0.500

Variant Score: 0.928

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-44120286-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.928 CONTRIBUTING VARIANT

Transcripts:: WDR76:ENST00000263795.6:c.184G>C:p.(Asp62His); WDR76:ENST00000381246.2:c.-9G>C:p.(=)

Pathogenicity Data:: Best Score: 0.928; Polyphen2: 0.343 (B); SIFT: 0.072 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.597

Phenotype Score: 0.500

Variant Score: 0.924

Phenotype matches:

Proximity score 0.500 in interactome to RSPO2 and phenotypic similarity 0.468 to ?Humerofemoral hypoplasia with radiotibial ray deficiency associated with RSPO2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0003865, Bowed humerus; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009777, Absent thumb; HP:0010055, Broad hallux - HP:0009777, Absent thumb

Proximity score 0.500 in interactome to RSPO2 and phenotypic similarity 0.727 to mouse mutant of RSPO2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Proximity score 0.500 in interactome to RSPO2 and phenotypic similarity 0.233 to fish mutant of RSPO2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - ZP:0012192, rib hypoplastic, abnormal; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.597

Phenotype Score: 0.500

Variant Score: 0.924

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-161221503-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.924 CONTRIBUTING VARIANT

Transcripts:: OTOL1:ENST00000327928.4:c.1207A>C:p.(Ile403Leu)

Pathogenicity Data:: Best Score: 0.924; Polyphen2: 0.621 (P); SIFT: 0.076 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.589

Phenotype Score: 0.500

Variant Score: 0.920

Phenotype matches:

Proximity score 0.500 in interactome to B3GLCT and phenotypic similarity 0.709 to Peters-plus syndrome associated with B3GLCT.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0009623, Proximal placement of thumb; HP:0010055, Broad hallux - HP:0001831, Short toe

Proximity score 0.500 in interactome to B3GLCT and phenotypic similarity 0.841 to mouse mutant of B3GLCT.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Known diseases:: OMIM:219050 Cryptorchidism - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.589

Phenotype Score: 0.500

Variant Score: 0.920

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-17932135-C-T [0/1] rs762412864

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.920 CONTRIBUTING VARIANT

Transcripts:: INSL3:ENST00000317306.7:c.181G>A:p.(Gly61Arg); INSL3:ENST00000379695.5:c.181G>A:p.(Gly61Arg)

Pathogenicity Data:: Best Score: 0.923; Polyphen2: 0.002 (B); SIFT: 0.077 (T)

Frequency Data:: TOPMed: 0.0072%; gnomAD_E_AFR: 0.0158%; gnomAD_E_EAS: 0.0100%; gnomAD_E_SAS: 0.0044%; gnomAD_G_AFR: 0.0229%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.569

Phenotype Score: 0.500

Variant Score: 0.911

Phenotype matches:

Phenotypic similarity 0.486 to mouse mutant involving GLG1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006396, decreased long bone epiphyseal plate size; HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure; HP:0011304, Broad thumb - MP:0006396, decreased long bone epiphyseal plate size; HP:0010055, Broad hallux - MP:0006396, decreased long bone epiphyseal plate size

Proximity score 0.500 in interactome to PIBF1 and phenotypic similarity 0.613 to Joubert syndrome associated with PIBF1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.500 in interactome to PIBF1 and phenotypic similarity 0.278 to mouse mutant of PIBF1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.569

Phenotype Score: 0.500

Variant Score: 0.911

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-74640853-A-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.911 CONTRIBUTING VARIANT

Transcripts:: GLG1:ENST00000205061.5:c.140T>A:p.(Val47Glu); GLG1:ENST00000422840.2:c.140T>A:p.(Val47Glu); GLG1:ENST00000447066.2:c.140T>A:p.(Val47Glu)

Pathogenicity Data:: Best Score: 0.911; Polyphen2: 0.009 (B); SIFT: 0.089 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.566

Phenotype Score: 0.500

Variant Score: 0.910

Phenotype matches:

Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.566

Phenotype Score: 0.500

Variant Score: 0.910

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-20502149-T-C [0/1] rs201040612

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.910 CONTRIBUTING VARIANT

Transcripts:: OR4K13:ENST00000315693.2:c.769A>G:p.(Ile257Val)

Pathogenicity Data:: Best Score: 0.916; Polyphen2: 0.458 (P); SIFT: 0.084 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0104%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC EAS: 0.0463%; ExAC NFE: 0.0120%; ExAC SAS: 0.0182%; gnomAD_E_EAS: 0.0348%; gnomAD_E_NFE: 0.0072%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0163%; gnomAD_G_NFE: 0.0200%

Exomiser Score: 0.545

Phenotype Score: 0.500

Variant Score: 0.900

Phenotype matches:

Phenotypic similarity 0.397 to mouse mutant involving REXO1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology; HP:0001363, Craniosynostosis - MP:0001293, anophthalmia; HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology; HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology

Proximity score 0.500 in interactome to RAI1 and phenotypic similarity 0.701 to Smith-Magenis syndrome associated with RAI1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.500 in interactome to RAI1 and phenotypic similarity 0.699 to mouse mutant of RAI1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000413, polyphalangy; HP:0001363, Craniosynostosis - MP:0002260, abnormal thyroid cartilage morphology; HP:0011304, Broad thumb - MP:0000413, polyphalangy; HP:0010055, Broad hallux - MP:0000413, polyphalangy

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.545

Phenotype Score: 0.500

Variant Score: 0.900

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-1825935-T-C [0/1] rs756775102

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.900 CONTRIBUTING VARIANT

Transcripts:: REXO1:ENST00000170168.4:c.1919A>G:p.(Lys640Arg)

Pathogenicity Data:: Best Score: 0.908; Polyphen2: 0.031 (B); Mutation Taster: 0.592; SIFT: 0.092 (T)

Frequency Data:: TOPMed: 0.0019%; ExAC EAS: 0.0463%; ExAC NFE: 0.0015%; gnomAD_E_EAS: 0.0406%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0065%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.535

Phenotype Score: 0.500

Variant Score: 0.896

Phenotype matches:

Proximity score 0.500 in interactome to HSPG2 and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with HSPG2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.500 in interactome to HSPG2 and phenotypic similarity 0.701 to mouse mutant of HSPG2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate; HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures; HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate; HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.535

Phenotype Score: 0.500

Variant Score: 0.896

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-180477292-G-A [0/1] rs769879741

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.896 CONTRIBUTING VARIANT

Transcripts:: BTNL9:ENST00000327705.9:c.659G>A:p.(Gly220Glu); BTNL9:ENST00000376841.2:c.659G>A:p.(Gly220Glu); BTNL9:ENST00000376842.3:c.659G>A:p.(Gly220Glu); BTNL9:ENST00000515271.1:c.452G>A:p.(Gly151Glu)

Pathogenicity Data:: Best Score: 0.899; Polyphen2: 0.770 (P); SIFT: 0.101 (T)

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0116%

Exomiser Score: 0.521

Phenotype Score: 0.537

Variant Score: 0.849

Phenotype matches:

Phenotypic similarity 0.537 to X-linked intellectual disability, Siderius type associated with PHF8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001177, Preaxial hand polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly; HP:0010055, Broad hallux - HP:0001177, Preaxial hand polydactyly

Phenotypic similarity 0.307 to mouse mutant involving PHF8.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:300263 Intellectual developmental disorder, X-linked, syndromic, Siderius type - X-linked recessive; ORPHA:85287 X-linked intellectual disability, Siderius type - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.521

Phenotype Score: 0.537

Variant Score: 0.849

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.537 to ORPHA:85287 X-linked intellectual disability, Siderius type
Phenotypic similarity 0.530 to OMIM:300263 Intellectual developmental disorder, X-linked, syndromic, Siderius type

Variants contributing to score:

INFRAME_DELETION DEL X-54011404-TCTC-T [0/1] rs782435731

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]

Variant score: 0.849 CONTRIBUTING VARIANT

Transcripts:: PHF8:ENST00000322659.8:c.2332_2334del:p.(Glu778del); PHF8:ENST00000338154.6:c.2383_2385del:p.(Glu795del); PHF8:ENST00000338946.6:c.2080_2082del:p.(Glu694del); PHF8:ENST00000357988.5:c.2491_2493del:p.(Glu831del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0039%; gnomAD_E_FIN: 0.0064%; gnomAD_E_NFE: 0.0090%

X_DOMINANT

Exomiser Score: 0.020

Phenotype Score: 0.153

Variant Score: 0.849

No phenotype matches to diseases with this MOI.

Variants contributing to score:

INFRAME_DELETION DEL X-54011404-TCTC-T [0/1] rs782435731

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]

Variant score: 0.849 CONTRIBUTING VARIANT

Transcripts:: PHF8:ENST00000322659.8:c.2332_2334del:p.(Glu778del); PHF8:ENST00000338154.6:c.2383_2385del:p.(Glu795del); PHF8:ENST00000338946.6:c.2080_2082del:p.(Glu694del); PHF8:ENST00000357988.5:c.2491_2493del:p.(Glu831del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0039%; gnomAD_E_FIN: 0.0064%; gnomAD_E_NFE: 0.0090%

Exomiser Score: 0.521

Phenotype Score: 0.500

Variant Score: 0.890

Phenotype matches:

Phenotypic similarity 0.295 to Kallmann syndrome associated with ANOS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb -; HP:0010055, Broad hallux - HP:0001761, Pes cavus

Proximity score 0.500 in interactome to IDUA and phenotypic similarity 0.477 to Hurler syndrome associated with IDUA.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0100490, Camptodactyly of finger; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0100490, Camptodactyly of finger

Proximity score 0.500 in interactome to IDUA and phenotypic similarity 0.724 to mouse mutant of IDUA.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0000441, increased cranium width; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases:: OMIM:308700 Hypogonadotropic hypogonadism 1 with or without anosmia (Kallmann syndrome 1) - X-linked recessive; ORPHA:478 Kallmann syndrome - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.521

Phenotype Score: 0.500

Variant Score: 0.890

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.295 to ORPHA:478 Kallmann syndrome
Phenotypic similarity 0.274 to OMIM:308700 Hypogonadotropic hypogonadism 1 with or without anosmia (Kallmann syndrome 1)

Variants contributing to score:

MISSENSE_VARIANT SNV X-8504922-G-A [0/1] rs765611622

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.890 CONTRIBUTING VARIANT

Transcripts:: ANOS1:ENST00000262648.3:c.1511C>T:p.(Pro504Leu)

Pathogenicity Data:: Best Score: 0.93299997; Polyphen2: 0.005 (B); SIFT: 0.067 (T)

Frequency Data:: 1000Genomes: 0.0530%; TOPMed: 0.0140%; ExAC AMR: 0.0114%; ExAC EAS: 0.2718%; ExAC NFE: 0.0023%; ExAC SAS: 0.0459%; gnomAD_E_AMR: 0.0188%; gnomAD_E_EAS: 0.2339%; gnomAD_E_NFE: 0.0025%; gnomAD_E_SAS: 0.0476%; gnomAD_G_EAS: 0.2935%

Exomiser Score: 0.513

Phenotype Score: 0.500

Variant Score: 0.887

Phenotype matches:

Proximity score 0.500 in interactome to TONSL and phenotypic similarity 0.610 to SPONASTRIME dysplasia associated with TONSL.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0010234, Ivory epiphyses of the phalanges of the hand; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to TONSL and phenotypic similarity 0.244 to mouse mutant of TONSL.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to TONSL and phenotypic similarity 0.415 to fish mutant of TONSL.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0010247, ossification increased occurrence, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.513

Phenotype Score: 0.500

Variant Score: 0.887

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-124358981-C-T [0/1] rs1212047865

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.887 CONTRIBUTING VARIANT

Transcripts:: ATAD2:ENST00000287394.5:c.2222G>A:p.(Cys741Tyr); ATAD2:ENST00000521903.1:c.176G>A:p.(Cys59Tyr)

Pathogenicity Data:: Best Score: 0.886801; Polyphen2: 0.001 (B); Mutation Taster: 0.887

Frequency Data:: TOPMed: 0.0004%

Exomiser Score: 0.512

Phenotype Score: 0.434

Variant Score: 0.961

Phenotype matches:

Phenotypic similarity 0.434 to Autosomal recessive centronuclear myopathy associated with TTN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0100807, Long fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0100807, Long fingers; HP:0010055, Broad hallux - HP:0100807, Long fingers

Phenotypic similarity 0.332 to mouse mutant involving TTN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0010225, abnormal quadriceps morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0010225, abnormal quadriceps morphology; HP:0010055, Broad hallux - MP:0010225, abnormal quadriceps morphology

Known diseases:: OMIM:600334 Tibial muscular dystrophy, tardive - autosomal dominant; OMIM:603689 Myopathy, myofibrillar, 9, with early respiratory failure - autosomal dominant; OMIM:604145 Cardiomyopathy, dilated, 1G - autosomal dominant; OMIM:608807 Muscular dystrophy, limb-girdle, autosomal recessive 10 - autosomal recessive; OMIM:611705 Salih myopathy - autosomal recessive; OMIM:613765 Cardiomyopathy, familial hypertrophic, 9 - autosomal dominant; ORPHA:154 Familial isolated dilated cardiomyopathy - autosomal dominant; ORPHA:169186 Autosomal recessive centronuclear myopathy - autosomal recessive; ORPHA:178464 Hereditary myopathy with early respiratory failure - autosomal dominant; ORPHA:324604 Classic multiminicore myopathy - unknown; ORPHA:609 Tibial muscular dystrophy - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.512

Phenotype Score: 0.434

Variant Score: 0.961

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.434 to ORPHA:169186 Autosomal recessive centronuclear myopathy

Variants contributing to score:

MISSENSE_VARIANT SNV 2-179399634-C-T [0/1] rs72629782

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.971 CONTRIBUTING VARIANT

Transcripts:: TTN:ENST00000342175.6:c.75089G>A:p.(Arg25030His); TTN:ENST00000342992.6:c.94004G>A:p.(Arg31335His); TTN:ENST00000359218.5:c.74888G>A:p.(Arg24963His); TTN:ENST00000460472.2:c.74513G>A:p.(Arg24838His); TTN:ENST00000589042.1:c.101708G>A:p.(Arg33903His); TTN:ENST00000591111.1:c.96785G>A:p.(Arg32262His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0091%; UK10K: 0.0132%; ExAC AFR: 0.0103%; ExAC EAS: 0.1759%; ExAC FIN: 0.0606%; ExAC NFE: 0.0075%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0066%; gnomAD_E_EAS: 0.1916%; gnomAD_E_FIN: 0.0767%; gnomAD_E_NFE: 0.0072%; gnomAD_E_SAS: 0.0033%; gnomAD_G_AFR: 0.0114%; gnomAD_G_EAS: 0.1870%; gnomAD_G_FIN: 0.0859%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 2-179640551-T-C [0/1] rs180672509

Exomiser ACMG: LIKELY_BENIGN [BP4, BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.951 CONTRIBUTING VARIANT

Transcripts:: TTN:ENST00000342175.6:c.5902A>G:p.(Thr1968Ala); TTN:ENST00000342992.6:c.6040A>G:p.(Thr2014Ala); TTN:ENST00000359218.5:c.5902A>G:p.(Thr1968Ala); TTN:ENST00000360870.5:c.6040A>G:p.(Thr2014Ala); TTN:ENST00000460472.2:c.5902A>G:p.(Thr1968Ala); TTN:ENST00000589042.1:c.6040A>G:p.(Thr2014Ala); TTN:ENST00000591111.1:c.6040A>G:p.(Thr2014Ala)

Pathogenicity Data:: Best Score: 0.979328; Polyphen2: 0.741 (P); Mutation Taster: 0.979 (P); SIFT: 0.176 (T)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0053%; ExAC EAS: 0.1850%; gnomAD_E_EAS: 0.1913%; gnomAD_G_EAS: 0.1856%

Other passed variants:

MISSENSE_VARIANT SNV 2-179583077-A-C [0/1] rs764248656

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.950

Transcripts:: TTN:ENST00000342992.6:c.21024T>G:p.(Asp7008Glu); TTN:ENST00000589042.1:c.24756T>G:p.(Asp8252Glu); TTN:ENST00000591111.1:c.23805T>G:p.(Asp7935Glu); TTN:ENST00000342175.6:c.13858+19732T>G:p.(=); TTN:ENST00000359218.5:c.13657+19732T>G:p.(=); TTN:ENST00000460472.2:c.13282+19732T>G:p.(=)

Pathogenicity Data:: Best Score: 0.999995; Polyphen2: 0.287 (B); Mutation Taster: 1.000 (P); SIFT: 0.934 (T)

Frequency Data:: TOPMed: 0.0129%; ExAC EAS: 0.1857%; gnomAD_E_EAS: 0.1914%; gnomAD_E_SAS: 0.0033%; gnomAD_G_EAS: 0.3141%

MISSENSE_VARIANT SNV 2-179650715-C-T [0/1] rs144639994

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.100

Transcripts:: TTN:ENST00000342175.6:c.2092G>A:p.(Ala698Thr); TTN:ENST00000342992.6:c.2230G>A:p.(Ala744Thr); TTN:ENST00000359218.5:c.2092G>A:p.(Ala698Thr); TTN:ENST00000360870.5:c.2230G>A:p.(Ala744Thr); TTN:ENST00000460472.2:c.2092G>A:p.(Ala698Thr); TTN:ENST00000589042.1:c.2230G>A:p.(Ala744Thr); TTN:ENST00000591111.1:c.2230G>A:p.(Ala744Thr)

Pathogenicity Data:: Best Score: 0.10699999; Polyphen2: 0.001 (B); SIFT: 0.893 (T)

Frequency Data:: 1000Genomes: 0.1198%; TOPMed: 0.0279%; ExAC EAS: 0.3722%; ExAC NFE: 0.0045%; ExAC SAS: 0.0545%; gnomAD_E_EAS: 0.3951%; gnomAD_E_FIN: 0.0045%; gnomAD_E_NFE: 0.0072%; gnomAD_E_OTH: 0.0182%; gnomAD_E_SAS: 0.0520%; gnomAD_G_EAS: 0.3086%; gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.512

Phenotype Score: 0.517

Variant Score: 0.867

Phenotype matches:

Proximity score 0.517 in interactome to CHST11 and phenotypic similarity 0.832 to ?Osteochondrodysplasia, brachydactyly, and overlapping malformed digits associated with CHST11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009778, Short thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.517 in interactome to CHST11 and phenotypic similarity 0.716 to mouse mutant of CHST11.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0000440, domed cranium; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005109, abnormal talus morphology

Known diseases:: OMIM:143200 Wagner syndrome 1 - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.512

Phenotype Score: 0.517

Variant Score: 0.867

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-82815395-C-T [0/1] rs775405712

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.867 CONTRIBUTING VARIANT

Transcripts:: VCAN:ENST00000265077.3:c.1270C>T:p.(Pro424Ser); VCAN:ENST00000342785.4:c.1270C>T:p.(Pro424Ser); VCAN:ENST00000512590.2:c.1126C>T:p.(Pro376Ser); VCAN:ENST00000343200.5:c.1042+7180C>T:p.(=); VCAN:ENST00000502527.2:c.1042+7180C>T:p.(=)

Pathogenicity Data:: Best Score: 0.875; Polyphen2: 0.028 (B); SIFT: 0.125 (T)

Frequency Data:: TOPMed: 0.0011%; ExAC EAS: 0.0231%; ExAC NFE: 0.0015%; gnomAD_E_EAS: 0.0174%; gnomAD_E_NFE: 0.0009%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.482

Phenotype Score: 0.520

Variant Score: 0.850

Phenotype matches:

Proximity score 0.520 in interactome to ZMIZ1 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with ZMIZ1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Known diseases:: OMIM:176807 Prostate cancer, susceptibility to (susceptibility); OMIM:300068 Androgen insensitivity - X-linked recessive; OMIM:300633 Hypospadias 1, X-linked - X-linked recessive; OMIM:312300 Androgen insensitivity, partial, with or without breast cancer - X-linked recessive; OMIM:313200 Spinal and bulbar muscular atrophy of Kennedy - X-linked recessive; ORPHA:481 Kennedy disease - X-linked recessive; ORPHA:90797 Partial androgen insensitivity syndrome - X-linked recessive; ORPHA:95706 Non-syndromic posterior hypospadias - X-linked recessive; ORPHA:99429 Complete androgen insensitivity syndrome - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.482

Phenotype Score: 0.520

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS X-66765158-T-TGCAGCAGCAGCAGCAGCA [0/1] rs3032358

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: AR:ENST00000374690.3:c.222_239dup:p.(Gln75_Gln80dup); AR:ENST00000396044.3:c.222_239dup:p.(Gln75_Gln80dup); AR:ENST00000504326.1:c.222_239dup:p.(Gln75_Gln80dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

X_DOMINANT

Exomiser Score: 0.059

Phenotype Score: 0.260

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS X-66765158-T-TGCAGCAGCAGCAGCAGCA [0/1] rs3032358

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: AR:ENST00000374690.3:c.222_239dup:p.(Gln75_Gln80dup); AR:ENST00000396044.3:c.222_239dup:p.(Gln75_Gln80dup); AR:ENST00000504326.1:c.222_239dup:p.(Gln75_Gln80dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.462

Phenotype Score: 0.513

Variant Score: 0.850

Phenotype matches:

Phenotypic similarity 0.513 to Congenital hypotonia, epilepsy, developmental delay, and digital anomalies associated with ATN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0010557, Overlapping fingers; HP:0010055, Broad hallux - HP:0001845, Overlapping toe

Phenotypic similarity 0.297 to mouse mutant involving ATN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.502 in interactome to RERE and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with RERE.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.502 in interactome to RERE and phenotypic similarity 0.280 to mouse mutant of RERE.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003425, abnormal optic vesicle formation; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.502 in interactome to RERE and phenotypic similarity 0.285 to fish mutant of RERE.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0001963, Meckel's cartilage sloped downward, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:125370 Dentatorubral-pallidoluysian atrophy - autosomal dominant; OMIM:618494 Congenital hypotonia, epilepsy, developmental delay, and digital anomalies - autosomal dominant; ORPHA:101 Dentatorubral pallidoluysian atrophy - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.462

Phenotype Score: 0.513

Variant Score: 0.850

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.513 to OMIM:618494 Congenital hypotonia, epilepsy, developmental delay, and digital anomalies

Variants contributing to score:

DISRUPTIVE_INFRAME_DELETION DEL 12-7045891-ACAGCAGCAGCAGCAG-A [-/1] rs60216939

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: LIKELY_BENIGN (no assertion criteria provided)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: ATN1:ENST00000356654.4:c.1494_1508del:p.(Gln498_Gln502del); ATN1:ENST00000396684.2:c.1494_1508del:p.(Gln498_Gln502del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.054

Phenotype Score: 0.251

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_DELETION DEL 12-7045891-ACAGCAGCAG-A [-/1] rs60216939

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: ATN1:ENST00000356654.4:c.1500_1508del:p.(Gln500_Gln502del); ATN1:ENST00000396684.2:c.1500_1508del:p.(Gln500_Gln502del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

DISRUPTIVE_INFRAME_DELETION DEL 12-7045891-ACAGCAGCAGCAGCAG-A [-/1] rs60216939

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: LIKELY_BENIGN (no assertion criteria provided)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: ATN1:ENST00000356654.4:c.1494_1508del:p.(Gln498_Gln502del); ATN1:ENST00000396684.2:c.1494_1508del:p.(Gln498_Gln502del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.443

Phenotype Score: 0.772

Variant Score: 0.548

Phenotype matches:

Phenotypic similarity 0.772 to Weill-Marchesani syndrome 1, recessive associated with ADAMTS10.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002682, Broad skull; HP:0011304, Broad thumb - HP:0009768, Broad phalanges of the hand; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Phenotypic similarity 0.512 to mouse mutant involving ADAMTS10.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003055, abnormal long bone epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0014176, abnormal cilary zonule morphology; HP:0011304, Broad thumb - MP:0003055, abnormal long bone epiphyseal plate morphology; HP:0010055, Broad hallux - MP:0003055, abnormal long bone epiphyseal plate morphology

Proximity score 0.506 in interactome to FBN1 and phenotypic similarity 0.750 to Weill-Marchesani syndrome 2, dominant associated with FBN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002682, Broad skull; HP:0011304, Broad thumb - HP:0009768, Broad phalanges of the hand; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.506 in interactome to FBN1 and phenotypic similarity 0.683 to mouse mutant of FBN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004634, short metacarpal bones; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002543, brachyphalangia; HP:0010055, Broad hallux - MP:0004634, short metacarpal bones

Known diseases:: OMIM:277600 Weill-Marchesani syndrome 1, recessive - autosomal recessive; ORPHA:3449 Weill-Marchesani syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.443

Phenotype Score: 0.772

Variant Score: 0.548

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.772 to OMIM:277600 Weill-Marchesani syndrome 1, recessive
Phenotypic similarity 0.691 to ORPHA:3449 Weill-Marchesani syndrome

Variants contributing to score:

MISSENSE_VARIANT SNV 19-8666020-G-A [0/1] rs572980571

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: ADAMTS10:ENST00000270328.4:c.602C>T:p.(Pro201Leu); ADAMTS10:ENST00000597188.1:c.602C>T:p.(Pro201Leu)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.328 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0011%; ExAC EAS: 0.0118%; ExAC SAS: 0.0122%; gnomAD_E_AFR: 0.0068%; gnomAD_E_EAS: 0.0349%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0065%

SYNONYMOUS_VARIANT SNV 19-8651770-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ADAMTS10:ENST00000270328.4:c.2169T>C:p.(=); ADAMTS10:ENST00000595838.1:c.630T>C:p.(=); ADAMTS10:ENST00000597188.1:c.2169T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.185

Phenotype Score: 0.256

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-8666020-G-A [0/1] rs572980571

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: ADAMTS10:ENST00000270328.4:c.602C>T:p.(Pro201Leu); ADAMTS10:ENST00000597188.1:c.602C>T:p.(Pro201Leu)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.328 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0011%; ExAC EAS: 0.0118%; ExAC SAS: 0.0122%; gnomAD_E_AFR: 0.0068%; gnomAD_E_EAS: 0.0349%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0065%

Exomiser Score: 0.432

Phenotype Score: 0.500

Variant Score: 0.851

Phenotype matches:

Proximity score 0.500 in interactome to MAP3K20 and phenotypic similarity 0.382 to Split-foot malformation with mesoaxial polydactyly associated with MAP3K20.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0012725, Cutaneous syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0012725, Cutaneous syndactyly; HP:0010055, Broad hallux - HP:0012725, Cutaneous syndactyly

Proximity score 0.500 in interactome to MAP3K20 and phenotypic similarity 0.723 to mouse mutant of MAP3K20.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.432

Phenotype Score: 0.500

Variant Score: 0.851

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-27684067-C-G [0/1] rs1222017421

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.851 CONTRIBUTING VARIANT

Transcripts:: MAP3K6:ENST00000357582.2:c.3082G>C:p.(Gly1028Arg); MAP3K6:ENST00000374040.3:c.3058G>C:p.(Gly1020Arg); MAP3K6:ENST00000493901.1:c.3082G>C:p.(Gly1028Arg)

Pathogenicity Data:: Best Score: 0.851; Polyphen2: 0.020 (B); SIFT: 0.149 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.431

Phenotype Score: 0.501

Variant Score: 0.850

Phenotype matches:

Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.665 to Okur-Chung neurodevelopmental syndrome associated with CSNK2A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0030084, Clinodactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.535 to mouse mutant of CSNK2A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology; HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape; HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology; HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.431

Phenotype Score: 0.501

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 16-30670916-G-GCCGAGA [0/1] rs2052428844

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: FBRS:ENST00000356166.6:c.87_92dup:p.(Asp30_Arg31dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.408

Phenotype Score: 0.541

Variant Score: 0.794

Phenotype matches:

Phenotypic similarity 0.541 to X-linked non-syndromic intellectual disability associated with DMD.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Phenotypic similarity 0.306 to mouse mutant involving DMD.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0010227, decreased quadriceps weight; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0010227, decreased quadriceps weight; HP:0010055, Broad hallux - MP:0010227, decreased quadriceps weight

Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification; HP:0011304, Broad thumb - MP:0004351, short humerus; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

Known diseases:: OMIM:300376 Becker muscular dystrophy - X-linked recessive; OMIM:302045 Cardiomyopathy, dilated, 3B - X-linked; OMIM:310200 Duchenne muscular dystrophy - X-linked recessive; ORPHA:154 Familial isolated dilated cardiomyopathy - X-linked; ORPHA:777 X-linked non-syndromic intellectual disability - X-linked recessive; ORPHA:98895 Becker muscular dystrophy - X-linked recessive; ORPHA:98896 Duchenne muscular dystrophy - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.408

Phenotype Score: 0.541

Variant Score: 0.794

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to ORPHA:777 X-linked non-syndromic intellectual disability
Phenotypic similarity 0.274 to ORPHA:98895 Becker muscular dystrophy
Phenotypic similarity 0.175 to ORPHA:154 Familial isolated dilated cardiomyopathy

Variants contributing to score:

MISSENSE_VARIANT SNV X-32563348-G-C [0/1] rs202008454

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.794 CONTRIBUTING VARIANT

Transcripts:: DMD:ENST00000288447.4:c.2072C>G:p.(Ala691Gly); DMD:ENST00000357033.4:c.2096C>G:p.(Ala699Gly); DMD:ENST00000378677.2:c.2084C>G:p.(Ala695Gly)

Pathogenicity Data:: Best Score: 0.955; Polyphen2: 0.551 (P); SIFT: 0.045 (D)

Frequency Data:: 1000Genomes: 0.0530%; TOPMed: 0.0366%; ExAC EAS: 0.7258%; ExAC OTH: 0.1590%; ExAC SAS: 0.0299%; gnomAD_E_EAS: 0.8089%; gnomAD_E_OTH: 0.0248%; gnomAD_E_SAS: 0.0418%; gnomAD_G_EAS: 0.6849%

Exomiser Score: 0.375

Phenotype Score: 0.347

Variant Score: 0.998

Phenotype matches:

Phenotypic similarity 0.347 to mouse mutant involving NOS2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.375

Phenotype Score: 0.347

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT SNV 17-26087772-T-G [0/1] rs1337800290

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: NOS2:ENST00000313735.6:c.2889-2A>C:p.?

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: gnomAD_G_NFE: 0.0134%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.258

Phenotype Score: 0.347

Variant Score: 0.939

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT SNV 17-26087772-T-G [0/1] rs1337800290

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: NOS2:ENST00000313735.6:c.2889-2A>C:p.?

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: gnomAD_G_NFE: 0.0134%

MISSENSE_VARIANT SNV 17-26087768-G-A [0/1] rs1258316978

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.879 CONTRIBUTING VARIANT

Transcripts:: NOS2:ENST00000313735.6:c.2891C>T:p.(Ala964Val)

Pathogenicity Data:: Best Score: 0.88; Polyphen2: 0.006 (B); Mutation Taster: 0.587; SIFT: 0.120 (T)

Frequency Data:: gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.372

Phenotype Score: 0.506

Variant Score: 0.817

Phenotype matches:

Proximity score 0.506 in interactome to SH3PXD2B and phenotypic similarity 0.653 to Frank-Ter Haar syndrome associated with SH3PXD2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.506 in interactome to SH3PXD2B and phenotypic similarity 0.694 to mouse mutant of SH3PXD2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0030853, abnormal iliac crest morphology; HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology; HP:0011304, Broad thumb - MP:0000159, abnormal xiphoid process morphology; HP:0010055, Broad hallux - MP:0030853, abnormal iliac crest morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.372

Phenotype Score: 0.506

Variant Score: 0.817

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-40558517-G-T [0/1] rs781727329

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.817 CONTRIBUTING VARIANT

Transcripts:: PAK6:ENST00000260404.4:c.679G>T:p.(Ala227Ser); PAK6:ENST00000441369.1:c.679G>T:p.(Ala227Ser); PAK6:ENST00000453867.1:c.679G>T:p.(Ala227Ser); PAK6:ENST00000455577.2:c.679G>T:p.(Ala227Ser); PAK6:ENST00000542403.2:c.679G>T:p.(Ala227Ser); PAK6:ENST00000560346.1:c.679G>T:p.(Ala227Ser); PAK6:ENST00000558658.1:c.*477G>T:p.(=)

Pathogenicity Data:: Best Score: 0.827; Polyphen2: 0.002 (B); SIFT: 0.173 (T)

Frequency Data:: TOPMed: 0.0023%; ExAC EAS: 0.0841%; gnomAD_E_EAS: 0.0584%

Exomiser Score: 0.364

Phenotype Score: 0.518

Variant Score: 0.800

Phenotype matches:

Proximity score 0.518 in interactome to NABP2 and phenotypic similarity 0.692 to mouse mutant of NABP2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000565, oligodactyly; HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology; HP:0011304, Broad thumb - MP:0000565, oligodactyly; HP:0010055, Broad hallux - MP:0000565, oligodactyly

Known diseases:: ORPHA:520 Acute promyelocytic leukemia (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.364

Phenotype Score: 0.518

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 2-192543129-CT-C [0/1] rs781513296

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: NABP1:ENST00000409510.1:c.-150+8del:p.(=); NABP1:ENST00000410026.2:c.-150+163del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.303 to mouse mutant involving RGR.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005253, abnormal eye physiology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.511 in interactome to RDH10 and phenotypic similarity 0.880 to mouse mutant of RDH10.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0001286, abnormal eye development; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

Known diseases:: OMIM:613769 Retinitis pigmentosa 44 - autosomal dominant/recessive; ORPHA:791 Retinitis pigmentosa - autosomal dominant/recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 10-86012608-T-G [0/1] rs1213129665

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: RGR:ENST00000358110.5:c.359-5T>G:p.?; RGR:ENST00000359452.4:c.371-5T>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

Phenotype matches:

Proximity score 0.511 in interactome to EVX2 and phenotypic similarity 0.952 to mouse mutant of EVX2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002543, brachyphalangia; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Known diseases:: OMIM:201400 Adrenocorticotropic hormone deficiency - autosomal recessive; ORPHA:199296 Congenital isolated ACTH deficiency - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 1-168262522-A-AGTGTGTGT [1/1] rs57039241

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: TBX19:ENST00000367821.3:c.603+6_603+7insGTGTGTGT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.332

Phenotype Score: 0.512

Variant Score: 0.791

Phenotype matches:

Proximity score 0.512 in interactome to ZC3H8 and phenotypic similarity 0.755 to mouse mutant of ZC3H8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.332

Phenotype Score: 0.512

Variant Score: 0.791

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV X-100093220-C-G [0/1] rs200116124

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.791 CONTRIBUTING VARIANT

Transcripts:: CSTF2:ENST00000372972.2:c.1612-8C>G:p.?; CSTF2:ENST00000415585.2:c.1672-8C>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0530%; TOPMed: 0.0042%; ExAC EAS: 0.0754%; gnomAD_E_EAS: 0.0762%

X_DOMINANT

Exomiser Score: 0.332

Phenotype Score: 0.512

Variant Score: 0.791

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV X-100093220-C-G [0/1] rs200116124

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.791 CONTRIBUTING VARIANT

Transcripts:: CSTF2:ENST00000372972.2:c.1612-8C>G:p.?; CSTF2:ENST00000415585.2:c.1672-8C>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0530%; TOPMed: 0.0042%; ExAC EAS: 0.0754%; gnomAD_E_EAS: 0.0762%

Exomiser Score: 0.331

Phenotype Score: 0.512

Variant Score: 0.791

Phenotype matches:

Proximity score 0.512 in interactome to DISP1 and phenotypic similarity 0.681 to Holoprosencephaly associated with DISP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0005469, Flat occiput; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.512 in interactome to DISP1 and phenotypic similarity 0.568 to mouse mutant of DISP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000550, abnormal forelimb morphology; HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape; HP:0011304, Broad thumb - MP:0000550, abnormal forelimb morphology; HP:0010055, Broad hallux - MP:0000550, abnormal forelimb morphology

Proximity score 0.512 in interactome to DISP1 and phenotypic similarity 0.308 to fish mutant of DISP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0005403, joint mandibular arch skeleton malformed, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.331

Phenotype Score: 0.512

Variant Score: 0.791

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-99769449-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.791 CONTRIBUTING VARIANT

Transcripts:: GPC2:ENST00000292377.2:c.1123G>A:p.(Glu375Lys)

Pathogenicity Data:: Best Score: 0.791; Polyphen2: 0.264 (B); SIFT: 0.209 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.331

Phenotype Score: 0.504

Variant Score: 0.800

Phenotype matches:

Proximity score 0.504 in interactome to EFNB1 and phenotypic similarity 0.807 to Craniofrontonasal dysplasia associated with EFNB1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0004440, Coronal craniosynostosis; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.504 in interactome to EFNB1 and phenotypic similarity 0.765 to mouse mutant of EFNB1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0004378, frontal bone foramen; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.331

Phenotype Score: 0.504

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 7-142560576-G-GA [0/1] rs1346772225

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: EPHB6:ENST00000392957.2:c.-104dup:p.(=); EPHB6:ENST00000442129.1:c.-100dup:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.331

Phenotype Score: 0.505

Variant Score: 0.799

Phenotype matches:

Proximity score 0.505 in interactome to ADK and phenotypic similarity 0.393 to Hypermethioninemia due to adenosine kinase deficiency associated with ADK.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001786, Narrow foot; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0001786, Narrow foot; HP:0010055, Broad hallux - HP:0001786, Narrow foot

Proximity score 0.505 in interactome to ADK and phenotypic similarity 0.755 to mouse mutant of ADK.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases:: OMIM:619150 Intellectual developmental disorder with paroxysmal dyskinesia or seizures - autosomal recessive; ORPHA:31709 Infantile convulsions and choreoathetosis - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.331

Phenotype Score: 0.505

Variant Score: 0.799

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 11-72292403-G-A [0/1] rs200284582

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.799 CONTRIBUTING VARIANT

Transcripts:: PDE2A:ENST00000334456.5:c.2043C>T:p.(=); PDE2A:ENST00000376450.3:c.1275C>T:p.(=); PDE2A:ENST00000418754.2:c.1698C>T:p.(=); PDE2A:ENST00000444035.2:c.2016C>T:p.(=); PDE2A:ENST00000540345.1:c.2016C>T:p.(=); PDE2A:ENST00000544570.1:c.2022C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC NFE: 0.0016%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0046%

Exomiser Score: 0.330

Phenotype Score: 0.503

Variant Score: 0.800

Phenotype matches:

Proximity score 0.503 in interactome to PDE6D and phenotypic similarity 0.703 to Orofaciodigital syndrome type 6 associated with PDE6D.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.503 in interactome to PDE6D and phenotypic similarity 0.343 to mouse mutant of PDE6D.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004022, abnormal cone electrophysiology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:606703 Dyskinesia, familial, with facial myokymia - autosomal dominant; ORPHA:1429 Benign hereditary chorea - autosomal dominant; ORPHA:324588 Familial dyskinesia and facial myokymia - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.330

Phenotype Score: 0.503

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 3-123038669-G-A [0/1] rs1941120792

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: ADCY5:ENST00000309879.5:c.1062-4C>T:p.?; ADCY5:ENST00000462833.1:c.2112-4C>T:p.?; ADCY5:ENST00000491190.1:c.1011-4C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

Exomiser Score: 0.329

Phenotype Score: 0.340

Variant Score: 0.984

Phenotype matches:

Phenotypic similarity 0.340 to mouse mutant involving RP1L1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004022, abnormal cone electrophysiology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:613587 Occult macular dystrophy - autosomal dominant; OMIM:618826 Retinitis pigmentosa 88 - autosomal recessive; ORPHA:791 Retinitis pigmentosa - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.329

Phenotype Score: 0.340

Variant Score: 0.984

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-10480644-C-G [0/1] rs777820137

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.984 CONTRIBUTING VARIANT

Transcripts:: RP1L1:ENST00000382483.3:c.68G>C:p.(Arg23Pro)

Pathogenicity Data:: Best Score: 0.994; SIFT: 0.006 (D)

Frequency Data:: gnomAD_E_AFR: 0.0696%; gnomAD_E_FIN: 0.0515%; gnomAD_E_NFE: 0.0700%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.227

Phenotype Score: 0.340

Variant Score: 0.929

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 8-10480644-C-G [0/1] rs777820137

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.984 CONTRIBUTING VARIANT

Transcripts:: RP1L1:ENST00000382483.3:c.68G>C:p.(Arg23Pro)

Pathogenicity Data:: Best Score: 0.994; SIFT: 0.006 (D)

Frequency Data:: gnomAD_E_AFR: 0.0696%; gnomAD_E_FIN: 0.0515%; gnomAD_E_NFE: 0.0700%

MISSENSE_VARIANT SNV 8-10467637-T-C [0/1] rs4240659

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.873 CONTRIBUTING VARIANT

Transcripts:: RP1L1:ENST00000382483.3:c.3971A>G:p.(Glu1324Gly)

Pathogenicity Data:: Best Score: 0.873; SIFT: 0.127 (T)

Frequency Data:: No frequency data

Other passed variants:

DISRUPTIVE_INFRAME_INSERTION INS 8-10467589-T-TCCTCTAACTGCACCCTCTCTTCTTGCAGCCCTTCTATTACTTTAGTCC [-/1] rs1585963467

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.850

Transcripts:: RP1L1:ENST00000382483.3:c.4018_4019insGGACTAAAGTAATAGAAGGGCTGCAAGAAGAGAGGGTGCAGTTAGAGG:p.(Glu1339_Glu1340insGlyThrLysValIleGluGlyLeuGlnGluGluArgValGlnLeuGlu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.328

Phenotype Score: 0.503

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.307 to mouse mutant involving CGN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002111, abnormal tail morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002111, abnormal tail morphology; HP:0010055, Broad hallux - MP:0002111, abnormal tail morphology

Proximity score 0.503 in interactome to TGFBR1 and phenotypic similarity 0.749 to Loeys-Dietz syndrome 1 associated with TGFBR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0001166, Arachnodactyly

Proximity score 0.503 in interactome to TGFBR1 and phenotypic similarity 0.952 to mouse mutant of TGFBR1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.328

Phenotype Score: 0.503

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 1-151501822-C-T [0/1] rs1664773807

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: CGN:ENST00000271636.7:c.1897-4C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

Exomiser Score: 0.326

Phenotype Score: 0.502

Variant Score: 0.800

Phenotype matches:

Proximity score 0.502 in interactome to BMS1 and phenotypic similarity 0.602 to Aplasia cutis congenita associated with BMS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.502 in interactome to BMS1 and phenotypic similarity 0.299 to mouse mutant of BMS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.326

Phenotype Score: 0.502

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 12-75900396-C-CA [0/1] rs35071517

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: KRR1:ENST00000229214.4:c.394-8_394-7insT:p.?; KRR1:ENST00000438169.2:c.394-8_394-7insT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

Phenotype matches:

Proximity score 0.501 in interactome to NOS3 and phenotypic similarity 0.712 to mouse mutant of NOS3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 15-69334995-T-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: NOX5:ENST00000260364.5:c.1451-8T>G:p.?; NOX5:ENST00000388866.3:c.1505-8T>G:p.?; NOX5:ENST00000448182.3:c.1367-8T>G:p.?; NOX5:ENST00000455873.3:c.1400-8T>G:p.?; NOX5:ENST00000530406.2:c.1421-8T>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.245 to mouse mutant involving SEC63.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0010124, decreased bone mineral content; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.665 to Okur-Chung neurodevelopmental syndrome associated with CSNK2A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0030084, Clinodactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.535 to mouse mutant of CSNK2A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology; HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape; HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology; HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology

Known diseases:: OMIM:617004 Polycystic liver disease 2 - autosomal dominant; ORPHA:2924 Isolated polycystic liver disease - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 6-108197874-C-CAAA [0/1] rs749125299

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: SEC63:ENST00000369002.4:c.1936-9_1936-8insTTT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.324

Phenotype Score: 0.506

Variant Score: 0.794

Phenotype matches:

Proximity score 0.506 in interactome to EPB41L1 and phenotypic similarity 0.684 to ?Intellectual developmental disorder, autosomal dominant 11 associated with EPB41L1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.506 in interactome to EPB41L1 and phenotypic similarity 0.294 to mouse mutant of EPB41L1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001340, abnormal eyelid morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.324

Phenotype Score: 0.506

Variant Score: 0.794

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 11-64490434-CCA-C [0/1] rs1189888724

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.794 CONTRIBUTING VARIANT

Transcripts:: NRXN2:ENST00000265459.6:c.-245+7_-245+8del:p.(=); NRXN2:ENST00000377559.3:c.-245+7_-245+8del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.0517%; gnomAD_G_NFE: 0.0235%

Exomiser Score: 0.323

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:

Proximity score 0.500 in interactome to PIGK and phenotypic similarity 0.660 to Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures associated with PIGK.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.323

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 8-145730879-T-TGCCC [0/1] rs1826753684

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: GPT:ENST00000394955.2:c.739+7_739+8insGCCC:p.?; GPT:ENST00000528431.1:c.739+7_739+8insGCCC:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.303 to mouse mutant involving EYA3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to MEIS2 and phenotypic similarity 0.856 to Cleft palate, cardiac defects, and mental retardation associated with MEIS2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009237, Short 5th finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.500 in interactome to MEIS2 and phenotypic similarity 0.299 to mouse mutant of MEIS2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 1-28337454-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: EYA3:ENST00000373863.3:c.771+4T>G:p.?; EYA3:ENST00000373864.1:c.438+4T>G:p.?; EYA3:ENST00000373871.3:c.909+4T>G:p.?; EYA3:ENST00000436342.2:c.531+4T>G:p.?; EYA3:ENST00000540618.1:c.771+4T>G:p.?; EYA3:ENST00000545175.1:c.750+4T>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:

Proximity score 0.500 in interactome to COL11A2 and phenotypic similarity 0.660 to Fibrochondrogenesis associated with COL11A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0000885, Broad ribs; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to COL11A2 and phenotypic similarity 0.502 to mouse mutant of COL11A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate; HP:0001363, Craniosynostosis - MP:0030049, prominent forehead; HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate; HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate

Proximity score 0.500 in interactome to COL11A2 and phenotypic similarity 0.447 to fish mutant of COL11A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0000119, endochondral ossification disrupted, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 13-21361194-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: XPO4:ENST00000255305.6:c.3168G>A:p.(=); XPO4:ENST00000400602.2:c.3168G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:

Proximity score 0.500 in interactome to TELO2 and phenotypic similarity 0.650 to TELO2-related intellectual disability-neurodevelopmental disorder associated with TELO2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0004692, 4-5 toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 5-146752857-T-C [0/1] rs1394522288

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: STK32A:ENST00000397936.3:c.903T>C:p.(=); STK32A:ENST00000398523.3:c.903T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

Exomiser Score: 0.319

Phenotype Score: 0.500

Variant Score: 0.798

Phenotype matches:

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput; HP:0011304, Broad thumb - HP:0010557, Overlapping fingers; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.319

Phenotype Score: 0.500

Variant Score: 0.798

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 1-26013026-C-T [0/1] rs769609026

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.798 CONTRIBUTING VARIANT

Transcripts:: MAN1C1:ENST00000263979.3:c.96C>T:p.(=); MAN1C1:ENST00000374332.4:c.636C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0030%; ExAC AMR: 0.0173%; ExAC NFE: 0.0030%; gnomAD_E_AMR: 0.0149%; gnomAD_E_NFE: 0.0045%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.316

Phenotype Score: 0.500

Variant Score: 0.797

Phenotype matches:

Proximity score 0.500 in interactome to EXOC8 and phenotypic similarity 0.635 to ?Neurodevelopmental disorder with microcephaly, seizures, and brain atrophy associated with EXOC8.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.316

Phenotype Score: 0.500

Variant Score: 0.797

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 17-43480072-C-T [0/1] rs745879917

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.797 CONTRIBUTING VARIANT

Transcripts:: ARHGAP27:ENST00000376922.2:c.720+8G>A:p.?; ARHGAP27:ENST00000428638.1:c.1743+8G>A:p.?; ARHGAP27:ENST00000442348.1:c.1662+8G>A:p.?; ARHGAP27:ENST00000455881.1:c.720+8G>A:p.?; ARHGAP27:ENST00000528384.1:c.639+8G>A:p.?; ARHGAP27:ENST00000532038.1:c.1077+8G>A:p.?; ARHGAP27:ENST00000532891.2:c.1677+8G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0038%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0018%; gnomAD_G_FIN: 0.0286%

Exomiser Score: 0.309

Phenotype Score: 0.500

Variant Score: 0.793

Phenotype matches:

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput; HP:0011304, Broad thumb - HP:0010557, Overlapping fingers; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.309

Phenotype Score: 0.500

Variant Score: 0.793

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 20-34145191-C-T [0/1] rs746387753

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.793 CONTRIBUTING VARIANT

Transcripts:: ERGIC3:ENST00000279052.6:c.1088-5C>T:p.?; ERGIC3:ENST00000348547.2:c.1073-5C>T:p.?; ERGIC3:ENST00000357394.4:c.1088-5C>T:p.?; ERGIC3:ENST00000447986.1:c.1118-5C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ExAC EAS: 0.0347%; gnomAD_E_EAS: 0.0232%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.303

Phenotype Score: 0.501

Variant Score: 0.789

Phenotype matches:

Phenotypic similarity 0.288 to mouse mutant involving NRG1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001322, abnormal iris morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to EVX2 and phenotypic similarity 0.952 to mouse mutant of EVX2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002543, brachyphalangia; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.303

Phenotype Score: 0.501

Variant Score: 0.789

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 8-32620883-G-C [0/1] rs751248065

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.789 CONTRIBUTING VARIANT

Transcripts:: NRG1:ENST00000521670.1:c.*21+6G>C:p.(=); NRG1:ENST00000287842.3:c.1260-383G>C:p.(=); NRG1:ENST00000287845.5:c.1182-383G>C:p.(=); NRG1:ENST00000338921.4:c.1293-383G>C:p.(=); NRG1:ENST00000356819.4:c.1284-383G>C:p.(=); NRG1:ENST00000405005.3:c.1269-383G>C:p.(=); NRG1:ENST00000519301.1:c.1119-383G>C:p.(=); NRG1:ENST00000539990.1:c.798-383G>C:p.(=); NRG1:ENST00000341377.5:c.*584-383G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0026%; ExAC EAS: 0.0927%; gnomAD_E_EAS: 0.0871%; gnomAD_G_EAS: 0.0618%

Exomiser Score: 0.302

Phenotype Score: 0.504

Variant Score: 0.786

Phenotype matches:

Phenotypic similarity 0.332 to Aromatase deficiency associated with CYP19A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002857, Genu valgum; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0002857, Genu valgum; HP:0010055, Broad hallux - HP:0002857, Genu valgum

Phenotypic similarity 0.352 to mouse mutant involving CYP19A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to SC5D and phenotypic similarity 0.646 to Lathosterolosis associated with SC5D.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.504 in interactome to SC5D and phenotypic similarity 0.731 to mouse mutant of SC5D.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis - MP:0002639, micrognathia; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

Known diseases:: OMIM:139300 Aromatase excess syndrome - autosomal dominant; OMIM:613546 Aromatase deficiency - autosomal recessive; ORPHA:91 Aromatase deficiency - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.302

Phenotype Score: 0.504

Variant Score: 0.786

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-51514597-G-A [0/1] rs761722363

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.786 CONTRIBUTING VARIANT

Transcripts:: CYP19A1:ENST00000260433.2:c.577C>T:p.(Arg193Cys); CYP19A1:ENST00000396402.1:c.577C>T:p.(Arg193Cys); CYP19A1:ENST00000396404.4:c.577C>T:p.(Arg193Cys); CYP19A1:ENST00000405913.3:c.577C>T:p.(Arg193Cys); CYP19A1:ENST00000557858.1:c.577C>T:p.(Arg193Cys); CYP19A1:ENST00000559878.1:c.577C>T:p.(Arg193Cys)

Pathogenicity Data:: Best Score: 0.78617; Polyphen2: 0.001 (B); Mutation Taster: 0.786; SIFT: 0.252 (T)

Frequency Data:: TOPMed: 0.0011%; ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0018%

Exomiser Score: 0.301

Phenotype Score: 0.314

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.314 to mouse mutant involving ZSCAN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.301

Phenotype Score: 0.314

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-85164121-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZSCAN2:ENST00000327179.6:c.692G>C:p.(Ser231Thr); ZSCAN2:ENST00000358472.3:c.245G>C:p.(Ser82Thr); ZSCAN2:ENST00000448803.2:c.695G>C:p.(Ser232Thr); ZSCAN2:ENST00000546148.1:c.695G>C:p.(Ser232Thr); ZSCAN2:ENST00000485222.2:c.577+118G>C:p.(=); ZSCAN2:ENST00000538076.1:c.577+118G>C:p.(=); ZSCAN2:ENST00000541040.1:c.577+118G>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.094 (B); Mutation Taster: 1.000 (P); SIFT: 0.226 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.288

Phenotype Score: 0.315

Variant Score: 0.991

Phenotype matches:

Phenotypic similarity 0.464 to Arthrogryposis multiplex congenita 3, myogenic type associated with SYNE1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001181, Adducted thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0001181, Adducted thumb

Phenotypic similarity 0.305 to mouse mutant involving SYNE1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009434, paraparesis; HP:0001363, Craniosynostosis - MP:0001852, conjunctivitis; HP:0011304, Broad thumb - MP:0009434, paraparesis; HP:0010055, Broad hallux - MP:0009434, paraparesis

Known diseases:: OMIM:610743 Spinocerebellar ataxia, autosomal recessive 8 - autosomal recessive; OMIM:612998 Emery-Dreifuss muscular dystrophy 4, autosomal dominant - autosomal dominant; OMIM:618484 Arthrogryposis multiplex congenita 3, myogenic type - autosomal recessive; ORPHA:88644 Autosomal recessive ataxia, Beauce type - autosomal recessive; ORPHA:98853 Autosomal dominant Emery-Dreifuss muscular dystrophy - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.288

Phenotype Score: 0.315

Variant Score: 0.991

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.315 to ORPHA:98853 Autosomal dominant Emery-Dreifuss muscular dystrophy

Variants contributing to score:

MISSENSE_VARIANT SNV 6-152651397-G-A [0/1] rs373040273

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, multiple submitters, no conflicts)

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: SYNE1:ENST00000265368.4:c.14423C>T:p.(Thr4808Met); SYNE1:ENST00000341594.5:c.13664C>T:p.(Thr4555Met); SYNE1:ENST00000367255.5:c.14423C>T:p.(Thr4808Met); SYNE1:ENST00000423061.1:c.14210C>T:p.(Thr4737Met); SYNE1:ENST00000448038.1:c.14210C>T:p.(Thr4737Met)

Pathogenicity Data:: Best Score: 0.999954; Polyphen2: 0.074 (B); Mutation Taster: 1.000 (P); SIFT: 0.041 (D)

Frequency Data:: TOPMed: 0.0135%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC AMR: 0.0086%; ExAC EAS: 0.0347%; ExAC NFE: 0.0060%; ExAC SAS: 0.0061%; gnomAD_E_AMR: 0.0060%; gnomAD_E_EAS: 0.0464%; gnomAD_E_NFE: 0.0063%; gnomAD_E_SAS: 0.0032%; gnomAD_G_EAS: 0.0617%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.285

Phenotype Score: 0.501

Variant Score: 0.780

Phenotype matches:

Proximity score 0.501 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput; HP:0011304, Broad thumb - HP:0010557, Overlapping fingers; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.501 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.285

Phenotype Score: 0.501

Variant Score: 0.780

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-91452720-A-C [0/1] rs184915505

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.983 CONTRIBUTING VARIANT

Transcripts:: MAN2A2:ENST00000360468.3:c.1360A>C:p.(Asn454His); MAN2A2:ENST00000559717.1:c.1360A>C:p.(Asn454His); MAN2A2:ENST00000431652.2:c.87A>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.002 (B); Mutation Taster: 1.000 (P); SIFT: 0.110 (T)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0143%; ExAC EAS: 0.1041%; gnomAD_E_EAS: 0.1160%; gnomAD_G_EAS: 0.0617%

MISSENSE_VARIANT SNV 15-91462950-C-T [0/1] rs182134455

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.577 CONTRIBUTING VARIANT

Transcripts:: MAN2A2:ENST00000360468.3:c.3386C>T:p.(Pro1129Leu); MAN2A2:ENST00000430376.2:c.956C>T:p.(Pro319Leu); MAN2A2:ENST00000431652.2:c.1910C>T:p.(Pro637Leu); MAN2A2:ENST00000559717.1:c.3386C>T:p.(Pro1129Leu)

Pathogenicity Data:: Best Score: 0.999988; Polyphen2: 0.006 (B); Mutation Taster: 1.000 (P); SIFT: 0.274 (T)

Frequency Data:: 1000Genomes: 0.3395%; TOPMed: 0.0521%; ExAC EAS: 1.2133%; ExAC NFE: 0.0030%; gnomAD_E_EAS: 1.2757%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0182%; gnomAD_E_SAS: 0.0032%; gnomAD_G_EAS: 1.4180%

Exomiser Score: 0.282

Phenotype Score: 0.504

Variant Score: 0.775

Phenotype matches:

Phenotypic similarity 0.275 to mouse mutant involving RGPD4.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004021, abnormal rod electrophysiology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to GRIP1 and phenotypic similarity 0.584 to Fraser syndrome associated with GRIP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.504 in interactome to GRIP1 and phenotypic similarity 0.757 to mouse mutant of GRIP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.282

Phenotype Score: 0.504

Variant Score: 0.775

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-108479427-G-A [0/1] rs746041708

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.775 CONTRIBUTING VARIANT

Transcripts:: RGPD4:ENST00000354986.4:c.2408G>A:p.(Arg803Gln); RGPD4:ENST00000408999.3:c.2408G>A:p.(Arg803Gln)

Pathogenicity Data:: Best Score: 0.778; Polyphen2: 0.000 (B); SIFT: 0.222 (T)

Frequency Data:: gnomAD_E_EAS: 0.0295%; gnomAD_E_FIN: 0.0045%; gnomAD_E_NFE: 0.0028%; gnomAD_E_OTH: 0.0187%; gnomAD_E_SAS: 0.0177%; gnomAD_G_NFE: 0.0153%

Exomiser Score: 0.262

Phenotype Score: 0.295

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.295 to mouse mutant involving GBP3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.262

Phenotype Score: 0.295

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 1-89480231-A-AGG [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GBP3:ENST00000370481.4:c.426_427insCC:p.(Tyr143Profs*4)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.124

Phenotype Score: 0.295

Variant Score: 0.900

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 1-89480231-A-AGG [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: GBP3:ENST00000370481.4:c.426_427insCC:p.(Tyr143Profs*4)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 1-89480232-C-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: GBP3:ENST00000370481.4:c.426G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.253

Phenotype Score: 0.294

Variant Score: 0.996

Phenotype matches:

Phenotypic similarity 0.294 to mouse mutant involving TMEM145.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001304, cataract; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.253

Phenotype Score: 0.294

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-42827820-C-G [0/1] rs772304118

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: TMEM145:ENST00000301204.3:c.1280C>G:p.(Pro427Arg)

Pathogenicity Data:: Best Score: 0.997535; Polyphen2: 0.675 (P); Mutation Taster: 0.998 (P); SIFT: 0.428 (T)

Frequency Data:: ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.249

Phenotype Score: 0.314

Variant Score: 0.972

Phenotype matches:

Phenotypic similarity 0.314 to mouse mutant involving GOLGA8T.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.249

Phenotype Score: 0.314

Variant Score: 0.972

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-32688688-G-C [0/1] rs1440004475

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.972 CONTRIBUTING VARIANT

Transcripts:: GOLGA8K:ENST00000512626.2:c.931C>G:p.(Leu311Val)

Pathogenicity Data:: Best Score: 0.976; Mutation Taster: 0.506; SIFT: 0.024 (D)

Frequency Data:: gnomAD_G_FIN: 0.0306%; gnomAD_G_NFE: 0.0081%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.005

Phenotype Score: 0.314

Variant Score: 0.521

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-32688688-G-C [0/1] rs1440004475

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.972 CONTRIBUTING VARIANT

Transcripts:: GOLGA8K:ENST00000512626.2:c.931C>G:p.(Leu311Val)

Pathogenicity Data:: Best Score: 0.976; Mutation Taster: 0.506; SIFT: 0.024 (D)

Frequency Data:: gnomAD_G_FIN: 0.0306%; gnomAD_G_NFE: 0.0081%

SYNONYMOUS_VARIANT SNV 15-32685337-G-A [0/1] rs1186711865

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.070 CONTRIBUTING VARIANT

Transcripts:: GOLGA8K:ENST00000512626.2:c.1623C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 1.1773%; gnomAD_G_AMR: 0.7788%; gnomAD_G_EAS: 0.5426%; gnomAD_G_FIN: 0.4038%; gnomAD_G_NFE: 0.5090%; gnomAD_G_OTH: 0.4087%

Exomiser Score: 0.223

Phenotype Score: 0.275

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.275 to mouse mutant involving C11orf54.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0011960, abnormal eye anterior chamber depth; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.223

Phenotype Score: 0.275

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT SNV 11-93494680-G-A [0/1] rs1196671772

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: C11orf54:ENST00000331239.4:c.775-1G>A:p.?; C11orf54:ENST00000354421.3:c.775-1G>A:p.?; C11orf54:ENST00000528099.1:c.775-1G>A:p.?; C11orf54:ENST00000528288.1:c.625-1G>A:p.?; C11orf54:ENST00000540113.1:c.718-1G>A:p.?

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0004%

Exomiser Score: 0.196

Phenotype Score: 0.500

Variant Score: 0.727

Phenotype matches:

Proximity score 0.500 in interactome to GRHL2 and phenotypic similarity 0.347 to Ectodermal dysplasia/short stature syndrome associated with GRHL2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0008404, Nail dystrophy; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0008404, Nail dystrophy; HP:0010055, Broad hallux - HP:0008404, Nail dystrophy

Proximity score 0.500 in interactome to GRHL2 and phenotypic similarity 0.756 to mouse mutant of GRHL2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.196

Phenotype Score: 0.500

Variant Score: 0.727

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 21-33691626-C-T [0/1] rs1287941853

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.727 CONTRIBUTING VARIANT

Transcripts:: URB1:ENST00000382751.3:c.5693G>A:p.(Arg1898His)

Pathogenicity Data:: Best Score: 0.728; Polyphen2: 0.000 (B); SIFT: 0.272 (T)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_AMR: 0.0042%; gnomAD_E_NFE: 0.0035%; gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.667 to 1p36 deletion syndrome associated with KCNAB2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Proximity score 0.505 in interactome to KCNH1 and phenotypic similarity 0.856 to Temple-Baraitser syndrome associated with KCNH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Known diseases - observed variants incompatible with mode of inheritance:: ORPHA:1606 1p36 deletion syndrome (CNV)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-6159993-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KCNAB2:ENST00000378087.3:c.437A>G:p.(Gln146Arg); KCNAB2:ENST00000378111.1:c.437A>G:p.(Gln146Arg); KCNAB2:ENST00000164247.1:c.*1359A>G:p.(=); KCNAB2:ENST00000341524.1:c.*1359A>G:p.(=); KCNAB2:ENST00000352527.1:c.*1359A>G:p.(=); KCNAB2:ENST00000378083.3:c.*1359A>G:p.(=); KCNAB2:ENST00000378097.1:c.*1359A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; SIFT: 0.000 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.185

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-6159993-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KCNAB2:ENST00000378087.3:c.437A>G:p.(Gln146Arg); KCNAB2:ENST00000378111.1:c.437A>G:p.(Gln146Arg); KCNAB2:ENST00000164247.1:c.*1359A>G:p.(=); KCNAB2:ENST00000341524.1:c.*1359A>G:p.(=); KCNAB2:ENST00000352527.1:c.*1359A>G:p.(=); KCNAB2:ENST00000378083.3:c.*1359A>G:p.(=); KCNAB2:ENST00000378097.1:c.*1359A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; SIFT: 0.000 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV 1-6159992-C-T [0/1] rs1377464015

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: KCNAB2:ENST00000378087.3:c.436C>T:p.(Gln146*); KCNAB2:ENST00000378111.1:c.436C>T:p.(Gln146*); KCNAB2:ENST00000164247.1:c.*1358C>T:p.(=); KCNAB2:ENST00000341524.1:c.*1358C>T:p.(=); KCNAB2:ENST00000352527.1:c.*1358C>T:p.(=); KCNAB2:ENST00000378083.3:c.*1358C>T:p.(=); KCNAB2:ENST00000378097.1:c.*1358C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: gnomAD_E_NFE: 0.0038%

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.275 to mouse mutant involving ITPR3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001314, corneal opacity; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.505 in interactome to INPP5K and phenotypic similarity 0.631 to Marinesco-Sjögren syndrome associated with INPP5K.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0010508, Metatarsus valgus; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:222100 Diabetes, type 1, susceptibility to (susceptibility)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-33635728-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ITPR3:ENST00000374316.5:c.1873A>G:p.(Asn625Asp); ITPR3:ENST00000605930.1:c.1873A>G:p.(Asn625Asp)

Pathogenicity Data:: Best Score: 0.999998; Polyphen2: 0.825 (P); Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.185

Phenotype Score: 0.252

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.473 to Microcephaly 16, primary, autosomal recessive associated with ANKLE2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001181, Adducted thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0001181, Adducted thumb

Phenotypic similarity 0.244 to mouse mutant involving ANKLE2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to LEMD2 and phenotypic similarity 0.629 to Marbach-Rustad progeroid syndrome associated with LEMD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0031846, Femur fracture; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0031846, Femur fracture; HP:0010055, Broad hallux - HP:0031846, Femur fracture

Proximity score 0.504 in interactome to LEMD2 and phenotypic similarity 0.257 to mouse mutant of LEMD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0006069, abnormal retinal neuronal layer morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:616681 Microcephaly 16, primary, autosomal recessive - autosomal recessive; ORPHA:2512 Autosomal recessive primary microcephaly - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.185

Phenotype Score: 0.252

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-133338300-G-A [0/1] rs1189947782

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ANKLE2:ENST00000337516.5:c.85C>T:p.(Arg29Trp); ANKLE2:ENST00000357997.5:c.85C>T:p.(Arg29Trp); ANKLE2:ENST00000539605.1:c.-6586C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.958 (D); Mutation Taster: 1.000 (P); SIFT: 0.021 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.183

Phenotype Score: 0.251

Variant Score: 1.000

Phenotype matches:

Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.656 to 2q37 microdeletion syndrome associated with HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.934 to mouse mutant of HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0001363, Craniosynostosis - MP:0030356, premature lambdoid suture closure; HP:0011304, Broad thumb - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0010055, Broad hallux - MP:0000165, abnormal long bone hypertrophic chondrocyte zone

Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.614 to fish mutant of HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0107238, anguloarticular premature ossification, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:209920 MHC class II deficiency, complementation group B - autosomal recessive; ORPHA:572 Immunodeficiency by defective expression of MHC class II - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.183

Phenotype Score: 0.251

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-19308935-T-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: RFXANK:ENST00000303088.4:c.458T>C:p.(Leu153Pro); RFXANK:ENST00000353145.1:c.389T>C:p.(Leu130Pro); RFXANK:ENST00000392324.4:c.389T>C:p.(Leu130Pro); RFXANK:ENST00000407360.3:c.458T>C:p.(Leu153Pro); RFXANK:ENST00000456252.3:c.392T>C:p.(Leu131Pro)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.995 (D); Mutation Taster: 1.000 (P); SIFT: 0.026 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.620 to Osteogenesis imperfecta, type VII associated with CRTAP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002979, Bowing of the legs; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0002812, Coxa vara; HP:0010055, Broad hallux - HP:0002979, Bowing of the legs

Phenotypic similarity 0.491 to mouse mutant involving CRTAP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate; HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization; HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate; HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate

Proximity score 0.500 in interactome to DDR2 and phenotypic similarity 0.612 to Spondylometaepiphyseal dysplasia, short limb-hand type associated with DDR2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0006009, Broad phalanx; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0009875, Triangular shaped distal phalanges of the hand; HP:0010055, Broad hallux - HP:0006009, Broad phalanx

Proximity score 0.500 in interactome to DDR2 and phenotypic similarity 0.515 to mouse mutant of DDR2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology; HP:0011304, Broad thumb - MP:0006395, abnormal epiphyseal plate morphology; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:610682 Osteogenesis imperfecta, type VII - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-33175692-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CRTAP:ENST00000320954.6:c.1087A>G:p.(Asn363Asp); CRTAP:ENST00000449224.1:c.958A>G:p.(Asn320Asp)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.991 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.479 to Primary ciliary dyskinesia associated with CCDC40.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.712 to Trichothiodystrophy associated with RNF113A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.262 to mouse mutant of RNF113A.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:613808 Ciliary dyskinesia, primary, 15 - autosomal recessive; ORPHA:244 Primary ciliary dyskinesia - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 17-78064000-AGGCACGTGCACGAAGAACACGGGACGCGCGCAGGCACGTGCACGAACAACACGGGACGCGCGCG-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: CCDC40:ENST00000374877.3:c.2910_2973del:p.(Lys970Asnfs*?); CCDC40:ENST00000397545.4:c.2832+318_2832+381del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.322 to mouse mutant involving PCDH15.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.703 to Neurofacioskeletal syndrome with or without renal agenesis associated with HS2ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0011927, Short digit; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger; HP:0010055, Broad hallux - HP:0010186, Broad distal phalanx of the toes

Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.698 to mouse mutant of HS2ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:601067 Usher syndrome, type 1D/F digenic - autosomal recessive; OMIM:602083 Usher syndrome, type 1F - autosomal recessive; OMIM:609533 Deafness, autosomal recessive 23 - autosomal recessive; ORPHA:231169 Usher syndrome type 1 - autosomal recessive; ORPHA:231169 Usher syndrome type 1 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-55912900-T-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: PCDH15:ENST00000320301.6:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000361849.3:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000373955.1:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000373957.3:c.1678A>G:p.(Thr560Ala); PCDH15:ENST00000373965.2:c.1765A>G:p.(Thr589Ala); PCDH15:ENST00000395430.1:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000395432.2:c.1633A>G:p.(Thr545Ala); PCDH15:ENST00000395433.1:c.1678A>G:p.(Thr560Ala); PCDH15:ENST00000395438.1:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000395445.1:c.1765A>G:p.(Thr589Ala); PCDH15:ENST00000395446.1:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000409834.1:c.577A>G:p.(Thr193Ala); PCDH15:ENST00000414778.1:c.1759A>G:p.(Thr587Ala); PCDH15:ENST00000437009.1:c.1744A>G:p.(Thr582Ala); PCDH15:ENST00000395440.1:c.1305+42543A>G:p.(=); PCDH15:ENST00000395442.1:c.1098+60796A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:

Proximity score 0.500 in interactome to GDF5 and phenotypic similarity 0.832 to Brachydactyly, type A2 associated with GDF5.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009536, Short 2nd finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009182, Triangular shaped middle phalanx of the 5th finger; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.500 in interactome to GDF5 and phenotypic similarity 0.911 to mouse mutant of GDF5.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:615112 Urofacial syndrome 2 - autosomal recessive; ORPHA:2704 Ochoa syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-113641340-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: LRIG2:ENST00000361127.5:c.1105A>C:p.(Asn369His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:

Phenotypic similarity 0.271 to mouse mutant involving MGME1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to SNRPN and phenotypic similarity 0.664 to Prader-Willi syndrome due to translocation associated with SNRPN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0005469, Flat occiput; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001845, Overlapping toe

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:615084 Mitochondrial DNA depletion syndrome 11 - autosomal recessive; ORPHA:352447 Progressive external ophthalmoplegia-myopathy-emaciation syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 20-17968847-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: MGME1:ENST00000377709.1:c.530A>C:p.(Lys177Thr); MGME1:ENST00000377710.5:c.770A>C:p.(Lys257Thr); MGME1:ENST00000377704.4:c.512-1735A>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

Exomiser Score: 0.176

Phenotype Score: 0.250

Variant Score: 0.996

Phenotype matches:

Phenotypic similarity 0.334 to mouse mutant involving TTLL5.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002864, abnormal ocular fundus morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to RXRA and phenotypic similarity 0.772 to mouse mutant of RXRA.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases:: OMIM:615860 Cone-rod dystrophy 19 - autosomal recessive; ORPHA:1872 Cone rod dystrophy - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.176

Phenotype Score: 0.250

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

START_LOST SNV 14-76219261-A-G [0/1] rs781316021

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: TTLL5:ENST00000554510.1:c.1A>G:p.0?; TTLL5:ENST00000298832.9:c.1513A>G:p.(Met505Val); TTLL5:ENST00000556893.1:c.127A>G:p.(Met43Val); TTLL5:ENST00000557636.1:c.1555A>G:p.(Met519Val)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.961 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0057%; ExAC AMR: 0.0173%; ExAC NFE: 0.0075%; ExAC SAS: 0.0121%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0060%; gnomAD_E_NFE: 0.0054%; gnomAD_E_SAS: 0.0065%; gnomAD_G_AFR: 0.0115%; gnomAD_G_FIN: 0.0286%; gnomAD_G_NFE: 0.0067%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.041

Phenotype Score: 0.500

Variant Score: 0.538

No phenotype matches to diseases with this MOI.

Variants contributing to score:

START_LOST SNV 14-76219261-A-G [0/1] rs781316021

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PVS1, PP3]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: TTLL5:ENST00000554510.1:c.1A>G:p.0?; TTLL5:ENST00000298832.9:c.1513A>G:p.(Met505Val); TTLL5:ENST00000556893.1:c.127A>G:p.(Met43Val); TTLL5:ENST00000557636.1:c.1555A>G:p.(Met519Val)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.961 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0057%; ExAC AMR: 0.0173%; ExAC NFE: 0.0075%; ExAC SAS: 0.0121%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0060%; gnomAD_E_NFE: 0.0054%; gnomAD_E_SAS: 0.0065%; gnomAD_G_AFR: 0.0115%; gnomAD_G_FIN: 0.0286%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 14-76230983-T-C [0/1] rs2288142

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.079 CONTRIBUTING VARIANT

Transcripts:: TTLL5:ENST00000298832.9:c.1576T>C:p.(=); TTLL5:ENST00000554510.1:c.103T>C:p.(=); TTLL5:ENST00000556893.1:c.229T>C:p.(=); TTLL5:ENST00000557636.1:c.1618T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.3594%; TOPMed: 0.0642%; ESP EA: 0.0349%; ESP All: 0.0231%; ExAC EAS: 0.9373%; ExAC FIN: 0.5897%; ExAC NFE: 0.0959%; ExAC OTH: 0.5507%; ExAC SAS: 0.1272%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.9047%; gnomAD_E_FIN: 0.4172%; gnomAD_E_NFE: 0.0422%; gnomAD_E_OTH: 0.3648%; gnomAD_E_SAS: 0.1300%; gnomAD_G_EAS: 0.7398%; gnomAD_G_FIN: 0.6297%; gnomAD_G_NFE: 0.0866%; gnomAD_G_OTH: 0.3055%

Exomiser Score: 0.158

Phenotype Score: 0.500

Variant Score: 0.699

Phenotype matches:

Proximity score 0.500 in interactome to DPH1 and phenotypic similarity 0.740 to Developmental delay with short stature, dysmorphic facial features, and sparse hair associated with DPH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001800, Hypoplastic toenails; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001800, Hypoplastic toenails; HP:0010055, Broad hallux - HP:0001800, Hypoplastic toenails

Proximity score 0.500 in interactome to DPH1 and phenotypic similarity 0.739 to mouse mutant of DPH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis - MP:0002116, abnormal craniofacial bone morphology; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.158

Phenotype Score: 0.500

Variant Score: 0.699

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-5145458-G-A [0/1] rs1298821277

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.699 CONTRIBUTING VARIANT

Transcripts:: EEF2KMT:ENST00000427587.4:c.154C>T:p.(His52Tyr); EEF2KMT:ENST00000458008.4:c.154C>T:p.(His52Tyr); EEF2KMT:ENST00000587133.1:c.154C>T:p.(His52Tyr)

Pathogenicity Data:: Best Score: 0.699; Polyphen2: 0.006 (B); SIFT: 0.301 (T)

Frequency Data:: TOPMed: 0.0011%

Exomiser Score: 0.149

Phenotype Score: 0.506

Variant Score: 0.685

Phenotype matches:

Proximity score 0.506 in interactome to STAMBP and phenotypic similarity 0.666 to Microcephaly-capillary malformation syndrome associated with STAMBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.506 in interactome to STAMBP and phenotypic similarity 0.268 to mouse mutant of STAMBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:219090 Pituitary adenoma 4, ACTH-secreting, somatic - autosomal dominant/recessive; ORPHA:96253 Cushing disease (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.149

Phenotype Score: 0.506

Variant Score: 0.685

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-50774228-A-T [0/1] rs1274994081

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.685 CONTRIBUTING VARIANT

Transcripts:: USP8:ENST00000307179.4:c.1769A>T:p.(His590Leu); USP8:ENST00000396444.3:c.1769A>T:p.(His590Leu); USP8:ENST00000425032.3:c.1538A>T:p.(His513Leu); USP8:ENST00000433963.1:c.1769A>T:p.(His590Leu)

Pathogenicity Data:: Best Score: 0.685; Polyphen2: 0.006 (B); SIFT: 0.315 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.144

Phenotype Score: 0.503

Variant Score: 0.683

Phenotype matches:

Proximity score 0.503 in interactome to GKN2 and phenotypic similarity 0.935 to mouse mutant of GKN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.144

Phenotype Score: 0.503

Variant Score: 0.683

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-1016733-G-T [0/1] rs548701018

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.726 CONTRIBUTING VARIANT

Transcripts:: MUC6:ENST00000421673.2:c.6068C>A:p.(Thr2023Lys)

Pathogenicity Data:: Best Score: 0.948; Polyphen2: 0.005 (B); SIFT: 0.052 (D)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; gnomAD_G_AFR: 0.2420%; gnomAD_G_EAS: 0.1190%; gnomAD_G_FIN: 1.0045%; gnomAD_G_NFE: 0.3645%; gnomAD_G_OTH: 0.5000%

SPLICE_REGION_VARIANT SNV 11-1028885-G-A [0/1] rs202152925

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.640 CONTRIBUTING VARIANT

Transcripts:: MUC6:ENST00000421673.2:c.1453+4C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1198%; TOPMed: 0.0574%; ExAC AFR: 0.0103%; ExAC AMR: 0.0087%; ExAC EAS: 0.9061%; ExAC NFE: 0.0030%; ExAC SAS: 0.0303%; gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0089%; gnomAD_E_EAS: 0.8935%; gnomAD_E_NFE: 0.0036%; gnomAD_E_SAS: 0.0292%; gnomAD_G_EAS: 0.6790%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.025

Phenotype Score: 0.503

Variant Score: 0.479

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-1017186-A-G [0/1] rs74579726

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.479 CONTRIBUTING VARIANT

Transcripts:: MUC6:ENST00000421673.2:c.5615T>C:p.(Met1872Thr)

Pathogenicity Data:: Best Score: 0.481; Polyphen2: 0.094 (B); SIFT: 0.519 (T)

Frequency Data:: gnomAD_E_FIN: 0.0149%; gnomAD_E_NFE: 0.0026%; gnomAD_E_OTH: 0.0286%

Other passed variants:

SYNONYMOUS_VARIANT SNV 11-1016714-G-A [0/1] rs373360588

Variant score: 0.100

Transcripts:: MUC6:ENST00000421673.2:c.6087C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 11-1017470-G-T [0/1] rs75533660

Variant score: 0.100

Transcripts:: MUC6:ENST00000421673.2:c.5331C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 11-1017200-G-C [0/1] rs763772915

Variant score: 0.100

Transcripts:: MUC6:ENST00000421673.2:c.5601C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_NFE: 0.0020%

SYNONYMOUS_VARIANT SNV 11-1017161-C-T [0/1] rs374837441

Variant score: 0.100

Transcripts:: MUC6:ENST00000421673.2:c.5640G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0206%; gnomAD_E_AMR: 0.0041%; gnomAD_E_EAS: 0.0102%; gnomAD_E_FIN: 0.0066%; gnomAD_E_NFE: 0.0106%; gnomAD_E_OTH: 0.0258%; gnomAD_E_SAS: 0.0080%

SYNONYMOUS_VARIANT SNV 11-1017833-C-T [0/1] rs373775476

Variant score: 0.084

Transcripts:: MUC6:ENST00000421673.2:c.4968G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.7955%; gnomAD_E_AMR: 0.0549%; gnomAD_E_EAS: 0.1312%; gnomAD_E_FIN: 0.1639%; gnomAD_E_NFE: 0.0564%; gnomAD_E_OTH: 0.0898%; gnomAD_E_SAS: 0.0475%

SYNONYMOUS_VARIANT SNV 11-1016732-T-C [0/1] rs527248643

Variant score: 0.080

Transcripts:: MUC6:ENST00000421673.2:c.6069A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; gnomAD_G_AFR: 0.2656%; gnomAD_G_EAS: 0.1220%; gnomAD_G_FIN: 0.9091%; gnomAD_G_NFE: 0.3708%; gnomAD_G_OTH: 0.5025%

Exomiser Score: 0.143

Phenotype Score: 0.501

Variant Score: 0.686

Phenotype matches:

Phenotypic similarity 0.331 to mouse mutant involving FOXK2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to SIN3A and phenotypic similarity 0.696 to 15q24 microdeletion syndrome associated with SIN3A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009623, Proximal placement of thumb; HP:0010055, Broad hallux - HP:0001780, Abnormality of toe

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.143

Phenotype Score: 0.501

Variant Score: 0.686

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-80545133-G-A [0/1] rs201027007

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.686 CONTRIBUTING VARIANT

Transcripts:: FOXK2:ENST00000335255.5:c.1771G>A:p.(Gly591Ser)

Pathogenicity Data:: Best Score: 0.69; Polyphen2: 0.011 (B); SIFT: 0.310 (T)

Frequency Data:: TOPMed: 0.0144%; ExAC AFR: 0.0098%; ExAC AMR: 0.0087%; ExAC EAS: 0.0463%; ExAC NFE: 0.0228%; ExAC SAS: 0.0303%; gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0238%; gnomAD_E_EAS: 0.0464%; gnomAD_E_NFE: 0.0252%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0260%; gnomAD_G_AFR: 0.0343%

Exomiser Score: 0.139

Phenotype Score: 0.396

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.396 to mouse mutant involving SVEP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002109, abnormal limb morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002109, abnormal limb morphology; HP:0010055, Broad hallux - MP:0002109, abnormal limb morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.139

Phenotype Score: 0.396

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 9-113137745-TAAA-T [0/1] rs71373993

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: SVEP1:ENST00000297826.5:c.4283-5_4283-3del:p.?; SVEP1:ENST00000374469.1:c.10436-5_10436-3del:p.?; SVEP1:ENST00000401783.2:c.10505-5_10505-3del:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.137

Phenotype Score: 0.507

Variant Score: 0.673

Phenotype matches:

Proximity score 0.507 in interactome to B4GALT7 and phenotypic similarity 0.696 to Ehlers-Danlos syndrome, spondylodysplastic type, 1 associated with B4GALT7.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0011308, Slender toe; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0006243, Phalangeal dislocation; HP:0010055, Broad hallux - HP:0011308, Slender toe

Proximity score 0.507 in interactome to B4GALT7 and phenotypic similarity 0.328 to fish mutant of B4GALT7.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0001049, head circular, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.137

Phenotype Score: 0.507

Variant Score: 0.673

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-42538423-A-G [0/1] rs1309618680

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.872 CONTRIBUTING VARIANT

Transcripts:: GXYLT1:ENST00000280876.6:c.26T>C:p.(Val9Ala); GXYLT1:ENST00000398675.3:c.26T>C:p.(Val9Ala)

Pathogenicity Data:: Best Score: 0.918; Polyphen2: 0.007 (B); SIFT: 0.082 (T)

Frequency Data:: gnomAD_G_AFR: 0.0435%; gnomAD_G_FIN: 0.3147%; gnomAD_G_NFE: 0.0077%

MISSENSE_VARIANT SNV 12-42538415-C-G [0/1] rs1367553026

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.475 CONTRIBUTING VARIANT

Transcripts:: GXYLT1:ENST00000280876.6:c.34G>C:p.(Val12Leu); GXYLT1:ENST00000398675.3:c.34G>C:p.(Val12Leu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.1590%; gnomAD_G_AMR: 0.9328%; gnomAD_G_EAS: 0.0914%; gnomAD_G_FIN: 0.6334%; gnomAD_G_NFE: 0.0320%; gnomAD_G_OTH: 0.1359%

Other passed variants:

MISSENSE_VARIANT SNV 12-42538412-C-T [0/1] rs1273118984

Variant score: 0.351

Transcripts:: GXYLT1:ENST00000280876.6:c.37G>A:p.(Ala13Thr); GXYLT1:ENST00000398675.3:c.37G>A:p.(Ala13Thr)

Pathogenicity Data:: Best Score: 0.908; Polyphen2: 0.051 (B); SIFT: 0.092 (T)

Frequency Data:: gnomAD_G_AFR: 0.2225%; gnomAD_G_AMR: 1.7110%; gnomAD_G_EAS: 0.5144%; gnomAD_G_FIN: 0.8319%; gnomAD_G_NFE: 0.0496%; gnomAD_G_OTH: 0.1475%

SYNONYMOUS_VARIANT SNV 12-42538428-G-C [0/1] rs779360753

Variant score: 0.097

Transcripts:: GXYLT1:ENST00000280876.6:c.21C>G:p.(=); GXYLT1:ENST00000398675.3:c.21C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC NFE: 0.0124%; gnomAD_E_NFE: 0.0061%; gnomAD_G_AFR: 0.0441%; gnomAD_G_FIN: 0.1923%

Exomiser Score: 0.131

Phenotype Score: 0.551

Variant Score: 0.617

Phenotype matches:

Phenotypic similarity 0.551 to Alström syndrome associated with ALMS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001831, Short toe; HP:0001363, Craniosynostosis - HP:0004438, Hyperostosis frontalis interna; HP:0011304, Broad thumb - HP:0009381, Short finger; HP:0010055, Broad hallux - HP:0001831, Short toe

Phenotypic similarity 0.298 to mouse mutant involving ALMS1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001326, retinal degeneration; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.503 in interactome to SDCCAG8 and phenotypic similarity 0.504 to Bardet-Biedl syndrome associated with SDCCAG8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0006101, Finger syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly; HP:0010055, Broad hallux - HP:0006101, Finger syndactyly

Proximity score 0.503 in interactome to SDCCAG8 and phenotypic similarity 0.737 to mouse mutant of SDCCAG8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Known diseases:: OMIM:203800 Alstrom syndrome - autosomal recessive; ORPHA:64 Alström syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.131

Phenotype Score: 0.551

Variant Score: 0.617

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.551 to ORPHA:64 Alström syndrome
Phenotypic similarity 0.383 to OMIM:203800 Alstrom syndrome

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 2-73613031-T-TGGAGGAGGAGGA [-/1] rs55889738

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: ALMS1:ENST00000264448.6:c.63_74dup:p.(Glu25_Glu28dup); ALMS1:ENST00000377715.1:c.63_74dup:p.(Glu25_Glu28dup); ALMS1:ENST00000409009.1:c.63_74dup:p.(Glu25_Glu28dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 2-73677983-G-T [0/1] rs192499639

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.384 CONTRIBUTING VARIANT

Transcripts:: ALMS1:ENST00000264448.6:c.4326G>T:p.(Leu1442Phe); ALMS1:ENST00000377715.1:c.4326G>T:p.(Leu1442Phe); ALMS1:ENST00000409009.1:c.4200G>T:p.(Leu1400Phe)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1997%; TOPMed: 0.0495%; ExAC AFR: 0.0102%; ExAC AMR: 0.0087%; ExAC EAS: 0.7655%; ExAC OTH: 0.2222%; ExAC SAS: 0.0242%; gnomAD_E_AFR: 0.0131%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.7713%; gnomAD_E_OTH: 0.0549%; gnomAD_E_SAS: 0.0260%; gnomAD_G_AFR: 0.0458%; gnomAD_G_EAS: 1.2979%; gnomAD_G_OTH: 0.1018%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.054

Phenotype Score: 0.252

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 2-73613031-T-TGGAGGAGGAGGA [-/1] rs55889738

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: ALMS1:ENST00000264448.6:c.63_74dup:p.(Glu25_Glu28dup); ALMS1:ENST00000377715.1:c.63_74dup:p.(Glu25_Glu28dup); ALMS1:ENST00000409009.1:c.63_74dup:p.(Glu25_Glu28dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SYNONYMOUS_VARIANT SNV 2-73717084-A-G [0/1]

Variant score: 0.100

Transcripts:: ALMS1:ENST00000264448.6:c.7995A>G:p.(=); ALMS1:ENST00000409009.1:c.7869A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.127

Phenotype Score: 0.250

Variant Score: 0.954

Phenotype matches:

Proximity score 0.500 in interactome to USP12 and phenotypic similarity 0.737 to mouse mutant of USP12.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000565, oligodactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000565, oligodactyly; HP:0010055, Broad hallux - MP:0000565, oligodactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:300066 Deafness, X-linked 4 - X-linked dominant

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.127

Phenotype Score: 0.250

Variant Score: 0.954

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-21761945-T-C [0/1] rs759552778

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3, BP6]

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.954 CONTRIBUTING VARIANT

Transcripts:: SMPX:ENST00000379494.3:c.55A>G:p.(Asn19Asp)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.986 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0064%; ExAC EAS: 0.1816%; ExAC OTH: 0.1587%; gnomAD_E_EAS: 0.2410%; gnomAD_G_EAS: 0.2904%

Exomiser Score: 0.116

Phenotype Score: 0.350

Variant Score: 0.829

Phenotype matches:

Phenotypic similarity 0.667 to 1p36 deletion syndrome associated with HSPG2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Phenotypic similarity 0.701 to mouse mutant involving HSPG2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate; HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures; HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate; HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate

Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.332 to Hypogonadotropic hypogonadism 15 with or without anosmia associated with HS6ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002857, Genu valgum; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0002857, Genu valgum; HP:0010055, Broad hallux - HP:0002857, Genu valgum

Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.783 to mouse mutant of HS6ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005104, abnormal tarsal bone morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:224410 Dyssegmental dysplasia, Silverman-Handmaker type - autosomal recessive; OMIM:255800 Schwartz-Jampel syndrome, type 1 - autosomal recessive; ORPHA:1606 1p36 deletion syndrome (CNV); ORPHA:1865 Dyssegmental dysplasia, Silverman-Handmaker type - autosomal recessive; ORPHA:800 Schwartz-Jampel syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.116

Phenotype Score: 0.350

Variant Score: 0.829

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-22179539-C-T [0/1] rs575744546

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.829 CONTRIBUTING VARIANT

Transcripts:: HSPG2:ENST00000374695.3:c.6464G>A:p.(Arg2155His); HSPG2:ENST00000430507.1:c.302G>A:p.(Arg101His)

Pathogenicity Data:: Best Score: 0.838; Polyphen2: 0.018 (B); SIFT: 0.162 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0104%; ExAC EAS: 0.0466%; gnomAD_E_EAS: 0.0755%; gnomAD_E_NFE: 0.0009%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.109

Phenotype Score: 0.326

Variant Score: 0.850

Phenotype matches:

Phenotypic similarity 0.326 to mouse mutant involving FADS6.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.109

Phenotype Score: 0.326

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 17-72889676-G-GGGCTCCGTAGGTTCCATGGGCTCCGTAGGTTCCATGGGCTCCGTAGGTTCCATC [1/1] rs1598567899

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: FADS6:ENST00000310226.6:c.17_18insGATGGAACCTACGGAGCCCATGGAACCTACGGAGCCCATGGAACCTACGGAGCC:p.(Pro15_Ala16insThrGluProMetGluProThrGluProMetGluProThrGluProMetGluPro)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.109

Phenotype Score: 0.500

Variant Score: 0.651

Phenotype matches:

Proximity score 0.500 in interactome to DOCK3 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with DOCK3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.109

Phenotype Score: 0.500

Variant Score: 0.651

No phenotype matches to diseases with this MOI.

Variants contributing to score:

STOP_GAINED SNV 4-103826685-T-A [0/1] rs77618489

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.860 CONTRIBUTING VARIANT

Transcripts:: SLC9B1:ENST00000296422.7:c.1318A>T:p.(Lys440*); SLC9B1:ENST00000394789.3:c.1318A>T:p.(Lys440*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: gnomAD_E_AFR: 0.0136%; gnomAD_E_AMR: 0.0061%; gnomAD_E_EAS: 0.0060%; gnomAD_E_NFE: 0.0027%; gnomAD_E_SAS: 0.0033%; gnomAD_G_AFR: 0.3301%; gnomAD_G_AMR: 0.7102%; gnomAD_G_EAS: 0.5691%; gnomAD_G_FIN: 0.4237%; gnomAD_G_NFE: 0.2110%; gnomAD_G_OTH: 0.2451%

SPLICE_REGION_VARIANT SNV 4-103826813-A-G [0/1] rs879245359

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.443 CONTRIBUTING VARIANT

Transcripts:: SLC9B1:ENST00000296422.7:c.1196-6T>C:p.?; SLC9B1:ENST00000394789.3:c.1196-6T>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0275%; gnomAD_E_AMR: 0.0138%; gnomAD_E_EAS: 0.0061%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0194%; gnomAD_E_SAS: 0.0110%; gnomAD_G_AFR: 0.6667%; gnomAD_G_AMR: 1.3678%; gnomAD_G_EAS: 0.8772%; gnomAD_G_FIN: 1.4587%; gnomAD_G_NFE: 0.4727%; gnomAD_G_OTH: 0.5249%

Exomiser Score: 0.092

Phenotype Score: 0.506

Variant Score: 0.625

Phenotype matches:

Phenotypic similarity 0.503 to Trismus-pseudocamptodactyly syndrome associated with MYH8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010621, Cutaneous syndactyly of toes; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001840, Metatarsus adductus; HP:0010055, Broad hallux - HP:0001765, Hammertoe

Proximity score 0.506 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases:: OMIM:158300 Trismus-pseudocamptodactyly syndrome - autosomal dominant; OMIM:608837 Carney complex variant - autosomal dominant; ORPHA:3377 Trismus-pseudocamptodactyly syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.092

Phenotype Score: 0.506

Variant Score: 0.625

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.503 to OMIM:158300 Trismus-pseudocamptodactyly syndrome
Phenotypic similarity 0.452 to ORPHA:3377 Trismus-pseudocamptodactyly syndrome

Variants contributing to score:

MISSENSE_VARIANT SNV 17-10305050-T-G [0/1] rs780682650

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.625 CONTRIBUTING VARIANT

Transcripts:: MYH8:ENST00000403437.2:c.2741A>C:p.(Asn914Thr)

Pathogenicity Data:: Best Score: 0.626; Polyphen2: 0.000 (B); SIFT: 0.374 (T)

Frequency Data:: TOPMed: 0.0011%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.090

Phenotype Score: 0.611

Variant Score: 0.503

Phenotype matches:

Phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Phenotypic similarity 0.611 to mouse mutant involving TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification; HP:0011304, Broad thumb - MP:0004351, short humerus; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

Proximity score 0.503 in interactome to MYH3 and phenotypic similarity 0.728 to Contractures, pterygia, and spondylocarpostarsal fusion syndrome 1A associated with MYH3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0008368, Tarsal synostosis; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0009702, Carpal synostosis; HP:0010055, Broad hallux - HP:0008368, Tarsal synostosis

Known diseases:: OMIM:601680 Arthrogryposis, distal, type 2B1 - autosomal dominant; ORPHA:1146 Distal arthrogryposis type 1 - autosomal dominant; ORPHA:1147 Sheldon-Hall syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.090

Phenotype Score: 0.611

Variant Score: 0.503

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.494 to ORPHA:1146 Distal arthrogryposis type 1
Phenotypic similarity 0.478 to ORPHA:1147 Sheldon-Hall syndrome
Phenotypic similarity 0.417 to OMIM:601680 Arthrogryposis, distal, type 2B1

Variants contributing to score:

MISSENSE_VARIANT SNV 11-1861812-G-A [0/1] rs761650095

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.503 CONTRIBUTING VARIANT

Transcripts:: TNNI2:ENST00000252898.7:c.112G>A:p.(Glu38Lys); TNNI2:ENST00000381905.3:c.112G>A:p.(Glu38Lys); TNNI2:ENST00000381906.1:c.112G>A:p.(Glu38Lys); TNNI2:ENST00000381911.1:c.112G>A:p.(Glu38Lys)

Pathogenicity Data:: Best Score: 0.504; Polyphen2: 0.073 (B); SIFT: 0.496 (T)

Frequency Data:: TOPMed: 0.0015%; ExAC EAS: 0.0118%; ExAC NFE: 0.0016%; gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.086

Phenotype Score: 0.502

Variant Score: 0.621

Phenotype matches:

Proximity score 0.502 in interactome to NUP188 and phenotypic similarity 0.609 to Sandestig-Stefanova syndrome associated with NUP188.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0030084, Clinodactyly; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0030084, Clinodactyly; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.086

Phenotype Score: 0.502

Variant Score: 0.621

No phenotype matches to diseases with this MOI.

Variants contributing to score:

INFRAME_DELETION DEL 1-29475218-CCTT-C [0/1] rs772412205

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM4]

Variant score: 0.721 CONTRIBUTING VARIANT

Transcripts:: SRSF4:ENST00000373795.4:c.1186_1188del:p.(Lys396del); SRSF4:ENST00000546138.1:c.*404_*406del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0144%; ESP AA: 0.7501%; ESP EA: 0.5937%; ESP All: 0.6470%; ExAC AFR: 0.2414%; ExAC AMR: 0.3114%; ExAC EAS: 0.4309%; ExAC FIN: 0.1362%; ExAC NFE: 0.3920%; ExAC OTH: 0.5531%; ExAC SAS: 0.6689%; gnomAD_E_AFR: 0.0333%; gnomAD_E_AMR: 0.0061%; gnomAD_E_EAS: 0.0239%; gnomAD_E_FIN: 0.0282%; gnomAD_E_NFE: 0.0184%; gnomAD_E_SAS: 0.0134%; gnomAD_G_AFR: 0.0345%; gnomAD_G_NFE: 0.0134%

SPLICE_REGION_VARIANT DEL 1-29481428-GA-G [0/1] rs758506993

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.520 CONTRIBUTING VARIANT

Transcripts:: SRSF4:ENST00000373795.4:c.364-7del:p.?; SRSF4:ENST00000546138.1:c.363+4457del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1198%; TOPMed: 0.1198%; ESP AA: 1.0080%; ESP EA: 1.0177%; ESP All: 1.0144%; ExAC AFR: 0.4176%; ExAC AMR: 0.1745%; ExAC EAS: 1.1193%; ExAC FIN: 0.0157%; ExAC NFE: 0.8665%; ExAC OTH: 0.8621%; ExAC SAS: 0.3222%; gnomAD_E_AFR: 0.0460%; gnomAD_E_AMR: 0.1459%; gnomAD_E_EAS: 1.2767%; gnomAD_E_FIN: 0.0461%; gnomAD_E_NFE: 0.0631%; gnomAD_E_OTH: 0.1893%; gnomAD_E_SAS: 0.1594%; gnomAD_G_EAS: 0.5703%; gnomAD_G_FIN: 0.0515%; gnomAD_G_NFE: 0.0392%; gnomAD_G_OTH: 0.1370%

Exomiser Score: 0.074

Phenotype Score: 0.505

Variant Score: 0.601

Phenotype matches:

Phenotypic similarity 0.375 to mouse mutant involving CD36.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003664, ocular pterygium; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.505 in interactome to THBS3 and phenotypic similarity 0.694 to mouse mutant of THBS3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000559, abnormal femur morphology; HP:0001363, Craniosynostosis - MP:0003416, premature bone ossification; HP:0011304, Broad thumb - MP:0000559, abnormal femur morphology; HP:0010055, Broad hallux - MP:0000559, abnormal femur morphology

Known diseases:: OMIM:608404 Platelet glycoprotein IV deficiency - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.074

Phenotype Score: 0.505

Variant Score: 0.601

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-80302123-A-T [0/1] rs201355711

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: CD36:ENST00000309881.7:c.1163A>T:p.(Gln388Leu); CD36:ENST00000394788.3:c.1163A>T:p.(Gln388Leu); CD36:ENST00000432207.1:c.1163A>T:p.(Gln388Leu); CD36:ENST00000433696.2:c.1046A>T:p.(Gln349Leu); CD36:ENST00000435819.1:c.1163A>T:p.(Gln388Leu); CD36:ENST00000447544.2:c.1163A>T:p.(Gln388Leu); CD36:ENST00000534394.1:c.935A>T:p.(Gln312Leu); CD36:ENST00000538969.1:c.983A>T:p.(Gln328Leu); CD36:ENST00000544133.1:c.*108A>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0144%; ExAC EAS: 0.6437%; gnomAD_E_EAS: 0.5500%; gnomAD_E_OTH: 0.0184%; gnomAD_G_EAS: 0.7453%

INFRAME_DELETION DEL 7-80302697-ATATTGTGCCTAT-A [0/1] rs764063131

Exomiser ACMG: LIKELY_PATHOGENIC [PM4, PP5_Strong]

ClinVar: PATHOGENIC_OR_LIKELY_PATHOGENIC (criteria provided, multiple submitters, no conflicts)

Variant score: 0.351 CONTRIBUTING VARIANT

Transcripts:: CD36:ENST00000309881.7:c.1228_1239del:p.(Ile410_Ile413del); CD36:ENST00000394788.3:c.1228_1239del:p.(Ile410_Ile413del); CD36:ENST00000432207.1:c.1228_1239del:p.(Ile410_Ile413del); CD36:ENST00000433696.2:c.1111_1122del:p.(Ile371_Ile374del); CD36:ENST00000435819.1:c.1228_1239del:p.(Ile410_Ile413del); CD36:ENST00000447544.2:c.1228_1239del:p.(Ile410_Ile413del); CD36:ENST00000534394.1:c.1000_1011del:p.(Ile334_Ile337del); CD36:ENST00000538969.1:c.1048_1059del:p.(Ile350_Ile353del); CD36:ENST00000544133.1:c.*173_*184del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1597%; TOPMed: 0.0457%; gnomAD_E_EAS: 1.0669%; gnomAD_E_OTH: 0.0183%; gnomAD_G_EAS: 1.6749%

Exomiser Score: 0.065

Phenotype Score: 0.500

Variant Score: 0.591

Phenotype matches:

Proximity score 0.500 in interactome to ZMPSTE24 and phenotypic similarity 0.646 to Mandibuloacral dysplasia with type B lipodystrophy associated with ZMPSTE24.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009803, Short phalanx of finger; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger; HP:0010055, Broad hallux - HP:0001870, Acroosteolysis of distal phalanges (feet)

Proximity score 0.500 in interactome to ZMPSTE24 and phenotypic similarity 0.679 to mouse mutant of ZMPSTE24.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000558, abnormal tibia morphology; HP:0001363, Craniosynostosis - MP:0002835, abnormal cranial suture morphology; HP:0011304, Broad thumb - MP:0000558, abnormal tibia morphology; HP:0010055, Broad hallux - MP:0000558, abnormal tibia morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.065

Phenotype Score: 0.500

Variant Score: 0.591

No phenotype matches to diseases with this MOI.

Variants contributing to score:

STOP_GAINED SNV 7-151716809-C-T [0/1] rs148537699

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.982 CONTRIBUTING VARIANT

Transcripts:: GALNTL5:ENST00000392800.2:c.1255C>T:p.(Arg419*); GALNTL5:ENST00000431418.2:c.1255C>T:p.(Arg419*)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0076%; ESP AA: 0.0227%; ESP EA: 0.0116%; ESP All: 0.0154%; ExAC AFR: 0.0096%; ExAC EAS: 0.0693%; ExAC NFE: 0.0120%; gnomAD_E_AFR: 0.0065%; gnomAD_E_EAS: 0.0812%; gnomAD_E_NFE: 0.0098%; gnomAD_E_SAS: 0.0032%; gnomAD_G_EAS: 0.1235%

MISSENSE_VARIANT SNV 7-151668119-G-A [0/1] rs181262306

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.199 CONTRIBUTING VARIANT

Transcripts:: GALNTL5:ENST00000392800.2:c.337G>A:p.(Glu113Lys); GALNTL5:ENST00000431418.2:c.337G>A:p.(Glu113Lys)

Pathogenicity Data:: Best Score: 0.959; Polyphen2: 0.003 (B); SIFT: 0.041 (D)

Frequency Data:: 1000Genomes: 0.1398%; TOPMed: 0.1730%; ExAC AFR: 0.0194%; ExAC AMR: 1.9247%; ExAC EAS: 1.1477%; ExAC NFE: 0.0075%; ExAC SAS: 0.0122%; gnomAD_E_AFR: 0.0131%; gnomAD_E_AMR: 1.7037%; gnomAD_E_EAS: 1.1608%; gnomAD_E_NFE: 0.0045%; gnomAD_E_OTH: 0.1278%; gnomAD_E_SAS: 0.0098%; gnomAD_G_AFR: 0.0115%; gnomAD_G_AMR: 1.5513%; gnomAD_G_EAS: 1.1728%; gnomAD_G_OTH: 0.2041%

Exomiser Score: 0.058

Phenotype Score: 0.500

Variant Score: 0.577

Phenotype matches:

Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.058

Phenotype Score: 0.500

Variant Score: 0.577

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-3195053-T-C [0/1] rs201389844

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.577 CONTRIBUTING VARIANT

Transcripts:: OR3A1:ENST00000323404.1:c.824A>G:p.(Lys275Arg)

Pathogenicity Data:: Best Score: 0.579; Polyphen2: 0.344 (B); SIFT: 0.421 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0011%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.057

Phenotype Score: 0.504

Variant Score: 0.570

Phenotype matches:

Proximity score 0.504 in interactome to POGZ and phenotypic similarity 0.707 to White-Sutton syndrome associated with POGZ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.057

Phenotype Score: 0.504

Variant Score: 0.570

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-129339273-T-C [0/1] rs191895201

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.570 CONTRIBUTING VARIANT

Transcripts:: ZNF280C:ENST00000370978.4:c.2159A>G:p.(Asn720Ser)

Pathogenicity Data:: Best Score: 0.866; Polyphen2: 0.022 (B); SIFT: 0.134 (T)

Frequency Data:: 1000Genomes: 0.1325%; TOPMed: 0.0665%; ExAC EAS: 1.0749%; ExAC NFE: 0.0042%; ExAC SAS: 0.0103%; gnomAD_E_EAS: 1.1985%; gnomAD_E_NFE: 0.0026%; gnomAD_E_SAS: 0.0119%; gnomAD_G_EAS: 1.2597%

Exomiser Score: 0.054

Phenotype Score: 0.503

Variant Score: 0.566

Phenotype matches:

Phenotypic similarity 0.262 to mouse mutant involving ALDH1L2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001325, abnormal retina morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.503 in interactome to SHMT2 and phenotypic similarity 0.669 to Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities associated with SHMT2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009943, Complete duplication of thumb phalanx; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Proximity score 0.503 in interactome to SHMT2 and phenotypic similarity 0.262 to mouse mutant of SHMT2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0008259, abnormal optic disk morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.054

Phenotype Score: 0.503

Variant Score: 0.566

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-105455412-G-C [0/1] rs761986038

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.566 CONTRIBUTING VARIANT

Transcripts:: ALDH1L2:ENST00000258494.9:c.1040C>G:p.(Thr347Ser); ALDH1L2:ENST00000424857.2:c.1040C>G:p.(Thr347Ser)

Pathogenicity Data:: Best Score: 0.571; Polyphen2: 0.016 (B); SIFT: 0.429 (T)

Frequency Data:: ExAC EAS: 0.0347%; gnomAD_E_EAS: 0.0464%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.049

Phenotype Score: 0.551

Variant Score: 0.502

Phenotype matches:

Phenotypic similarity 0.551 to Congenital muscular dystrophy, Ullrich type associated with COL6A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001238, Slender finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010511, Long toe

Known diseases:: OMIM:158810 Bethlem myopathy 1 - autosomal dominant/recessive; OMIM:254090 Ullrich congenital muscular dystrophy 1 - autosomal dominant/recessive; OMIM:255600 ?Myosclerosis, congenital (unconfirmed); ORPHA:610 Bethlem myopathy - autosomal dominant/recessive; ORPHA:75840 Congenital muscular dystrophy, Ullrich type - autosomal dominant/recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.049

Phenotype Score: 0.551

Variant Score: 0.502

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.551 to ORPHA:75840 Congenital muscular dystrophy, Ullrich type
Phenotypic similarity 0.475 to ORPHA:610 Bethlem myopathy
Phenotypic similarity 0.396 to OMIM:158810 Bethlem myopathy 1
Phenotypic similarity 0.324 to OMIM:254090 Ullrich congenital muscular dystrophy 1

Variants contributing to score:

MISSENSE_VARIANT SNV 21-47531486-G-C [0/1] rs1450538075

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.502 CONTRIBUTING VARIANT

Transcripts:: COL6A2:ENST00000300527.4:c.96G>C:p.(Glu32Asp); COL6A2:ENST00000310645.5:c.96G>C:p.(Glu32Asp); COL6A2:ENST00000357838.4:c.96G>C:p.(Glu32Asp); COL6A2:ENST00000397763.1:c.96G>C:p.(Glu32Asp); COL6A2:ENST00000409416.1:c.96G>C:p.(Glu32Asp)

Pathogenicity Data:: Best Score: 0.502; Polyphen2: 0.001 (B); SIFT: 0.498 (T)

Frequency Data:: gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.045

Phenotype Score: 0.133

Variant Score: 0.965

Phenotype matches:

Phenotypic similarity 0.265 to mouse mutant involving NLRP7.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005543, decreased cornea thickness; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:231090 Hydatidiform mole, recurrent, 1 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.045

Phenotype Score: 0.133

Variant Score: 0.965

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55450929-C-T [0/1] rs771101644

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.965 CONTRIBUTING VARIANT

Transcripts:: NLRP7:ENST00000328092.5:c.1258G>A:p.(Ala420Thr); NLRP7:ENST00000340844.2:c.1258G>A:p.(Ala420Thr); NLRP7:ENST00000446217.1:c.1342G>A:p.(Ala448Thr); NLRP7:ENST00000448121.2:c.1258G>A:p.(Ala420Thr); NLRP7:ENST00000588756.1:c.1258G>A:p.(Ala420Thr); NLRP7:ENST00000590030.1:c.1258G>A:p.(Ala420Thr); NLRP7:ENST00000592784.1:c.1258G>A:p.(Ala420Thr)

Pathogenicity Data:: Best Score: 0.973; Polyphen2: 0.901 (P); SIFT: 0.027 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC EAS: 0.0362%; gnomAD_E_EAS: 0.0409%; gnomAD_G_EAS: 0.0620%

Exomiser Score: 0.044

Phenotype Score: 0.320

Variant Score: 0.748

Phenotype matches:

Phenotypic similarity 0.320 to mouse mutant involving FSD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.044

Phenotype Score: 0.320

Variant Score: 0.748

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-83447635-C-T [0/1] rs200246355

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.748 CONTRIBUTING VARIANT

Transcripts:: FSD2:ENST00000334574.8:c.994G>A:p.(Gly332Arg); FSD2:ENST00000541889.1:c.994G>A:p.(Gly332Arg)

Pathogenicity Data:: Best Score: 0.753977; Polyphen2: 0.005 (B); Mutation Taster: 0.754; SIFT: 0.513 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0072%; ESP AA: 0.0544%; ESP All: 0.0168%; ExAC AFR: 0.0102%; ExAC AMR: 0.0086%; ExAC EAS: 0.0232%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0065%; gnomAD_E_AMR: 0.0060%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0183%

Exomiser Score: 0.043

Phenotype Score: 0.274

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.559 to Phelan-McDermid syndrome associated with SHANK3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Phenotypic similarity 0.548 to mouse mutant involving SHANK3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000572, abnormal autopod morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000572, abnormal autopod morphology; HP:0010055, Broad hallux - MP:0000572, abnormal autopod morphology

Proximity score 0.507 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:606232 Phelan-McDermid syndrome - autosomal dominant; OMIM:613950 Schizophrenia 15 (susceptibility); ORPHA:48652 Monosomy 22q13.3 (CNV)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.043

Phenotype Score: 0.274

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 22-51135986-T-C [1/1] rs1469966522

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: SHANK3:ENST00000414786.2:c.1305-6T>C:p.?; SHANK3:ENST00000262795.3:c.1389T>C:p.(=); SHANK3:ENST00000445220.2:c.1344T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SYNONYMOUS_VARIANT SNV 22-51135983-A-C [1/1] rs1430487902

Variant score: 0.100

Transcripts:: SHANK3:ENST00000262795.3:c.1386A>C:p.(=); SHANK3:ENST00000445220.2:c.1341A>C:p.(=); SHANK3:ENST00000414786.2:c.1305-9A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.042

Phenotype Score: 0.505

Variant Score: 0.535

Phenotype matches:

Proximity score 0.505 in interactome to BRIP1 and phenotypic similarity 0.676 to Fanconi anemia associated with BRIP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.505 in interactome to BRIP1 and phenotypic similarity 0.275 to mouse mutant of BRIP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001304, cataract; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:614337 Colorectal cancer, hereditary nonpolyposis, type 4 - autosomal dominant; OMIM:619101 Mismatch repair cancer syndrome 4 - autosomal recessive; ORPHA:144 Lynch syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.042

Phenotype Score: 0.505

Variant Score: 0.535

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-6017340-T-C [0/1] rs17420802

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3, BP6_Strong]

ClinVar: BENIGN (reviewed by expert panel)

Variant score: 0.972 CONTRIBUTING VARIANT

Transcripts:: PMS2:ENST00000265849.7:c.2324A>G:p.(Asn775Ser); PMS2:ENST00000382321.4:c.1121A>G:p.(Asn374Ser); PMS2:ENST00000406569.3:c.1684A>G:p.(Thr562Ala); PMS2:ENST00000441476.2:c.2006A>G:p.(Asn669Ser)

Pathogenicity Data:: Best Score: 0.999977; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.218 (T)

Frequency Data:: gnomAD_E_AMR: 0.0388%; gnomAD_E_NFE: 0.0371%; gnomAD_E_OTH: 0.0549%; gnomAD_E_SAS: 0.0098%; gnomAD_G_AFR: 0.0582%; gnomAD_G_EAS: 0.1880%; gnomAD_G_FIN: 0.0291%; gnomAD_G_NFE: 0.1291%

SYNONYMOUS_VARIANT SNV 7-6018249-A-G [0/1] rs1805325

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]

ClinVar: BENIGN (reviewed by expert panel)

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PMS2:ENST00000265849.7:c.2253T>C:p.(=); PMS2:ENST00000382321.4:c.1050T>C:p.(=); PMS2:ENST00000441476.2:c.1935T>C:p.(=); PMS2:ENST00000406569.3:c.1679-904T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC NFE: 0.0047%; gnomAD_E_AFR: 0.0198%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0054%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0033%; gnomAD_G_AFR: 0.0818%; gnomAD_G_FIN: 0.0291%; gnomAD_G_NFE: 0.0203%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-6018249-A-G [0/1] rs1805325

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]

ClinVar: BENIGN (reviewed by expert panel)

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PMS2:ENST00000265849.7:c.2253T>C:p.(=); PMS2:ENST00000382321.4:c.1050T>C:p.(=); PMS2:ENST00000441476.2:c.1935T>C:p.(=); PMS2:ENST00000406569.3:c.1679-904T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC NFE: 0.0047%; gnomAD_E_AFR: 0.0198%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0054%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0033%; gnomAD_G_AFR: 0.0818%; gnomAD_G_FIN: 0.0291%; gnomAD_G_NFE: 0.0203%

Exomiser Score: 0.041

Phenotype Score: 0.333

Variant Score: 0.727

Phenotype matches:

Phenotypic similarity 0.365 to Metaphyseal anadysplasia 2 associated with MMP9.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002979, Bowing of the legs; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0002979, Bowing of the legs; HP:0010055, Broad hallux - HP:0002979, Bowing of the legs

Phenotypic similarity 0.666 to mouse mutant involving MMP9.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003072, abnormal metatarsal bone morphology; HP:0001363, Craniosynostosis - MP:0000060, delayed bone ossification; HP:0011304, Broad thumb - MP:0003072, abnormal metatarsal bone morphology; HP:0010055, Broad hallux - MP:0003072, abnormal metatarsal bone morphology

Proximity score 0.527 in interactome to RECK and phenotypic similarity 0.705 to mouse mutant of RECK.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:613073 Metaphyseal anadysplasia 2 - autosomal recessive; ORPHA:1040 Metaphyseal anadysplasia - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.041

Phenotype Score: 0.333

Variant Score: 0.727

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 20-44642043-A-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.727 CONTRIBUTING VARIANT

Transcripts:: MMP9:ENST00000372330.3:c.1480A>T:p.(Thr494Ser)

Pathogenicity Data:: Best Score: 0.727; Polyphen2: 0.047 (B); SIFT: 0.273 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.040

Phenotype Score: 0.506

Variant Score: 0.529

Phenotype matches:

Proximity score 0.506 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.040

Phenotype Score: 0.506

Variant Score: 0.529

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-65968887-T-A [0/1] rs779985646

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.529 CONTRIBUTING VARIANT

Transcripts:: DENND4A:ENST00000431932.2:c.4133A>T:p.(His1378Leu); DENND4A:ENST00000443035.3:c.4262A>T:p.(His1421Leu)

Pathogenicity Data:: Best Score: 0.52900004; SIFT: 0.471 (T)

Frequency Data:: TOPMed: 0.0008%

Exomiser Score: 0.039

Phenotype Score: 0.502

Variant Score: 0.529

Phenotype matches:

Proximity score 0.502 in interactome to EIF3C and phenotypic similarity 1.000 to mouse mutant of EIF3C.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0009049, abnormal hallux morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.039

Phenotype Score: 0.502

Variant Score: 0.529

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 22-39713638-C-CA [0/1] rs201453499

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.754 CONTRIBUTING VARIANT

Transcripts:: RPL3:ENST00000216146.4:c.197-5_197-4insT:p.?; RPL3:ENST00000401609.1:c.41-5_41-4insT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AFR: 0.0517%; ExAC AMR: 0.1177%; ExAC EAS: 0.1725%; ExAC FIN: 0.0154%; ExAC NFE: 0.0430%; ExAC OTH: 0.1163%; ExAC SAS: 0.3514%; gnomAD_G_AMR: 0.1259%; gnomAD_G_EAS: 0.1247%; gnomAD_G_NFE: 0.0141%

SPLICE_REGION_VARIANT SNV 22-39715593-C-G [0/1] rs200650933

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.303 CONTRIBUTING VARIANT

Transcripts:: RPL3:ENST00000216146.4:c.3+7G>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0998%; TOPMed: 0.0276%; ExAC EAS: 1.7216%; ExAC OTH: 0.3906%; gnomAD_E_AMR: 0.0038%; gnomAD_E_EAS: 0.6846%; gnomAD_E_OTH: 0.0473%; gnomAD_G_EAS: 0.8015%

Exomiser Score: 0.036

Phenotype Score: 0.260

Variant Score: 0.795

Phenotype matches:

Phenotypic similarity 0.646 to Developmental and epileptic encephalopathy 80 associated with PIGB.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001182, Tapered finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001182, Tapered finger

Proximity score 0.520 in interactome to PIGO and phenotypic similarity 0.865 to Hyperphosphatasia with mental retardation syndrome 2 associated with PIGO.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis - HP:0011326, Anterior plagiocephaly; HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:618580 Developmental and epileptic encephalopathy 80 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.036

Phenotype Score: 0.260

Variant Score: 0.795

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-55626174-G-C [0/1] rs1243578081

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.795 CONTRIBUTING VARIANT

Transcripts:: PIGB:ENST00000164305.5:c.763G>C:p.(Asp255His); PIGB:ENST00000539642.1:c.178G>C:p.(Asp60His)

Pathogenicity Data:: Best Score: 0.795; Polyphen2: 0.014 (B); SIFT: 0.205 (T)

Frequency Data:: TOPMed: 0.0008%

Exomiser Score: 0.035

Phenotype Score: 0.252

Variant Score: 0.800

Phenotype matches:

Phenotypic similarity 0.541 to Arthrogryposis multiplex congenita 6 associated with NEB.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001181, Adducted thumb; HP:0001363, Craniosynostosis - HP:0000239, Large fontanelles; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0001181, Adducted thumb

Phenotypic similarity 0.268 to mouse mutant involving NEB.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification; HP:0011304, Broad thumb - MP:0004351, short humerus; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

Known diseases:: OMIM:256030 Nemaline myopathy 2, autosomal recessive - autosomal recessive; OMIM:619334 Arthrogryposis multiplex congenita 6 - autosomal recessive; ORPHA:171430 Severe congenital nemaline myopathy - autosomal recessive; ORPHA:171433 Intermediate nemaline myopathy - autosomal recessive; ORPHA:171436 Typical nemaline myopathy - autosomal recessive; ORPHA:171439 Childhood-onset nemaline myopathy - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.035

Phenotype Score: 0.252

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 2-152458415-G-A [0/1] rs876657541

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]

ClinVar: BENIGN_OR_LIKELY_BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: NEB:ENST00000397345.3:c.13476C>T:p.(=); NEB:ENST00000427231.2:c.13476C>T:p.(=); NEB:ENST00000603639.1:c.13476C>T:p.(=); NEB:ENST00000604864.1:c.13476C>T:p.(=); NEB:ENST00000172853.10:c.11601+7908C>T:p.(=); NEB:ENST00000409198.1:c.11601+7908C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.028

Phenotype Score: 0.541

Variant Score: 0.447

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to OMIM:619334 Arthrogryposis multiplex congenita 6
Phenotypic similarity 0.526 to ORPHA:171430 Severe congenital nemaline myopathy
Phenotypic similarity 0.346 to ORPHA:171436 Typical nemaline myopathy
Phenotypic similarity 0.324 to ORPHA:171439 Childhood-onset nemaline myopathy
Phenotypic similarity 0.237 to OMIM:256030 Nemaline myopathy 2, autosomal recessive

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 2-152458415-G-A [0/1] rs876657541

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]

ClinVar: BENIGN_OR_LIKELY_BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: NEB:ENST00000397345.3:c.13476C>T:p.(=); NEB:ENST00000427231.2:c.13476C>T:p.(=); NEB:ENST00000603639.1:c.13476C>T:p.(=); NEB:ENST00000604864.1:c.13476C>T:p.(=); NEB:ENST00000172853.10:c.11601+7908C>T:p.(=); NEB:ENST00000409198.1:c.11601+7908C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 2-152460241-G-A [0/1] rs147579763

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]

ClinVar: BENIGN_OR_LIKELY_BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.094 CONTRIBUTING VARIANT

Transcripts:: NEB:ENST00000397345.3:c.13105C>T:p.(=); NEB:ENST00000427231.2:c.13105C>T:p.(=); NEB:ENST00000603639.1:c.13105C>T:p.(=); NEB:ENST00000604864.1:c.13105C>T:p.(=); NEB:ENST00000172853.10:c.11601+6082C>T:p.(=); NEB:ENST00000409198.1:c.11601+6082C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.3778%; gnomAD_G_AFR: 0.1316%; gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.034

Phenotype Score: 0.254

Variant Score: 0.795

Phenotype matches:

Phenotypic similarity 0.556 to 6q25 microdeletion syndrome associated with ARID1B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

Proximity score 0.507 in interactome to SMARCD2 and phenotypic similarity 0.657 to Specific granule deficiency 2 associated with SMARCD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001852, Sandal gap

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:135900 Coffin-Siris syndrome 1 - autosomal dominant; ORPHA:1465 Coffin-Siris syndrome - autosomal dominant; ORPHA:251056 6q25 microdeletion syndrome (CNV)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.034

Phenotype Score: 0.254

Variant Score: 0.795

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_DELETION DEL 6-157100430-AGGC-A [0/1] rs777545000

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.817 CONTRIBUTING VARIANT

Transcripts:: ARID1B:ENST00000275248.4:c.1205_1207del:p.(Ala402del); ARID1B:ENST00000346085.5:c.1379_1381del:p.(Ala460del); ARID1B:ENST00000350026.5:c.1379_1381del:p.(Ala460del); ARID1B:ENST00000367148.1:c.1379_1381del:p.(Ala460del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_NFE: 0.0394%; gnomAD_G_AFR: 0.0272%; gnomAD_G_FIN: 0.2500%; gnomAD_G_OTH: 0.1667%

DISRUPTIVE_INFRAME_DELETION DEL 6-157100092-CGCG-C [0/1] rs764418312

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.773 CONTRIBUTING VARIANT

Transcripts:: ARID1B:ENST00000275248.4:c.867_869del:p.(Ala292del); ARID1B:ENST00000346085.5:c.1041_1043del:p.(Ala350del); ARID1B:ENST00000350026.5:c.1041_1043del:p.(Ala350del); ARID1B:ENST00000367148.1:c.1041_1043del:p.(Ala350del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_FIN: 0.1145%; gnomAD_E_NFE: 0.5144%; gnomAD_E_SAS: 0.2688%

Exomiser Score: 0.031

Phenotype Score: 0.500

Variant Score: 0.508

Phenotype matches:

Proximity score 0.500 in interactome to ENPP1 and phenotypic similarity 0.697 to Autosomal recessive hypophosphatemic rickets associated with ENPP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002970, Genu varum; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0002982, Tibial bowing; HP:0010055, Broad hallux - HP:0002970, Genu varum

Proximity score 0.500 in interactome to ENPP1 and phenotypic similarity 0.578 to mouse mutant of ENPP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0008915, fused carpal bones; HP:0001363, Craniosynostosis - MP:0006392, abnormal nucleus pulposus morphology; HP:0011304, Broad thumb - MP:0008915, fused carpal bones; HP:0010055, Broad hallux - MP:0008915, fused carpal bones

Proximity score 0.500 in interactome to ENPP1 and phenotypic similarity 0.563 to fish mutant of ENPP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0012007, ceratohyal cartilage premature perichondral ossification, abnormal; HP:0011304, Broad thumb - ZP:0006782, cleithrum nodular, abnormal; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.031

Phenotype Score: 0.500

Variant Score: 0.508

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-104160692-A-T [0/1] rs201971373

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.915 CONTRIBUTING VARIANT

Transcripts:: AMY2A:ENST00000414303.2:c.285A>T:p.(Arg95Ser)

Pathogenicity Data:: Best Score: 0.999918; Polyphen2: 0.472 (P); Mutation Taster: 1.000 (P); SIFT: 0.205 (T)

Frequency Data:: 1000Genomes: 0.0998%; TOPMed: 0.0200%; ExAC EAS: 0.4870%; gnomAD_E_EAS: 0.4646%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0185%; gnomAD_G_EAS: 0.2488%

SYNONYMOUS_VARIANT SNV 1-104161706-C-A [0/1] rs752786393

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: AMY2A:ENST00000414303.2:c.489C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-104161706-C-A [0/1] rs752786393

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: AMY2A:ENST00000414303.2:c.489C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Exomiser Score: 0.030

Phenotype Score: 0.510

Variant Score: 0.491

Phenotype matches:

Proximity score 0.510 in interactome to FMN1 and phenotypic similarity 0.772 to mouse mutant of FMN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.030

Phenotype Score: 0.510

Variant Score: 0.491

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-62302543-G-A [0/1] rs76611638

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.982 CONTRIBUTING VARIANT

Transcripts:: AHNAK:ENST00000257247.7:c.274C>T:p.(Arg92Cys); AHNAK:ENST00000378024.4:c.274C>T:p.(Arg92Cys); AHNAK:ENST00000530124.1:c.274C>T:p.(Arg92Cys)

Pathogenicity Data:: Best Score: 0.999486; Polyphen2: 0.967 (D); Mutation Taster: 0.999 (P); SIFT: 0.006 (D)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0175%; UK10K: 0.0132%; ExAC EAS: 0.0929%; ExAC NFE: 0.0106%; ExAC SAS: 0.0061%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0754%; gnomAD_E_NFE: 0.0081%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0130%; gnomAD_G_EAS: 0.1233%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 11-62295075-C-T [0/1] rs183783741

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.001 CONTRIBUTING VARIANT

Transcripts:: AHNAK:ENST00000378024.4:c.6814G>A:p.(Val2272Ile); AHNAK:ENST00000257247.7:c.342+7400G>A:p.(=); AHNAK:ENST00000530124.1:c.342+7400G>A:p.(=)

Pathogenicity Data:: Best Score: 0.002; Polyphen2: 0.002 (B); SIFT: 1.000 (T)

Frequency Data:: 1000Genomes: 0.7188%; TOPMed: 0.0654%; ExAC AFR: 0.0096%; ExAC EAS: 1.7102%; ExAC NFE: 0.0015%; ExAC SAS: 0.0484%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 1.6872%; gnomAD_E_NFE: 0.0045%; gnomAD_E_OTH: 0.0911%; gnomAD_E_SAS: 0.0487%; gnomAD_G_EAS: 1.7901%

Exomiser Score: 0.029

Phenotype Score: 0.507

Variant Score: 0.490

Phenotype matches:

Proximity score 0.507 in interactome to NLRP3 and phenotypic similarity 0.705 to CINCA syndrome associated with NLRP3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001476, Delayed closure of the anterior fontanelle; HP:0011304, Broad thumb - HP:0001156, Brachydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.507 in interactome to NLRP3 and phenotypic similarity 0.486 to mouse mutant of NLRP3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0030825, decreased femur size; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0030825, decreased femur size; HP:0010055, Broad hallux - MP:0030825, decreased femur size

Known diseases:: OMIM:618497 Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements - autosomal recessive; ORPHA:442835 Non-specific early-onset epileptic encephalopathy - autosomal dominant/recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.029

Phenotype Score: 0.507

Variant Score: 0.490

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT INS 9-140773612-G-GACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT [0/1] rs370237172

Exomiser ACMG: PATHOGENIC [PVS1, PM2]

Variant score: 0.880 CONTRIBUTING VARIANT

Transcripts:: CACNA1B:ENST00000277549.5:c.-2035+1_-2035+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT:p.(=); CACNA1B:ENST00000277551.2:c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT:p.?; CACNA1B:ENST00000371355.4:c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT:p.?; CACNA1B:ENST00000371357.1:c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT:p.?; CACNA1B:ENST00000371363.1:c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT:p.?; CACNA1B:ENST00000371372.1:c.390+1_390+2insACGACACGGAGCCCTATTTCATCGGGATCTTTTGCTTCGAGGCAGGGATCAAAATCATCGCTCTGGGCTT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.6358%; gnomAD_G_AMR: 0.6234%; gnomAD_G_EAS: 0.5844%; gnomAD_G_FIN: 0.3525%; gnomAD_G_NFE: 0.4949%; gnomAD_G_OTH: 0.3158%

SYNONYMOUS_VARIANT SNV 9-140953560-G-A [0/1] rs1388466870

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CACNA1B:ENST00000277549.5:c.2091G>A:p.(=); CACNA1B:ENST00000277551.2:c.4503G>A:p.(=); CACNA1B:ENST00000371355.4:c.4506G>A:p.(=); CACNA1B:ENST00000371357.1:c.4506G>A:p.(=); CACNA1B:ENST00000371363.1:c.4503G>A:p.(=); CACNA1B:ENST00000371372.1:c.4503G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; gnomAD_E_NFE: 0.0009%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.507

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 9-140953560-G-A [0/1] rs1388466870

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CACNA1B:ENST00000277549.5:c.2091G>A:p.(=); CACNA1B:ENST00000277551.2:c.4503G>A:p.(=); CACNA1B:ENST00000371355.4:c.4506G>A:p.(=); CACNA1B:ENST00000371357.1:c.4506G>A:p.(=); CACNA1B:ENST00000371363.1:c.4503G>A:p.(=); CACNA1B:ENST00000371372.1:c.4503G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.025

Phenotype Score: 0.504

Variant Score: 0.478

Phenotype matches:

Proximity score 0.504 in interactome to TRIP12 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with TRIP12.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.025

Phenotype Score: 0.504

Variant Score: 0.478

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-128119379-T-C [0/1] rs2896399

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.478 CONTRIBUTING VARIANT

Transcripts:: METTL2B:ENST00000262432.8:c.370T>C:p.(Cys124Arg); METTL2B:ENST00000480046.1:c.175T>C:p.(Cys59Arg)

Pathogenicity Data:: Best Score: 0.478; SIFT: 0.522 (T)

Frequency Data:: gnomAD_E_NFE: 0.0009%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.009

Phenotype Score: 0.504

Variant Score: 0.370

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-128119379-T-C [0/1] rs2896399

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.478 CONTRIBUTING VARIANT

Transcripts:: METTL2B:ENST00000262432.8:c.370T>C:p.(Cys124Arg); METTL2B:ENST00000480046.1:c.175T>C:p.(Cys59Arg)

Pathogenicity Data:: Best Score: 0.478; SIFT: 0.522 (T)

Frequency Data:: gnomAD_E_NFE: 0.0009%

MISSENSE_VARIANT SNV 7-128119380-G-C [0/1] rs1053120

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.262 CONTRIBUTING VARIANT

Transcripts:: METTL2B:ENST00000262432.8:c.371G>C:p.(Cys124Ser); METTL2B:ENST00000480046.1:c.176G>C:p.(Cys59Ser)

Pathogenicity Data:: Best Score: 0.26200002; SIFT: 0.738 (T)

Frequency Data:: gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.023

Phenotype Score: 0.501

Variant Score: 0.472

Phenotype matches:

Proximity score 0.501 in interactome to DVL3 and phenotypic similarity 0.823 to Robinow syndrome, autosomal dominant 3 associated with DVL3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.501 in interactome to DVL3 and phenotypic similarity 0.513 to mouse mutant of DVL3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004678, split xiphoid process; HP:0001363, Craniosynostosis - MP:0004522, abnormal orientation of cochlear hair cell stereociliary bundles; HP:0011304, Broad thumb - MP:0004678, split xiphoid process; HP:0010055, Broad hallux - MP:0004678, split xiphoid process

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.023

Phenotype Score: 0.501

Variant Score: 0.472

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-1033543-G-A [0/1] rs769021504

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.472 CONTRIBUTING VARIANT

Transcripts:: NKD2:ENST00000274150.4:c.259G>A:p.(Ala87Thr); NKD2:ENST00000296849.5:c.259G>A:p.(Ala87Thr); NKD2:ENST00000537972.1:c.259G>A:p.(Ala87Thr)

Pathogenicity Data:: Best Score: 0.473; Polyphen2: 0.002 (B); SIFT: 0.527 (T)

Frequency Data:: ExAC NFE: 0.0097%; gnomAD_E_NFE: 0.0024%; gnomAD_E_SAS: 0.0039%

Exomiser Score: 0.022

Phenotype Score: 0.500

Variant Score: 0.470

Phenotype matches:

Proximity score 0.500 in interactome to MDGA2 and phenotypic similarity 0.635 to mouse mutant of MDGA2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000554, abnormal carpal bone morphology; HP:0001363, Craniosynostosis - MP:0000554, abnormal carpal bone morphology; HP:0011304, Broad thumb - MP:0000554, abnormal carpal bone morphology; HP:0010055, Broad hallux - MP:0000554, abnormal carpal bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.022

Phenotype Score: 0.500

Variant Score: 0.470

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-10541402-C-A [0/1] rs766926962

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.470 CONTRIBUTING VARIANT

Transcripts:: KLRK1:ENST00000240618.6:c.8G>T:p.(Trp3Leu); KLRK1:ENST00000540818.1:c.8G>T:p.(Trp3Leu); KLRK1:ENST00000539300.1:c.*205G>T:p.(=)

Pathogenicity Data:: Best Score: 0.47100002; SIFT: 0.529 (T)

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0232%; gnomAD_E_EAS: 0.0116%

Exomiser Score: 0.022

Phenotype Score: 0.501

Variant Score: 0.466

Phenotype matches:

Proximity score 0.501 in interactome to PRKAR1A and phenotypic similarity 0.684 to Acrodysostosis 1, with or without hormone resistance associated with PRKAR1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0004490, Calvarial hyperostosis; HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger; HP:0010055, Broad hallux - HP:0001847, Long hallux

Proximity score 0.501 in interactome to PRKAR1A and phenotypic similarity 0.852 to mouse mutant of PRKAR1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0003419, delayed endochondral bone ossification; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.022

Phenotype Score: 0.501

Variant Score: 0.466

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-50121521-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.466 CONTRIBUTING VARIANT

Transcripts:: LRRC18:ENST00000298124.3:c.680T>G:p.(Met227Arg); LRRC18:ENST00000374160.3:c.680T>G:p.(Met227Arg); LRRC18:ENST00000325239.5:c.7586+11613A>C:p.(=); LRRC18:ENST00000413659.2:c.*2748+11613A>C:p.(=)

Pathogenicity Data:: Best Score: 0.46600002; Polyphen2: 0.025 (B); SIFT: 0.534 (T)

Frequency Data:: No frequency data

Exomiser Score: 0.019

Phenotype Score: 0.504

Variant Score: 0.446

Phenotype matches:

Phenotypic similarity 0.272 to mouse mutant involving RAD54L.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0012121, sclerocornea; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to RAD51C and phenotypic similarity 0.676 to Fanconi anemia associated with RAD51C.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Known diseases:: OMIM:114480 Breast cancer, invasive ductal (susceptibility); OMIM:605027 Lymphoma, non-Hodgkin, somatic - unknown

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.019

Phenotype Score: 0.504

Variant Score: 0.446

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-46715694-G-C [0/1] rs764303863

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.446 CONTRIBUTING VARIANT

Transcripts:: RAD54L:ENST00000371975.4:c.113G>C:p.(Ser38Thr); RAD54L:ENST00000442598.1:c.113G>C:p.(Ser38Thr)

Pathogenicity Data:: Best Score: 0.45; Polyphen2: 0.001 (B); SIFT: 0.550 (T)

Frequency Data:: TOPMed: 0.0064%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0290%; gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.017

Phenotype Score: 0.500

Variant Score: 0.439

Phenotype matches:

Proximity score 0.500 in interactome to SFN and phenotypic similarity 0.710 to mouse mutant of SFN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0000454, abnormal jaw morphology; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.017

Phenotype Score: 0.500

Variant Score: 0.439

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 13-24892967-C-T [0/1] rs150781719

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.822 CONTRIBUTING VARIANT

Transcripts:: C1QTNF9:ENST00000332018.4:c.178C>T:p.(Arg60Cys); C1QTNF9:ENST00000382071.2:c.178C>T:p.(Arg60Cys); C1QTNF9:ENST00000382141.4:c.*174C>T:p.(=)

Pathogenicity Data:: Best Score: 0.837; Polyphen2: 0.448 (P); SIFT: 0.163 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; ExAC AMR: 0.0259%; ExAC EAS: 0.1040%; ExAC NFE: 0.0105%; gnomAD_E_AMR: 0.0119%; gnomAD_E_EAS: 0.1045%; gnomAD_E_NFE: 0.0107%; gnomAD_E_OTH: 0.0365%; gnomAD_E_SAS: 0.0097%; gnomAD_G_AFR: 0.0114%; gnomAD_G_EAS: 0.1233%; gnomAD_G_NFE: 0.0200%; gnomAD_G_OTH: 0.1022%

SYNONYMOUS_VARIANT SNV 13-24895711-T-C [0/1] rs377422263

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.056 CONTRIBUTING VARIANT

Transcripts:: C1QTNF9:ENST00000332018.4:c.807T>C:p.(=); C1QTNF9:ENST00000382071.2:c.807T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AFR: 0.0288%; ExAC AMR: 0.0432%; ExAC EAS: 0.0925%; ExAC NFE: 0.0030%; ExAC OTH: 0.1109%; ExAC SAS: 1.4514%; gnomAD_E_AFR: 0.0327%; gnomAD_E_AMR: 0.0238%; gnomAD_E_EAS: 0.0812%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0365%; gnomAD_E_SAS: 1.3941%; gnomAD_G_AFR: 0.0459%; gnomAD_G_EAS: 0.0621%

Exomiser Score: 0.016

Phenotype Score: 0.502

Variant Score: 0.433

Phenotype matches:

Proximity score 0.502 in interactome to PSEN1 and phenotypic similarity 0.175 to Familial isolated dilated cardiomyopathy associated with PSEN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0000982, Palmoplantar keratoderma; HP:0010055, Broad hallux - HP:0000982, Palmoplantar keratoderma

Proximity score 0.502 in interactome to PSEN1 and phenotypic similarity 0.685 to mouse mutant of PSEN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000592, short tail; HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology; HP:0011304, Broad thumb - MP:0000592, short tail; HP:0010055, Broad hallux - MP:0000592, short tail

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.502

Variant Score: 0.433

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-62135281-C-T [0/1] rs371477913

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.433 CONTRIBUTING VARIANT

Transcripts:: ERN1:ENST00000433197.3:c.1279G>A:p.(Ala427Thr)

Pathogenicity Data:: Best Score: 0.43699998; Polyphen2: 0.002 (B); SIFT: 0.563 (T)

Frequency Data:: TOPMed: 0.0060%; ESP AA: 0.0250%; ESP All: 0.0081%; ExAC FIN: 0.0414%; ExAC NFE: 0.0160%; ExAC SAS: 0.0079%; gnomAD_E_AMR: 0.0031%; gnomAD_E_EAS: 0.0060%; gnomAD_E_FIN: 0.0366%; gnomAD_E_NFE: 0.0102%; gnomAD_G_EAS: 0.0617%; gnomAD_G_FIN: 0.0287%; gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-105413578-G-A [0/1] rs1211896206

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: AHNAK2:ENST00000333244.5:c.8210C>T:p.(Pro2737Leu); AHNAK2:ENST00000557457.1:c.-220-6263C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.996 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.014

Phenotype Score: 0.000

Variant Score: 0.985

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-105413578-G-A [0/1] rs1211896206

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: AHNAK2:ENST00000333244.5:c.8210C>T:p.(Pro2737Leu); AHNAK2:ENST00000557457.1:c.-220-6263C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.996 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 14-105410512-G-A [0/1] rs762470858

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.969 CONTRIBUTING VARIANT

Transcripts:: AHNAK2:ENST00000333244.5:c.11276C>T:p.(Ala3759Val); AHNAK2:ENST00000557457.1:c.-220-3197C>T:p.(=)

Pathogenicity Data:: Best Score: 0.972; Polyphen2: 0.010 (B); SIFT: 0.028 (D)

Frequency Data:: UK10K: 0.0132%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0195%; gnomAD_G_AFR: 0.0122%; gnomAD_G_NFE: 0.0135%

Other passed variants:

MISSENSE_VARIANT SNV 14-105410461-G-C [0/1] rs771414548

Variant score: 0.968

Transcripts:: AHNAK2:ENST00000333244.5:c.11327C>G:p.(Pro3776Arg); AHNAK2:ENST00000557457.1:c.-220-3146C>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.944 (P); SIFT: 0.000 (D)

Frequency Data:: gnomAD_G_AFR: 0.1652%; gnomAD_G_EAS: 0.2146%; gnomAD_G_NFE: 0.0068%

MISSENSE_VARIANT SNV 14-105410383-T-C [0/1] rs553656839

Variant score: 0.954

Transcripts:: AHNAK2:ENST00000333244.5:c.11405A>G:p.(Lys3802Arg); AHNAK2:ENST00000557457.1:c.-220-3068A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.471 (P); Mutation Taster: 1.000 (P); SIFT: 0.028 (D)

Frequency Data:: 1000Genomes: 0.1797%; TOPMed: 0.1797%; gnomAD_E_NFE: 0.0009%; gnomAD_G_AFR: 0.1322%; gnomAD_G_EAS: 0.2941%; gnomAD_G_NFE: 0.0137%

MISSENSE_VARIANT SNV 14-105419314-T-G [0/1] rs557538603

Variant score: 0.606

Transcripts:: AHNAK2:ENST00000333244.5:c.2474A>C:p.(Glu825Ala); AHNAK2:ENST00000557457.1:c.-221+904A>C:p.(=)

Pathogenicity Data:: Best Score: 0.612; Polyphen2: 0.013 (B); SIFT: 0.388 (T)

Frequency Data:: UK10K: 0.0132%; gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0298%; gnomAD_E_EAS: 0.0058%; gnomAD_E_FIN: 0.0179%; gnomAD_E_NFE: 0.0673%; gnomAD_E_OTH: 0.0548%; gnomAD_E_SAS: 0.0033%

MISSENSE_VARIANT SNV 14-105413040-T-C [0/1] rs755431279

Variant score: 0.322

Transcripts:: AHNAK2:ENST00000333244.5:c.8748A>G:p.(Ile2916Met); AHNAK2:ENST00000557457.1:c.-220-5725A>G:p.(=)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.006 (B); SIFT: 0.007 (D)

Frequency Data:: gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0328%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0548%; gnomAD_E_SAS: 0.0032%; gnomAD_G_AFR: 1.7907%; gnomAD_G_AMR: 0.1302%; gnomAD_G_EAS: 1.5228%; gnomAD_G_FIN: 0.1180%; gnomAD_G_NFE: 0.0560%; gnomAD_G_OTH: 0.1087%

SYNONYMOUS_VARIANT SNV 14-105419298-G-A [0/1] rs746412834

Variant score: 0.099

Transcripts:: AHNAK2:ENST00000333244.5:c.2490C>T:p.(=); AHNAK2:ENST00000557457.1:c.-221+920C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0197%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0032%; gnomAD_G_AFR: 0.0471%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 14-105410502-C-G [0/1] rs1197255416

Variant score: 0.099

Transcripts:: AHNAK2:ENST00000333244.5:c.11286G>C:p.(=); AHNAK2:ENST00000557457.1:c.-220-3187G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.0125%; gnomAD_G_EAS: 0.0668%; gnomAD_G_NFE: 0.0069%

SYNONYMOUS_VARIANT SNV 14-105410508-A-G [0/1] rs1253609445

Variant score: 0.099

Transcripts:: AHNAK2:ENST00000333244.5:c.11280T>C:p.(=); AHNAK2:ENST00000557457.1:c.-220-3193T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_EAS: 0.0678%; gnomAD_G_NFE: 0.0069%

SYNONYMOUS_VARIANT SNV 14-105410481-C-G [0/1] rs1340610489

Variant score: 0.098

Transcripts:: AHNAK2:ENST00000333244.5:c.11307G>C:p.(=); AHNAK2:ENST00000557457.1:c.-220-3166G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.0629%; gnomAD_G_EAS: 0.1376%; gnomAD_G_NFE: 0.0068%

SYNONYMOUS_VARIANT SNV 14-105410352-T-C [0/1] rs554470062

Variant score: 0.098

Transcripts:: AHNAK2:ENST00000333244.5:c.11436A>G:p.(=); AHNAK2:ENST00000557457.1:c.-220-3037A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0998%; TOPMed: 0.0998%; gnomAD_E_AFR: 0.1244%; gnomAD_E_AMR: 0.0089%; gnomAD_E_NFE: 0.0063%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0976%; gnomAD_G_AFR: 0.1686%; gnomAD_G_NFE: 0.0136%

SYNONYMOUS_VARIANT SNV 14-105410463-G-A [0/1] rs777192686

Variant score: 0.097

Transcripts:: AHNAK2:ENST00000333244.5:c.11325C>T:p.(=); AHNAK2:ENST00000557457.1:c.-220-3148C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.1812%; gnomAD_G_EAS: 0.2152%; gnomAD_G_NFE: 0.0136%

SYNONYMOUS_VARIANT SNV 14-105410460-T-C [0/1] rs760792869

Variant score: 0.095

Transcripts:: AHNAK2:ENST00000333244.5:c.11328A>G:p.(=); AHNAK2:ENST00000557457.1:c.-220-3145A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AFR: 0.0204%; ExAC EAS: 0.0116%; ExAC NFE: 0.0015%; ExAC SAS: 0.0303%; gnomAD_E_AFR: 0.0131%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0227%; gnomAD_G_AFR: 0.2503%; gnomAD_G_EAS: 0.2915%; gnomAD_G_NFE: 0.0137%

SYNONYMOUS_VARIANT SNV 14-105410451-T-C [0/1] rs199536215

Variant score: 0.088

Transcripts:: AHNAK2:ENST00000333244.5:c.11337A>G:p.(=); AHNAK2:ENST00000557457.1:c.-220-3136A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0066%; gnomAD_E_SAS: 0.0033%; gnomAD_G_AFR: 0.3233%; gnomAD_G_EAS: 0.6192%; gnomAD_G_NFE: 0.0141%

SYNONYMOUS_VARIANT SNV 14-105412014-C-A [0/1] rs533365075

Variant score: 0.082

Transcripts:: AHNAK2:ENST00000333244.5:c.9774G>T:p.(=); AHNAK2:ENST00000557457.1:c.-220-4699G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0799%; TOPMed: 0.0234%; ExAC EAS: 0.6378%; ExAC NFE: 0.0015%; ExAC SAS: 0.0122%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.5532%; gnomAD_E_NFE: 0.0019%; gnomAD_E_OTH: 0.0191%; gnomAD_E_SAS: 0.0101%; gnomAD_G_EAS: 0.8301%; gnomAD_G_NFE: 0.0085%

MISSENSE_VARIANT SNV 14-105415607-C-G [0/1] rs112699389

Variant score: 0.073

Transcripts:: AHNAK2:ENST00000333244.5:c.6181G>C:p.(Val2061Leu); AHNAK2:ENST00000557457.1:c.-221+4611G>C:p.(=)

Pathogenicity Data:: Best Score: 0.184; Polyphen2: 0.184 (B); SIFT: 1.000 (T)

Frequency Data:: 1000Genomes: 0.3195%; TOPMed: 0.3195%; ExAC AFR: 0.0434%; ExAC AMR: 0.2236%; ExAC EAS: 1.7005%; ExAC NFE: 0.0830%; ExAC OTH: 1.0938%; ExAC SAS: 0.7985%; gnomAD_E_AFR: 0.0274%; gnomAD_E_AMR: 0.0547%; gnomAD_E_EAS: 0.0484%; gnomAD_E_NFE: 0.0014%; gnomAD_E_SAS: 0.0633%; gnomAD_G_AFR: 0.0273%; gnomAD_G_AMR: 0.3390%; gnomAD_G_EAS: 0.5785%; gnomAD_G_NFE: 0.1383%; gnomAD_G_OTH: 0.1639%

SYNONYMOUS_VARIANT SNV 14-105418080-C-A [0/1] rs546876487

Variant score: 0.070

Transcripts:: AHNAK2:ENST00000333244.5:c.3708G>T:p.(=); AHNAK2:ENST00000557457.1:c.-221+2138G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 1.0780%; TOPMed: 1.0780%; gnomAD_E_AFR: 0.2453%; gnomAD_E_AMR: 0.0193%; gnomAD_E_NFE: 0.0024%; gnomAD_E_OTH: 0.0230%; gnomAD_E_SAS: 0.0083%; gnomAD_G_AFR: 1.1684%; gnomAD_G_AMR: 0.1404%; gnomAD_G_EAS: 0.3981%; gnomAD_G_NFE: 0.1363%; gnomAD_G_OTH: 0.5348%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 1-41847872-G-GGCCCGCGCCGGGACGCCCGCCTACTTCGGCGGCTGCAAGGGCGGCGCCTACGGCGGGGGCGGGGGCTTCGGGCCGCCGGCGATGGGCGCTCTGCGCCGTCTGCCCATGCAGACCATCCAGGAGAACAAGCAGGCCAGCTTCGTGCCGGCCGCGGCGCCCTTCCGCCCTGGGGCGCTGCCCGCGCTGCTGCCGCCGCCGCC [1/1] rs1643606760

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FOXO6:ENST00000372591.1:c.1008_1009insGGGACGCCCGCCTACTTCGGCGGCTGCAAGGGCGGCGCCTACGGCGGGGGCGGGGGCTTCGGGCCGCCGGCGATGGGCGCTCTGCGCCGTCTGCCCATGCAGACCATCCAGGAGAACAAGCAGGCCAGCTTCGTGCCGGCCGCGGCGCCCTTCCGCCCTGGGGCGCTGCCCGCGCTGCTGCCGCCGCCGCCGCCCGCGCC:p.(Gln337Glyfs*224)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRG1BP

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 20-29625985-G-C [0/1] rs79368216

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG1BP:ENST00000278882.3:c.228+1G>C:p.?; FRG1BP:ENST00000358464.4:c.228+1G>C:p.?; FRG1BP:ENST00000439954.2:c.243+1G>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 20-29625985-G-C [0/1] rs79368216

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG1BP:ENST00000278882.3:c.228+1G>C:p.?; FRG1BP:ENST00000358464.4:c.228+1G>C:p.?; FRG1BP:ENST00000439954.2:c.243+1G>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

STOP_GAINED SNV 20-29632660-G-T [0/1] rs796333808

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG1BP:ENST00000278882.3:c.475G>T:p.(Glu159*); FRG1BP:ENST00000358464.4:c.475G>T:p.(Glu159*)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SPLICE_DONOR_VARIANT SNV 20-29612103-T-C [0/1] rs73906354

Variant score: 0.997

Transcripts:: FRG1BP:ENST00000358464.4:c.-128+2T>C:p.(=); FRG1BP:ENST00000439954.2:c.-124+2T>C:p.(=); FRG1BP:ENST00000278882.3:c.-134T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0200%

INFRAME_INSERTION INS 20-29625924-A-ACTT [0/1] rs377364132

Variant score: 0.850

Transcripts:: FRG1BP:ENST00000278882.3:c.169_171dup:p.(Leu57dup); FRG1BP:ENST00000358464.4:c.169_171dup:p.(Leu57dup); FRG1BP:ENST00000439954.2:c.184_186dup:p.(Leu62dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

DISRUPTIVE_INFRAME_DELETION DEL 20-29628274-TGAAGCAGGGGACATAGAA-T [0/1]

Variant score: 0.850

Transcripts:: FRG1BP:ENST00000278882.3:c.278_295del:p.(Glu93_Glu98del); FRG1BP:ENST00000358464.4:c.278_295del:p.(Glu93_Glu98del); FRG1BP:ENST00000439954.2:c.293_310del:p.0?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 20-29612099-G-A [0/1] rs139498073

Variant score: 0.800

Transcripts:: FRG1BP:ENST00000358464.4:c.-130G>A:p.(=); FRG1BP:ENST00000439954.2:c.-126G>A:p.(=); FRG1BP:ENST00000278882.3:c.-138G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 20-29625984-T-C [0/1] rs80066412

Variant score: 0.800

Transcripts:: FRG1BP:ENST00000278882.3:c.228T>C:p.(=); FRG1BP:ENST00000358464.4:c.228T>C:p.(=); FRG1BP:ENST00000439954.2:c.243T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 20-29625979-C-A [0/1] rs7272849

Variant score: 0.600

Transcripts:: FRG1BP:ENST00000278882.3:c.223C>A:p.(Gln75Lys); FRG1BP:ENST00000358464.4:c.223C>A:p.(Gln75Lys); FRG1BP:ENST00000439954.2:c.238C>A:p.(Gln80Lys)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 20-29628241-G-C [0/1] rs1436052500

Variant score: 0.600

Transcripts:: FRG1BP:ENST00000278882.3:c.243G>C:p.(Leu81Phe); FRG1BP:ENST00000358464.4:c.243G>C:p.(Leu81Phe); FRG1BP:ENST00000439954.2:c.258G>C:p.(Leu86Phe)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 20-29628243-T-C [0/1] rs754561929

Variant score: 0.600

Transcripts:: FRG1BP:ENST00000278882.3:c.245T>C:p.(Leu82Ser); FRG1BP:ENST00000358464.4:c.245T>C:p.(Leu82Ser); FRG1BP:ENST00000439954.2:c.260T>C:p.(Leu87Ser)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 20-29628257-T-C [0/1] rs1035506847

Variant score: 0.600

Transcripts:: FRG1BP:ENST00000278882.3:c.259T>C:p.(Cys87Arg); FRG1BP:ENST00000358464.4:c.259T>C:p.(Cys87Arg); FRG1BP:ENST00000439954.2:c.274T>C:p.(Cys92Arg)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 20-29628273-A-G [0/1] rs749727422

Variant score: 0.600

Transcripts:: FRG1BP:ENST00000278882.3:c.275A>G:p.(Asn92Ser); FRG1BP:ENST00000358464.4:c.275A>G:p.(Asn92Ser); FRG1BP:ENST00000439954.2:c.290A>G:p.(Asn97Ser)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 20-29633900-A-G [0/1] rs60081496

Variant score: 0.593

Transcripts:: FRG1BP:ENST00000278882.3:c.539A>G:p.(Glu180Gly); FRG1BP:ENST00000358464.4:c.539A>G:p.(Glu180Gly)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0543%; gnomAD_E_EAS: 0.0060%; gnomAD_E_FIN: 0.0046%; gnomAD_E_NFE: 0.0252%; gnomAD_E_OTH: 0.0190%; gnomAD_E_SAS: 0.0803%

MISSENSE_VARIANT SNV 20-29623224-C-A [0/1] rs779430348

Variant score: 0.589

Transcripts:: FRG1BP:ENST00000439954.2:c.40C>A:p.(Leu14Ile); FRG1BP:ENST00000278882.3:c.36C>A:p.(=); FRG1BP:ENST00000358464.4:c.36C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0515%; gnomAD_E_AMR: 0.0341%; gnomAD_E_EAS: 0.0198%; gnomAD_E_FIN: 0.0228%; gnomAD_E_NFE: 0.0573%; gnomAD_E_OTH: 0.0287%; gnomAD_E_SAS: 0.0467%; gnomAD_G_AFR: 0.0910%; gnomAD_G_EAS: 0.1253%; gnomAD_G_NFE: 0.0515%

MISSENSE_VARIANT SNV 20-29625877-G-A [0/1] rs7266938

Variant score: 0.581

Transcripts:: FRG1BP:ENST00000278882.3:c.121G>A:p.(Ala41Thr); FRG1BP:ENST00000358464.4:c.121G>A:p.(Ala41Thr); FRG1BP:ENST00000439954.2:c.136G>A:p.(Ala46Thr)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AFR: 0.1137%; ExAC AMR: 0.0087%; ExAC EAS: 0.2110%; ExAC FIN: 0.0152%; ExAC NFE: 0.0153%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0268%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.1000%; gnomAD_E_NFE: 0.0063%; gnomAD_E_OTH: 0.0184%; gnomAD_E_SAS: 0.0066%

SYNONYMOUS_VARIANT SNV 20-29632680-G-A [0/1] rs4892355

Variant score: 0.096

Transcripts:: FRG1BP:ENST00000278882.3:c.495G>A:p.(=); FRG1BP:ENST00000358464.4:c.495G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0070%; gnomAD_E_AMR: 0.0385%; gnomAD_E_EAS: 0.2344%; gnomAD_E_NFE: 0.0199%; gnomAD_E_OTH: 0.0195%; gnomAD_E_SAS: 0.0105%; gnomAD_G_AFR: 0.0116%; gnomAD_G_EAS: 0.0708%

FRG2C

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 3-75713658-AAG-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG2C:ENST00000308062.3:c.129_130del:p.(Gly44Glnfs*9); FRG2C:ENST00000464571.1:c.129_130del:p.(Gly44Glnfs*9)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 3-75713658-AAG-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG2C:ENST00000308062.3:c.129_130del:p.(Gly44Glnfs*9); FRG2C:ENST00000464571.1:c.129_130del:p.(Gly44Glnfs*9)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_TRUNCATION DEL 3-75714805-TG-T [0/1] rs144577984

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG2C:ENST00000308062.3:c.465del:p.(Gly155Glyfs*11); FRG2C:ENST00000464571.1:c.462del:p.(Gly154Glyfs*11)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

FRAMESHIFT_TRUNCATION DEL 3-75714824-AG-A [0/1] rs373728386

Variant score: 1.000

Transcripts:: FRG2C:ENST00000308062.3:c.483del:p.(Arg161Serfs*5); FRG2C:ENST00000464571.1:c.480del:p.(Arg160Serfs*5)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75715124-C-T [0/1] rs72503535

Variant score: 1.000

Transcripts:: FRG2C:ENST00000308062.3:c.781C>T:p.(Pro261Ser); FRG2C:ENST00000464571.1:c.778C>T:p.(Pro260Ser)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.986 (D); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75715181-G-A [0/1] rs4054107

Variant score: 1.000

Transcripts:: FRG2C:ENST00000308062.3:c.838G>A:p.(Gly280Arg); FRG2C:ENST00000464571.1:c.835G>A:p.(Gly279Arg)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.979 (D); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714807-G-A [0/1] rs62247158

Variant score: 0.998

Transcripts:: FRG2C:ENST00000308062.3:c.464G>A:p.(Gly155Glu); FRG2C:ENST00000464571.1:c.461G>A:p.(Gly154Glu)

Pathogenicity Data:: Best Score: 0.998; Polyphen2: 0.998 (D); SIFT: 0.003 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75713561-C-T [0/1] rs199575562

Variant score: 0.996

Transcripts:: FRG2C:ENST00000308062.3:c.31C>T:p.(His11Tyr); FRG2C:ENST00000464571.1:c.31C>T:p.(His11Tyr)

Pathogenicity Data:: Best Score: 0.996; Polyphen2: 0.888 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0004%

MISSENSE_VARIANT SNV 3-75713563-C-G [0/1] rs201362708

Variant score: 0.993

Transcripts:: FRG2C:ENST00000308062.3:c.33C>G:p.(His11Gln); FRG2C:ENST00000464571.1:c.33C>G:p.(His11Gln)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.944 (P); SIFT: 0.007 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75715173-C-T [0/1] rs79506752

Variant score: 0.993

Transcripts:: FRG2C:ENST00000308062.3:c.830C>T:p.(Ala277Val); FRG2C:ENST00000464571.1:c.827C>T:p.(Ala276Val)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.971 (D); SIFT: 0.007 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75713654-G-A [0/1] rs73840317

Variant score: 0.990

Transcripts:: FRG2C:ENST00000308062.3:c.124G>A:p.(Gly42Arg); FRG2C:ENST00000464571.1:c.124G>A:p.(Gly42Arg)

Pathogenicity Data:: Best Score: 0.99; Polyphen2: 0.101 (B); SIFT: 0.010 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714950-C-A [0/1] rs73840338

Variant score: 0.986

Transcripts:: FRG2C:ENST00000308062.3:c.607C>A:p.(Leu203Met); FRG2C:ENST00000464571.1:c.604C>A:p.(Leu202Met)

Pathogenicity Data:: Best Score: 0.986; Polyphen2: 0.986 (D); SIFT: 0.016 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75713555-G-A [0/1] rs201766868

Variant score: 0.982

Transcripts:: FRG2C:ENST00000308062.3:c.25G>A:p.(Asp9Asn); FRG2C:ENST00000464571.1:c.25G>A:p.(Asp9Asn)

Pathogenicity Data:: Best Score: 0.982; Polyphen2: 0.982 (D); SIFT: 0.050 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714345-G-T [0/1] rs73840324

Variant score: 0.979

Transcripts:: FRG2C:ENST00000308062.3:c.325G>T:p.(Asp109Tyr); FRG2C:ENST00000464571.1:c.322G>T:p.(Asp108Tyr)

Pathogenicity Data:: Best Score: 0.979; Polyphen2: 0.246 (B); SIFT: 0.021 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714819-G-A [0/1] rs74497996

Variant score: 0.964

Transcripts:: FRG2C:ENST00000308062.3:c.476G>A:p.(Arg159Gln); FRG2C:ENST00000464571.1:c.473G>A:p.(Arg158Gln)

Pathogenicity Data:: Best Score: 0.964; Polyphen2: 0.001 (B); SIFT: 0.036 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714917-G-A [0/1] rs75138472

Variant score: 0.959

Transcripts:: FRG2C:ENST00000308062.3:c.574G>A:p.(Ala192Thr); FRG2C:ENST00000464571.1:c.571G>A:p.(Ala191Thr)

Pathogenicity Data:: Best Score: 0.959; Polyphen2: 0.002 (B); SIFT: 0.041 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714771-A-G [0/1] rs79973298

Variant score: 0.943

Transcripts:: FRG2C:ENST00000308062.3:c.428A>G:p.(Asp143Gly); FRG2C:ENST00000464571.1:c.425A>G:p.(Asp142Gly)

Pathogenicity Data:: Best Score: 0.943; Polyphen2: 0.943 (P); SIFT: 0.076 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714929-G-A [0/1] rs75980922

Variant score: 0.942

Transcripts:: FRG2C:ENST00000308062.3:c.586G>A:p.(Ala196Thr); FRG2C:ENST00000464571.1:c.583G>A:p.(Ala195Thr)

Pathogenicity Data:: Best Score: 0.94200003; Polyphen2: 0.905 (P); SIFT: 0.058 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714809-C-T [0/1] rs77371781

Variant score: 0.939

Transcripts:: FRG2C:ENST00000308062.3:c.466C>T:p.(Arg156Cys); FRG2C:ENST00000464571.1:c.463C>T:p.(Arg155Cys)

Pathogenicity Data:: Best Score: 0.939; Polyphen2: 0.001 (B); SIFT: 0.061 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75713618-A-T [0/1] rs78279965

Variant score: 0.889

Transcripts:: FRG2C:ENST00000308062.3:c.88A>T:p.(Thr30Ser); FRG2C:ENST00000464571.1:c.88A>T:p.(Thr30Ser)

Pathogenicity Data:: Best Score: 0.889; Polyphen2: 0.001 (B); SIFT: 0.111 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714825-G-A [0/1] rs74640812

Variant score: 0.833

Transcripts:: FRG2C:ENST00000308062.3:c.482G>A:p.(Arg161Lys); FRG2C:ENST00000464571.1:c.479G>A:p.(Arg160Lys)

Pathogenicity Data:: Best Score: 0.833; Polyphen2: 0.015 (B); SIFT: 0.167 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714831-G-A [0/1] rs138192454

Variant score: 0.815

Transcripts:: FRG2C:ENST00000308062.3:c.488G>A:p.(Arg163Gln); FRG2C:ENST00000464571.1:c.485G>A:p.(Arg162Gln)

Pathogenicity Data:: Best Score: 0.815; Polyphen2: 0.001 (B); SIFT: 0.185 (T)

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 3-75714674-G-A [0/1] rs62247156

Variant score: 0.800

Transcripts:: FRG2C:ENST00000308062.3:c.335-4G>A:p.?; FRG2C:ENST00000464571.1:c.332-4G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714843-T-A [0/1] rs77860721

Variant score: 0.758

Transcripts:: FRG2C:ENST00000308062.3:c.500T>A:p.(Val167Asp); FRG2C:ENST00000464571.1:c.497T>A:p.(Val166Asp)

Pathogenicity Data:: Best Score: 0.758; Polyphen2: 0.181 (B); SIFT: 0.242 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75713669-G-A [0/1] rs73840318

Variant score: 0.652

Transcripts:: FRG2C:ENST00000308062.3:c.139G>A:p.(Ala47Thr); FRG2C:ENST00000464571.1:c.139G>A:p.(Ala47Thr)

Pathogenicity Data:: Best Score: 0.652; Polyphen2: 0.003 (B); SIFT: 0.348 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714337-T-G [0/1] rs73840323

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.600

Transcripts:: FRG2C:ENST00000308062.3:c.317T>G:p.(Ile106Ser); FRG2C:ENST00000464571.1:c.314T>G:p.(Ile105Ser)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714702-A-G [0/1] rs62247157

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.600

Transcripts:: FRG2C:ENST00000308062.3:c.359A>G:p.(Asn120Ser); FRG2C:ENST00000464571.1:c.356A>G:p.(Asn119Ser)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714840-A-G [0/1] rs77669108

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.600

Transcripts:: FRG2C:ENST00000308062.3:c.497A>G:p.(Glu166Gly); FRG2C:ENST00000464571.1:c.494A>G:p.(Glu165Gly)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75715118-G-A [0/1] rs73840339

Variant score: 0.599

Transcripts:: FRG2C:ENST00000308062.3:c.775G>A:p.(Ala259Thr); FRG2C:ENST00000464571.1:c.772G>A:p.(Ala258Thr)

Pathogenicity Data:: Best Score: 0.599; SIFT: 0.401 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75715099-T-A [0/1] rs2118760

Variant score: 0.376

Transcripts:: FRG2C:ENST00000308062.3:c.756T>A:p.(Asp252Glu); FRG2C:ENST00000464571.1:c.753T>A:p.(Asp251Glu)

Pathogenicity Data:: Best Score: 0.376; Polyphen2: 0.001 (B); SIFT: 0.624 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714298-A-G [0/1] rs74714110

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.113

Transcripts:: FRG2C:ENST00000308062.3:c.278A>G:p.(Gln93Arg); FRG2C:ENST00000464571.1:c.275A>G:p.(Gln92Arg)

Pathogenicity Data:: Best Score: 0.112999976; SIFT: 0.887 (T)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75713566-T-C [0/1] rs74910647

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.36T>C:p.(=); FRG2C:ENST00000464571.1:c.36T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714311-G-A [0/1] rs79850029

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.291G>A:p.(=); FRG2C:ENST00000464571.1:c.288G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714709-G-T [0/1] rs75314787

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.366G>T:p.(=); FRG2C:ENST00000464571.1:c.363G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714835-C-T [0/1] rs150744016

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.492C>T:p.(=); FRG2C:ENST00000464571.1:c.489C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714853-G-A [0/1] rs75091771

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.510G>A:p.(=); FRG2C:ENST00000464571.1:c.507G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714898-G-A [0/1] rs62247159

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.555G>A:p.(=); FRG2C:ENST00000464571.1:c.552G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714976-C-T [0/1] rs62247960

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.633C>T:p.(=); FRG2C:ENST00000464571.1:c.630C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75714980-C-A [0/1] rs78599742

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.637C>A:p.(=); FRG2C:ENST00000464571.1:c.634C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75715033-T-C [0/1] rs79024020

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.690T>C:p.(=); FRG2C:ENST00000464571.1:c.687T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75715087-T-A [0/1] rs62247961

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.744T>A:p.(=); FRG2C:ENST00000464571.1:c.741T>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75715174-T-G [0/1] rs78974762

Variant score: 0.100

Transcripts:: FRG2C:ENST00000308062.3:c.831T>G:p.(=); FRG2C:ENST00000464571.1:c.828T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75714788-A-C [0/1] rs77229582

Variant score: 0.008

Transcripts:: FRG2C:ENST00000308062.3:c.445A>C:p.(Ser149Arg); FRG2C:ENST00000464571.1:c.442A>C:p.(Ser148Arg)

Pathogenicity Data:: Best Score: 0.008000016; SIFT: 0.992 (T)

Frequency Data:: No frequency data

HLA-DRB5

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_VARIANT INS 6-32487158-G-GCA [0/1] rs138885982

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: HLA-DRB5:ENST00000374975.3:c.640_641insTG:p.(Thr214Metfs*17)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

HLA-DRB6

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT SNV 6-32521178-T-C [0/1] rs1368270719

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: HLA-DRB6:ENST00000411500.1:n.852-2A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.900

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT SNV 6-32521178-T-C [0/1] rs1368270719

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: HLA-DRB6:ENST00000411500.1:n.852-2A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 6-32521179-G-A [0/1] rs113640313

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: HLA-DRB6:ENST00000411500.1:n.852-3C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SPLICE_REGION_VARIANT SNV 6-32521183-A-G [0/1] rs112119119

Variant score: 0.800

Transcripts:: HLA-DRB6:ENST00000411500.1:n.852-7T>C:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

KIR2DL4

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 19-55317527-GGA-G [0/1] rs2060503380

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KIR2DL4:ENST00000345540.5:c.484_485del:p.(Glu162Serfs*3); KIR2DL4:ENST00000346587.4:c.199_200del:p.(Glu67Serfs*3); KIR2DL4:ENST00000357494.4:c.484_485del:p.(Glu162Serfs*3); KIR2DL4:ENST00000359085.4:c.484_485del:p.(Glu162Serfs*3); KIR2DL4:ENST00000396284.2:c.478_479del:p.(Glu160Serfs*3); KIR2DL4:ENST00000396293.1:c.199_200del:p.(Glu67Serfs*3); KIR2DL4:ENST00000402254.2:c.35-11461_35-11460del:p.(=); KIR2DL4:ENST00000538269.1:c.35-11461_35-11460del:p.(=); KIR2DL4:ENST00000541392.1:c.35-11461_35-11460del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 19-55317527-GGA-G [0/1] rs2060503380

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KIR2DL4:ENST00000345540.5:c.484_485del:p.(Glu162Serfs*3); KIR2DL4:ENST00000346587.4:c.199_200del:p.(Glu67Serfs*3); KIR2DL4:ENST00000357494.4:c.484_485del:p.(Glu162Serfs*3); KIR2DL4:ENST00000359085.4:c.484_485del:p.(Glu162Serfs*3); KIR2DL4:ENST00000396284.2:c.478_479del:p.(Glu160Serfs*3); KIR2DL4:ENST00000396293.1:c.199_200del:p.(Glu67Serfs*3); KIR2DL4:ENST00000402254.2:c.35-11461_35-11460del:p.(=); KIR2DL4:ENST00000538269.1:c.35-11461_35-11460del:p.(=); KIR2DL4:ENST00000541392.1:c.35-11461_35-11460del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_ELONGATION INS 19-55317530-A-AGG [0/1] rs2060504296

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KIR2DL4:ENST00000345540.5:c.487_488insGG:p.(Ala163Glyfs*78); KIR2DL4:ENST00000357494.4:c.487_488insGG:p.(Ala163Glyfs*61); KIR2DL4:ENST00000396293.1:c.202_203insGG:p.(Ala68Glyfs*61); KIR2DL4:ENST00000346587.4:c.202_203insGG:p.(Ala68Glyfs*78); KIR2DL4:ENST00000359085.4:c.487_488insGG:p.(Ala163Glyfs*83); KIR2DL4:ENST00000396284.2:c.481_482insGG:p.(Ala161Glyfs*83); KIR2DL4:ENST00000402254.2:c.35-11459_35-11458insGG:p.(=); KIR2DL4:ENST00000538269.1:c.35-11459_35-11458insGG:p.(=); KIR2DL4:ENST00000541392.1:c.35-11459_35-11458insGG:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

FRAMESHIFT_TRUNCATION DEL 19-55320305-TGG-T [0/1]

Variant score: 1.000

Transcripts:: KIR2DL4:ENST00000345540.5:c.674_675del:p.(Trp225Serfs*5); KIR2DL4:ENST00000346587.4:c.389_390del:p.(Trp130Serfs*5); KIR2DL4:ENST00000359085.4:c.674_675del:p.(Trp225Serfs*5); KIR2DL4:ENST00000396284.2:c.668_669del:p.(Trp223Serfs*5); KIR2DL4:ENST00000402254.2:c.35-8683_35-8682del:p.(=); KIR2DL4:ENST00000538269.1:c.35-8683_35-8682del:p.(=); KIR2DL4:ENST00000541392.1:c.35-8683_35-8682del:p.(=); KIR2DL4:ENST00000357494.4:c.655+2607_655+2608del:p.(=); KIR2DL4:ENST00000396293.1:c.370+2607_370+2608del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_ELONGATION INS 19-55320308-C-CAT [0/1]

Variant score: 1.000

Transcripts:: KIR2DL4:ENST00000345540.5:c.676_677insAT:p.(Pro226Hisfs*15); KIR2DL4:ENST00000346587.4:c.391_392insAT:p.(Pro131Hisfs*15); KIR2DL4:ENST00000359085.4:c.676_677insAT:p.(Pro226Hisfs*20); KIR2DL4:ENST00000396284.2:c.670_671insAT:p.(Pro224Hisfs*20); KIR2DL4:ENST00000402254.2:c.35-8681_35-8680insAT:p.(=); KIR2DL4:ENST00000538269.1:c.35-8681_35-8680insAT:p.(=); KIR2DL4:ENST00000541392.1:c.35-8681_35-8680insAT:p.(=); KIR2DL4:ENST00000357494.4:c.655+2609_655+2610insAT:p.(=); KIR2DL4:ENST00000396293.1:c.370+2609_370+2610insAT:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_VARIANT INS 19-55324674-C-CA [1/1] rs11371265

Variant score: 1.000

Transcripts:: KIR2DL4:ENST00000359085.4:c.811dup:p.(Met271Asnfs*108); KIR2DL4:ENST00000396284.2:c.804dup:p.(Val269Serfs*43); KIR2DL4:ENST00000402254.2:c.35-4315_35-4314insA:p.(=); KIR2DL4:ENST00000538269.1:c.35-4315_35-4314insA:p.(=); KIR2DL4:ENST00000541392.1:c.35-4315_35-4314insA:p.(=); KIR2DL4:ENST00000345540.5:c.707-471_707-470insA:p.(=); KIR2DL4:ENST00000346587.4:c.422-471_422-470insA:p.(=); KIR2DL4:ENST00000357494.4:c.656-471_656-470insA:p.(=); KIR2DL4:ENST00000396293.1:c.371-471_371-470insA:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317489-C-A [0/1] rs796139593

Variant score: 0.985

Transcripts:: KIR2DL4:ENST00000345540.5:c.445C>A:p.(Gln149Lys); KIR2DL4:ENST00000346587.4:c.160C>A:p.(Gln54Lys); KIR2DL4:ENST00000357494.4:c.445C>A:p.(Gln149Lys); KIR2DL4:ENST00000359085.4:c.445C>A:p.(Gln149Lys); KIR2DL4:ENST00000396284.2:c.439C>A:p.(Gln147Lys); KIR2DL4:ENST00000396293.1:c.160C>A:p.(Gln54Lys); KIR2DL4:ENST00000402254.2:c.35-11500C>A:p.(=); KIR2DL4:ENST00000538269.1:c.35-11500C>A:p.(=); KIR2DL4:ENST00000541392.1:c.35-11500C>A:p.(=)

Pathogenicity Data:: Best Score: 0.985; Polyphen2: 0.060 (B); SIFT: 0.015 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317412-A-T [0/1] rs548305067

Variant score: 0.917

Transcripts:: KIR2DL4:ENST00000345540.5:c.368A>T:p.(Tyr123Phe); KIR2DL4:ENST00000346587.4:c.83A>T:p.(Tyr28Phe); KIR2DL4:ENST00000357494.4:c.368A>T:p.(Tyr123Phe); KIR2DL4:ENST00000359085.4:c.368A>T:p.(Tyr123Phe); KIR2DL4:ENST00000396284.2:c.362A>T:p.(Tyr121Phe); KIR2DL4:ENST00000396293.1:c.83A>T:p.(Tyr28Phe); KIR2DL4:ENST00000402254.2:c.35-11577A>T:p.(=); KIR2DL4:ENST00000538269.1:c.35-11577A>T:p.(=); KIR2DL4:ENST00000541392.1:c.35-11577A>T:p.(=)

Pathogenicity Data:: Best Score: 0.917; Polyphen2: 0.168 (B); SIFT: 0.083 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317541-T-C [0/1] rs112694450

Variant score: 0.887

Transcripts:: KIR2DL4:ENST00000345540.5:c.497T>C:p.(Leu166Pro); KIR2DL4:ENST00000346587.4:c.212T>C:p.(Leu71Pro); KIR2DL4:ENST00000357494.4:c.497T>C:p.(Leu166Pro); KIR2DL4:ENST00000359085.4:c.497T>C:p.(Leu166Pro); KIR2DL4:ENST00000396284.2:c.491T>C:p.(Leu164Pro); KIR2DL4:ENST00000396293.1:c.212T>C:p.(Leu71Pro); KIR2DL4:ENST00000402254.2:c.35-11448T>C:p.(=); KIR2DL4:ENST00000538269.1:c.35-11448T>C:p.(=); KIR2DL4:ENST00000541392.1:c.35-11448T>C:p.(=)

Pathogenicity Data:: Best Score: 0.887; Polyphen2: 0.012 (B); SIFT: 0.113 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317415-A-G [0/1] rs796298317

Variant score: 0.878

Transcripts:: KIR2DL4:ENST00000345540.5:c.371A>G:p.(Glu124Gly); KIR2DL4:ENST00000346587.4:c.86A>G:p.(Glu29Gly); KIR2DL4:ENST00000357494.4:c.371A>G:p.(Glu124Gly); KIR2DL4:ENST00000359085.4:c.371A>G:p.(Glu124Gly); KIR2DL4:ENST00000396284.2:c.365A>G:p.(Glu122Gly); KIR2DL4:ENST00000396293.1:c.86A>G:p.(Glu29Gly); KIR2DL4:ENST00000402254.2:c.35-11574A>G:p.(=); KIR2DL4:ENST00000538269.1:c.35-11574A>G:p.(=); KIR2DL4:ENST00000541392.1:c.35-11574A>G:p.(=)

Pathogenicity Data:: Best Score: 0.878; Polyphen2: 0.006 (B); SIFT: 0.122 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55320293-C-T [0/1] rs1601176397

Variant score: 0.820

Transcripts:: KIR2DL4:ENST00000345540.5:c.661C>T:p.(Pro221Ser); KIR2DL4:ENST00000346587.4:c.376C>T:p.(Pro126Ser); KIR2DL4:ENST00000359085.4:c.661C>T:p.(Pro221Ser); KIR2DL4:ENST00000396284.2:c.655C>T:p.(Pro219Ser); KIR2DL4:ENST00000402254.2:c.35-8696C>T:p.(=); KIR2DL4:ENST00000538269.1:c.35-8696C>T:p.(=); KIR2DL4:ENST00000541392.1:c.35-8696C>T:p.(=); KIR2DL4:ENST00000357494.4:c.655+2594C>T:p.(=); KIR2DL4:ENST00000396293.1:c.370+2594C>T:p.(=)

Pathogenicity Data:: Best Score: 0.82; Polyphen2: 0.003 (B); SIFT: 0.180 (T)

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 19-55320341-A-G [0/1] rs1601177489

Variant score: 0.800

Transcripts:: KIR2DL4:ENST00000345540.5:c.706+3A>G:p.?; KIR2DL4:ENST00000346587.4:c.421+3A>G:p.?; KIR2DL4:ENST00000359085.4:c.706+3A>G:p.?; KIR2DL4:ENST00000396284.2:c.700+3A>G:p.?; KIR2DL4:ENST00000402254.2:c.35-8648A>G:p.(=); KIR2DL4:ENST00000538269.1:c.35-8648A>G:p.(=); KIR2DL4:ENST00000541392.1:c.35-8648A>G:p.(=); KIR2DL4:ENST00000357494.4:c.655+2642A>G:p.(=); KIR2DL4:ENST00000396293.1:c.370+2642A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT DEL 19-55320344-TG-T [0/1] rs1569377122

Variant score: 0.800

Transcripts:: KIR2DL4:ENST00000345540.5:c.706+7del:p.?; KIR2DL4:ENST00000346587.4:c.421+7del:p.?; KIR2DL4:ENST00000359085.4:c.706+7del:p.?; KIR2DL4:ENST00000396284.2:c.700+7del:p.?; KIR2DL4:ENST00000402254.2:c.35-8644del:p.(=); KIR2DL4:ENST00000538269.1:c.35-8644del:p.(=); KIR2DL4:ENST00000541392.1:c.35-8644del:p.(=); KIR2DL4:ENST00000357494.4:c.655+2646del:p.(=); KIR2DL4:ENST00000396293.1:c.370+2646del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317429-A-T [0/1] rs748394765

Variant score: 0.600

Transcripts:: KIR2DL4:ENST00000345540.5:c.385A>T:p.(Thr129Ser); KIR2DL4:ENST00000346587.4:c.100A>T:p.(Thr34Ser); KIR2DL4:ENST00000357494.4:c.385A>T:p.(Thr129Ser); KIR2DL4:ENST00000359085.4:c.385A>T:p.(Thr129Ser); KIR2DL4:ENST00000396284.2:c.379A>T:p.(Thr127Ser); KIR2DL4:ENST00000396293.1:c.100A>T:p.(Thr34Ser); KIR2DL4:ENST00000402254.2:c.35-11560A>T:p.(=); KIR2DL4:ENST00000538269.1:c.35-11560A>T:p.(=); KIR2DL4:ENST00000541392.1:c.35-11560A>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55317428-T-C [0/1] rs778634886

Variant score: 0.100

Transcripts:: KIR2DL4:ENST00000345540.5:c.384T>C:p.(=); KIR2DL4:ENST00000346587.4:c.99T>C:p.(=); KIR2DL4:ENST00000357494.4:c.384T>C:p.(=); KIR2DL4:ENST00000359085.4:c.384T>C:p.(=); KIR2DL4:ENST00000396284.2:c.378T>C:p.(=); KIR2DL4:ENST00000396293.1:c.99T>C:p.(=); KIR2DL4:ENST00000402254.2:c.35-11561T>C:p.(=); KIR2DL4:ENST00000538269.1:c.35-11561T>C:p.(=); KIR2DL4:ENST00000541392.1:c.35-11561T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55317497-C-A [0/1] rs113248048

Variant score: 0.100

Transcripts:: KIR2DL4:ENST00000345540.5:c.453C>A:p.(=); KIR2DL4:ENST00000346587.4:c.168C>A:p.(=); KIR2DL4:ENST00000357494.4:c.453C>A:p.(=); KIR2DL4:ENST00000359085.4:c.453C>A:p.(=); KIR2DL4:ENST00000396284.2:c.447C>A:p.(=); KIR2DL4:ENST00000396293.1:c.168C>A:p.(=); KIR2DL4:ENST00000402254.2:c.35-11492C>A:p.(=); KIR2DL4:ENST00000538269.1:c.35-11492C>A:p.(=); KIR2DL4:ENST00000541392.1:c.35-11492C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55317584-C-T [0/1] rs954023147

Variant score: 0.100

Transcripts:: KIR2DL4:ENST00000345540.5:c.540C>T:p.(=); KIR2DL4:ENST00000346587.4:c.255C>T:p.(=); KIR2DL4:ENST00000357494.4:c.540C>T:p.(=); KIR2DL4:ENST00000359085.4:c.540C>T:p.(=); KIR2DL4:ENST00000396284.2:c.534C>T:p.(=); KIR2DL4:ENST00000396293.1:c.255C>T:p.(=); KIR2DL4:ENST00000402254.2:c.35-11405C>T:p.(=); KIR2DL4:ENST00000538269.1:c.35-11405C>T:p.(=); KIR2DL4:ENST00000541392.1:c.35-11405C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55320298-T-A [0/1] rs1400414490

Variant score: 0.100

Transcripts:: KIR2DL4:ENST00000345540.5:c.666T>A:p.(=); KIR2DL4:ENST00000346587.4:c.381T>A:p.(=); KIR2DL4:ENST00000359085.4:c.666T>A:p.(=); KIR2DL4:ENST00000396284.2:c.660T>A:p.(=); KIR2DL4:ENST00000402254.2:c.35-8691T>A:p.(=); KIR2DL4:ENST00000538269.1:c.35-8691T>A:p.(=); KIR2DL4:ENST00000541392.1:c.35-8691T>A:p.(=); KIR2DL4:ENST00000357494.4:c.655+2599T>A:p.(=); KIR2DL4:ENST00000396293.1:c.370+2599T>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55317425-G-A [0/1] rs201419800

Variant score: 0.099

Transcripts:: KIR2DL4:ENST00000345540.5:c.381G>A:p.(=); KIR2DL4:ENST00000346587.4:c.96G>A:p.(=); KIR2DL4:ENST00000357494.4:c.381G>A:p.(=); KIR2DL4:ENST00000359085.4:c.381G>A:p.(=); KIR2DL4:ENST00000396284.2:c.375G>A:p.(=); KIR2DL4:ENST00000396293.1:c.96G>A:p.(=); KIR2DL4:ENST00000402254.2:c.35-11564G>A:p.(=); KIR2DL4:ENST00000538269.1:c.35-11564G>A:p.(=); KIR2DL4:ENST00000541392.1:c.35-11564G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AMR: 0.0693%; ExAC NFE: 0.0895%; gnomAD_E_AMR: 0.0204%; gnomAD_E_NFE: 0.0097%; gnomAD_G_NFE: 0.0217%

MISSENSE_VARIANT SNV 19-55317506-C-G [0/1] rs112266387

Variant score: 0.060

Transcripts:: KIR2DL4:ENST00000345540.5:c.462C>G:p.(Ile154Met); KIR2DL4:ENST00000346587.4:c.177C>G:p.(Ile59Met); KIR2DL4:ENST00000357494.4:c.462C>G:p.(Ile154Met); KIR2DL4:ENST00000359085.4:c.462C>G:p.(Ile154Met); KIR2DL4:ENST00000396284.2:c.456C>G:p.(Ile152Met); KIR2DL4:ENST00000396293.1:c.177C>G:p.(Ile59Met); KIR2DL4:ENST00000402254.2:c.35-11483C>G:p.(=); KIR2DL4:ENST00000538269.1:c.35-11483C>G:p.(=); KIR2DL4:ENST00000541392.1:c.35-11483C>G:p.(=)

Pathogenicity Data:: Best Score: 0.06; Polyphen2: 0.060 (B)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317490-A-G [0/1] rs746343340

Variant score: 0.020

Transcripts:: KIR2DL4:ENST00000345540.5:c.446A>G:p.(Gln149Arg); KIR2DL4:ENST00000346587.4:c.161A>G:p.(Gln54Arg); KIR2DL4:ENST00000357494.4:c.446A>G:p.(Gln149Arg); KIR2DL4:ENST00000359085.4:c.446A>G:p.(Gln149Arg); KIR2DL4:ENST00000396284.2:c.440A>G:p.(Gln147Arg); KIR2DL4:ENST00000396293.1:c.161A>G:p.(Gln54Arg); KIR2DL4:ENST00000402254.2:c.35-11499A>G:p.(=); KIR2DL4:ENST00000538269.1:c.35-11499A>G:p.(=); KIR2DL4:ENST00000541392.1:c.35-11499A>G:p.(=)

Pathogenicity Data:: Best Score: 0.02; Polyphen2: 0.020 (B)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55320330-T-C [0/1] rs1465997687

Variant score: 0.002

Transcripts:: KIR2DL4:ENST00000345540.5:c.698T>C:p.(Phe233Ser); KIR2DL4:ENST00000346587.4:c.413T>C:p.(Phe138Ser); KIR2DL4:ENST00000359085.4:c.698T>C:p.(Phe233Ser); KIR2DL4:ENST00000396284.2:c.692T>C:p.(Phe231Ser); KIR2DL4:ENST00000402254.2:c.35-8659T>C:p.(=); KIR2DL4:ENST00000538269.1:c.35-8659T>C:p.(=); KIR2DL4:ENST00000541392.1:c.35-8659T>C:p.(=); KIR2DL4:ENST00000357494.4:c.655+2631T>C:p.(=); KIR2DL4:ENST00000396293.1:c.370+2631T>C:p.(=)

Pathogenicity Data:: Best Score: 0.002; Polyphen2: 0.002 (B)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317564-A-G [0/1] rs200435373

Variant score: 0.001

Transcripts:: KIR2DL4:ENST00000345540.5:c.520A>G:p.(Ile174Val); KIR2DL4:ENST00000346587.4:c.235A>G:p.(Ile79Val); KIR2DL4:ENST00000357494.4:c.520A>G:p.(Ile174Val); KIR2DL4:ENST00000359085.4:c.520A>G:p.(Ile174Val); KIR2DL4:ENST00000396284.2:c.514A>G:p.(Ile172Val); KIR2DL4:ENST00000396293.1:c.235A>G:p.(Ile79Val); KIR2DL4:ENST00000402254.2:c.35-11425A>G:p.(=); KIR2DL4:ENST00000538269.1:c.35-11425A>G:p.(=); KIR2DL4:ENST00000541392.1:c.35-11425A>G:p.(=)

Pathogenicity Data:: Best Score: 0.001; Polyphen2: 0.001 (B)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55317436-G-A [0/1] rs202246882

Variant score: 0.001

Transcripts:: KIR2DL4:ENST00000345540.5:c.392G>A:p.(Arg131Gln); KIR2DL4:ENST00000346587.4:c.107G>A:p.(Arg36Gln); KIR2DL4:ENST00000357494.4:c.392G>A:p.(Arg131Gln); KIR2DL4:ENST00000359085.4:c.392G>A:p.(Arg131Gln); KIR2DL4:ENST00000396284.2:c.386G>A:p.(Arg129Gln); KIR2DL4:ENST00000396293.1:c.107G>A:p.(Arg36Gln); KIR2DL4:ENST00000402254.2:c.35-11553G>A:p.(=); KIR2DL4:ENST00000538269.1:c.35-11553G>A:p.(=); KIR2DL4:ENST00000541392.1:c.35-11553G>A:p.(=)

Pathogenicity Data:: Best Score: 0.001; Polyphen2: 0.001 (B)

Frequency Data:: gnomAD_E_AMR: 0.0235%; gnomAD_E_NFE: 0.0071%; gnomAD_E_SAS: 0.0596%; gnomAD_G_AFR: 0.0379%

KIR2DS4

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 19-55358654-T-TGC [0/1] rs2063706973

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KIR2DS4:ENST00000339924.8:c.709_710insGC:p.(Tyr237Cysfs*51); KIR2DS4:ENST00000402254.2:c.1001-18606_1001-18605insGC:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 19-55358654-T-TGC [0/1] rs2063706973

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KIR2DS4:ENST00000339924.8:c.709_710insGC:p.(Tyr237Cysfs*51); KIR2DS4:ENST00000402254.2:c.1001-18606_1001-18605insGC:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_TRUNCATION DEL 19-55358657-ATG-A [0/1] rs2063708159

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: KIR2DS4:ENST00000339924.8:c.714_715del:p.(Met238Ilefs*60); KIR2DS4:ENST00000402254.2:c.1001-18602_1001-18601del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

FRAMESHIFT_VARIANT INS 19-55358736-C-CA [0/1] rs145114829

Variant score: 1.000

Transcripts:: KIR2DS4:ENST00000339924.8:c.799dup:p.(Met267Asnfs*32); KIR2DS4:ENST00000402254.2:c.1001-18524_1001-18523insA:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_TRUNCATION DEL 19-55359243-AAC-A [0/1] rs138992022

Variant score: 1.000

Transcripts:: KIR2DS4:ENST00000339924.8:c.838_839del:p.(Gln280Valfs*18); KIR2DS4:ENST00000402254.2:c.1001-18016_1001-18015del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55358645-C-T [0/1] rs144486451

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.700C>T:p.(Pro234Ser); KIR2DS4:ENST00000402254.2:c.1001-18615C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55358658-T-C [0/1] rs72489166

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.713T>C:p.(Met238Thr); KIR2DS4:ENST00000402254.2:c.1001-18602T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55358686-A-C [0/1] rs112697729

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.741A>C:p.(Lys247Asn); KIR2DS4:ENST00000402254.2:c.1001-18574A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55359210-T-A [0/1] rs78348350

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.803T>A:p.(Leu268Gln); KIR2DS4:ENST00000402254.2:c.1001-18050T>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55359227-A-G [0/1] rs78647568

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.820A>G:p.(Ser274Gly); KIR2DS4:ENST00000402254.2:c.1001-18033A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55359234-A-G [0/1] rs113921547

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.827A>G:p.(Gln276Arg); KIR2DS4:ENST00000402254.2:c.1001-18026A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55359255-C-G [0/1] rs1130471

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.848C>G:p.(Ala283Gly); KIR2DS4:ENST00000402254.2:c.1001-18005C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55359371-A-G [0/1] rs112305589

Variant score: 0.600

Transcripts:: KIR2DS4:ENST00000339924.8:c.866A>G:p.(Lys289Arg); KIR2DS4:ENST00000402254.2:c.1001-17889A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55344239-T-G [0/1] rs1130476

Variant score: 0.599

Transcripts:: KIR2DS4:ENST00000339924.8:c.20T>G:p.(Ile7Ser); KIR2DS4:ENST00000402254.2:c.1000+7706T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_EAS: 0.0122%

MISSENSE_VARIANT SNV 19-55349320-G-C [0/1] rs1130494

Variant score: 0.311

Transcripts:: KIR2DS4:ENST00000339924.8:c.360G>C:p.(Met120Ile); KIR2DS4:ENST00000402254.2:c.1000+12787G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 1.5180%; TOPMed: 1.5180%; ExAC AFR: 0.0098%; ExAC EAS: 0.0120%; gnomAD_E_EAS: 0.0181%

MISSENSE_VARIANT SNV 19-55349328-T-C [0/1] rs201518955

Variant score: 0.311

Transcripts:: KIR2DS4:ENST00000339924.8:c.368T>C:p.(Ile123Thr); KIR2DS4:ENST00000402254.2:c.1000+12795T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 1.5180%; TOPMed: 1.5180%; ExAC EAS: 0.0120%; gnomAD_E_EAS: 0.0182%; gnomAD_E_NFE: 0.0019%

MISSENSE_VARIANT SNV 19-55346565-G-T [0/1] rs1130478

Variant score: 0.106

Transcripts:: KIR2DS4:ENST00000339924.8:c.66G>T:p.(Gln22His); KIR2DS4:ENST00000402254.2:c.1000+10032G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 1.9570%; TOPMed: 1.9570%; ExAC AFR: 0.0784%; ExAC AMR: 0.0366%; ExAC EAS: 0.0361%; ExAC FIN: 0.1796%; ExAC NFE: 0.1766%; ExAC OTH: 0.3529%; ExAC SAS: 0.0832%; gnomAD_E_AFR: 0.0133%; gnomAD_E_AMR: 0.0160%; gnomAD_E_EAS: 0.0182%; gnomAD_E_FIN: 0.0578%; gnomAD_E_NFE: 0.0972%; gnomAD_E_OTH: 0.0195%; gnomAD_E_SAS: 0.0297%

SYNONYMOUS_VARIANT SNV 19-55358734-G-A [0/1] rs757178914

Variant score: 0.100

Transcripts:: KIR2DS4:ENST00000339924.8:c.789G>A:p.(=); KIR2DS4:ENST00000402254.2:c.1001-18526G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 19-55359211-G-T [0/1] rs80015348

Variant score: 0.100

Transcripts:: KIR2DS4:ENST00000339924.8:c.804G>T:p.(=); KIR2DS4:ENST00000402254.2:c.1001-18049G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

LSP1

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-1887763-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: LSP1:ENST00000381775.1:c.59C>T:p.(Pro20Leu); LSP1:ENST00000311604.3:c.53+13336C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; SIFT: 0.000 (D)

Frequency Data:: No frequency data

MUC19

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT INS 12-40859390-T-TGACCA [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: MUC19:ENST00000454784.4:c.3884-1_3884insACCAG:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

RAD17

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-68677842-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: RAD17:ENST00000282891.6:c.208C>T:p.(Pro70Ser); RAD17:ENST00000305138.4:c.466C>T:p.(Pro156Ser); RAD17:ENST00000345306.6:c.466C>T:p.(Pro156Ser); RAD17:ENST00000354312.3:c.466C>T:p.(Pro156Ser); RAD17:ENST00000354868.5:c.466C>T:p.(Pro156Ser); RAD17:ENST00000361732.2:c.466C>T:p.(Pro156Ser); RAD17:ENST00000380774.3:c.499C>T:p.(Pro167Ser); RAD17:ENST00000509734.1:c.499C>T:p.(Pro167Ser); RAD17:ENST00000358030.2:c.-30C>T:p.(=); RAD17:ENST00000521422.1:c.-30C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.003 (B); Mutation Taster: 1.000 (P); SIFT: 0.176 (T)

Frequency Data:: No frequency data

SP140L

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-231264881-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: SP140L:ENST00000243810.6:c.1237G>T:p.(Gly413Trp); SP140L:ENST00000396563.4:c.1132G>T:p.(Gly378Trp); SP140L:ENST00000415673.2:c.1237G>T:p.(Gly413Trp); SP140L:ENST00000444636.1:c.1237G>T:p.(Gly413Trp)

Pathogenicity Data:: Best Score: 1.0; SIFT: 0.000 (D)

Frequency Data:: No frequency data

ZNF285CP

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 2-133066897-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZNF285CP:ENST00000424130.2:n.15+1G>T:; ZNF285CP:ENST00000438300.1:n.15+1G>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.900

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 2-133066897-G-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZNF285CP:ENST00000424130.2:n.15+1G>T:; ZNF285CP:ENST00000438300.1:n.15+1G>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 2-133074683-T-C [0/1] rs7355726

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: ZNF285CP:ENST00000424130.2:n.144T>C:; ZNF285CP:ENST00000438300.1:n.148T>C:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

ZNF717

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 3-75786041-AG-A [0/1] rs150497643

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZNF717:ENST00000400845.3:c.2711del:p.(Ser904Phefs*?); ZNF717:ENST00000422325.1:c.2732del:p.(Ser911Phefs*?); ZNF717:ENST00000478296.1:c.2582del:p.(Ser861Phefs*31); ZNF717:ENST00000477374.1:c.277+4385del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 3-75786041-AG-A [0/1] rs150497643

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZNF717:ENST00000400845.3:c.2711del:p.(Ser904Phefs*?); ZNF717:ENST00000422325.1:c.2732del:p.(Ser911Phefs*?); ZNF717:ENST00000478296.1:c.2582del:p.(Ser861Phefs*31); ZNF717:ENST00000477374.1:c.277+4385del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786243-C-T [0/1] rs139633377

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ZNF717:ENST00000400845.3:c.2510G>A:p.(Cys837Tyr); ZNF717:ENST00000422325.1:c.2531G>A:p.(Cys844Tyr); ZNF717:ENST00000478296.1:c.2381G>A:p.(Cys794Tyr); ZNF717:ENST00000477374.1:c.277+4184G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

Other passed variants:

STOP_GAINED SNV 3-75786256-T-A [0/1] rs113251431

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2497A>T:p.(Lys833*); ZNF717:ENST00000422325.1:c.2518A>T:p.(Lys840*); ZNF717:ENST00000478296.1:c.2368A>T:p.(Lys790*); ZNF717:ENST00000477374.1:c.277+4171A>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786278-A-C [0/1] rs79811623

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2475T>G:p.(His825Gln); ZNF717:ENST00000422325.1:c.2496T>G:p.(His832Gln); ZNF717:ENST00000478296.1:c.2346T>G:p.(His782Gln); ZNF717:ENST00000477374.1:c.277+4149T>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786337-G-A [0/1] rs78596620

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2416C>T:p.(Pro806Ser); ZNF717:ENST00000422325.1:c.2437C>T:p.(Pro813Ser); ZNF717:ENST00000478296.1:c.2287C>T:p.(Pro763Ser); ZNF717:ENST00000477374.1:c.277+4090C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.076 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786354-G-A [0/1] rs77045598

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2399C>T:p.(Thr800Ile); ZNF717:ENST00000422325.1:c.2420C>T:p.(Thr807Ile); ZNF717:ENST00000478296.1:c.2270C>T:p.(Thr757Ile); ZNF717:ENST00000477374.1:c.277+4073C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786417-T-C [0/1] rs77452946

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2336A>G:p.(Tyr779Cys); ZNF717:ENST00000422325.1:c.2357A>G:p.(Tyr786Cys); ZNF717:ENST00000478296.1:c.2207A>G:p.(Tyr736Cys); ZNF717:ENST00000477374.1:c.277+4010A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.001 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786518-A-C [0/1] rs113078821

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2235T>G:p.(His745Gln); ZNF717:ENST00000422325.1:c.2256T>G:p.(His752Gln); ZNF717:ENST00000478296.1:c.2106T>G:p.(His702Gln); ZNF717:ENST00000477374.1:c.277+3909T>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786607-C-T [0/1] rs113494751

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2146G>A:p.(Val716Ile); ZNF717:ENST00000422325.1:c.2167G>A:p.(Val723Ile); ZNF717:ENST00000478296.1:c.2017G>A:p.(Val673Ile); ZNF717:ENST00000477374.1:c.277+3820G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.135 (T)

Frequency Data:: No frequency data

STOP_GAINED SNV 3-75786610-T-A [0/1] rs80021495

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2143A>T:p.(Lys715*); ZNF717:ENST00000422325.1:c.2164A>T:p.(Lys722*); ZNF717:ENST00000478296.1:c.2014A>T:p.(Lys672*); ZNF717:ENST00000477374.1:c.277+3817A>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786670-G-A [0/1] rs80089603

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2083C>T:p.(Pro695Ser); ZNF717:ENST00000422325.1:c.2104C>T:p.(Pro702Ser); ZNF717:ENST00000478296.1:c.1954C>T:p.(Pro652Ser); ZNF717:ENST00000477374.1:c.277+3757C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.014 (D)

Frequency Data:: No frequency data

FRAMESHIFT_TRUNCATION DEL 3-75786743-TA-T [0/1]

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2009del:p.(Val670Glufs*2); ZNF717:ENST00000422325.1:c.2030del:p.(Val677Glufs*2); ZNF717:ENST00000478296.1:c.1880del:p.(Val627Glufs*2); ZNF717:ENST00000477374.1:c.277+3683del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786754-G-T [0/1] rs77394685

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1999C>A:p.(Arg667Ser); ZNF717:ENST00000422325.1:c.2020C>A:p.(Arg674Ser); ZNF717:ENST00000478296.1:c.1870C>A:p.(Arg624Ser); ZNF717:ENST00000477374.1:c.277+3673C>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.056 (D)

Frequency Data:: No frequency data

FRAMESHIFT_VARIANT INS 3-75786764-C-CT [0/1] rs139062880

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1988_1989insA:p.(Lys665Glufs*79); ZNF717:ENST00000422325.1:c.2009_2010insA:p.(Lys672Glufs*79); ZNF717:ENST00000478296.1:c.1859_1860insA:p.(Lys622Glufs*79); ZNF717:ENST00000477374.1:c.277+3662_277+3663insA:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786773-T-A [0/1] rs76175438

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1980A>T:p.(Arg660Ser); ZNF717:ENST00000422325.1:c.2001A>T:p.(Arg667Ser); ZNF717:ENST00000478296.1:c.1851A>T:p.(Arg617Ser); ZNF717:ENST00000477374.1:c.277+3654A>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.020 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV 3-75786827-A-T [0/1] rs79635065

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1926T>A:p.(Cys642*); ZNF717:ENST00000422325.1:c.1947T>A:p.(Cys649*); ZNF717:ENST00000478296.1:c.1797T>A:p.(Cys599*); ZNF717:ENST00000477374.1:c.277+3600T>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786892-A-C [0/1] rs76826286

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1861T>G:p.(Phe621Val); ZNF717:ENST00000422325.1:c.1882T>G:p.(Phe628Val); ZNF717:ENST00000478296.1:c.1732T>G:p.(Phe578Val); ZNF717:ENST00000477374.1:c.277+3535T>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV 3-75786916-C-A [0/1] rs78906544

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1837G>T:p.(Glu613*); ZNF717:ENST00000422325.1:c.1858G>T:p.(Glu620*); ZNF717:ENST00000478296.1:c.1708G>T:p.(Glu570*); ZNF717:ENST00000477374.1:c.277+3511G>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786919-A-T [0/1] rs77101176

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1834T>A:p.(Tyr612Asn); ZNF717:ENST00000422325.1:c.1855T>A:p.(Tyr619Asn); ZNF717:ENST00000478296.1:c.1705T>A:p.(Tyr569Asn); ZNF717:ENST00000477374.1:c.277+3508T>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.005 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787015-C-T [0/1] rs76263679

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1738G>A:p.(Gly580Ser); ZNF717:ENST00000422325.1:c.1759G>A:p.(Gly587Ser); ZNF717:ENST00000478296.1:c.1609G>A:p.(Gly537Ser); ZNF717:ENST00000477374.1:c.277+3412G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.006 (D)

Frequency Data:: No frequency data

FRAMESHIFT_ELONGATION INS 3-75787042-G-GAAAT [0/1] rs369928577

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1710_1711insATTT:p.(Leu571Ilefs*16); ZNF717:ENST00000422325.1:c.1731_1732insATTT:p.(Leu578Ilefs*16); ZNF717:ENST00000478296.1:c.1581_1582insATTT:p.(Leu528Ilefs*16); ZNF717:ENST00000477374.1:c.277+3384_277+3385insATTT:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

STOP_GAINED INS 3-75787044-A-ACTT [0/1] rs373780316

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1708_1709insAAG:p.(Phe570*); ZNF717:ENST00000422325.1:c.1729_1730insAAG:p.(Phe577*); ZNF717:ENST00000478296.1:c.1579_1580insAAG:p.(Phe527*); ZNF717:ENST00000477374.1:c.277+3382_277+3383insAAG:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_ELONGATION INS 3-75787047-G-GACTTATA [0/1] rs796859243

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1705_1706insTATAAGT:p.(Ser569Leufs*2); ZNF717:ENST00000422325.1:c.1726_1727insTATAAGT:p.(Ser576Leufs*2); ZNF717:ENST00000478296.1:c.1576_1577insTATAAGT:p.(Ser526Leufs*2); ZNF717:ENST00000477374.1:c.277+3379_277+3380insTATAAGT:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787081-A-T [0/1] rs77378861

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1672T>A:p.(Cys558Ser); ZNF717:ENST00000422325.1:c.1693T>A:p.(Cys565Ser); ZNF717:ENST00000478296.1:c.1543T>A:p.(Cys515Ser); ZNF717:ENST00000477374.1:c.277+3346T>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787116-T-G [0/1] rs77490669

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1637A>C:p.(His546Pro); ZNF717:ENST00000422325.1:c.1658A>C:p.(His553Pro); ZNF717:ENST00000478296.1:c.1508A>C:p.(His503Pro); ZNF717:ENST00000477374.1:c.277+3311A>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.003 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV 3-75787127-G-T [0/1] rs74740396

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1626C>A:p.(Tyr542*); ZNF717:ENST00000422325.1:c.1647C>A:p.(Tyr549*); ZNF717:ENST00000478296.1:c.1497C>A:p.(Tyr499*); ZNF717:ENST00000477374.1:c.277+3300C>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787228-A-C [0/1] rs78763958

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1525T>G:p.(Phe509Val); ZNF717:ENST00000422325.1:c.1546T>G:p.(Phe516Val); ZNF717:ENST00000478296.1:c.1396T>G:p.(Phe466Val); ZNF717:ENST00000477374.1:c.277+3199T>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787240-A-G [0/1] rs76111663

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1513T>C:p.(Cys505Arg); ZNF717:ENST00000422325.1:c.1534T>C:p.(Cys512Arg); ZNF717:ENST00000478296.1:c.1384T>C:p.(Cys462Arg); ZNF717:ENST00000477374.1:c.277+3187T>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787264-C-T [0/1] rs80019510

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1489G>A:p.(Glu497Lys); ZNF717:ENST00000422325.1:c.1510G>A:p.(Glu504Lys); ZNF717:ENST00000478296.1:c.1360G>A:p.(Glu454Lys); ZNF717:ENST00000477374.1:c.277+3163G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.005 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787273-G-T [0/1] rs77118311

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1480C>A:p.(His494Asn); ZNF717:ENST00000422325.1:c.1501C>A:p.(His501Asn); ZNF717:ENST00000478296.1:c.1351C>A:p.(His451Asn); ZNF717:ENST00000477374.1:c.277+3154C>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787276-T-C [0/1] rs113168258

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1477A>G:p.(Thr493Ala); ZNF717:ENST00000422325.1:c.1498A>G:p.(Thr500Ala); ZNF717:ENST00000478296.1:c.1348A>G:p.(Thr450Ala); ZNF717:ENST00000477374.1:c.277+3151A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.029 (D)

Frequency Data:: No frequency data

FRAMESHIFT_TRUNCATION DEL 3-75787348-CCCCTG-C [0/1]

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1400_1404del:p.(Thr467Argfs*5); ZNF717:ENST00000422325.1:c.1421_1425del:p.(Thr474Argfs*5); ZNF717:ENST00000478296.1:c.1271_1275del:p.(Thr424Argfs*5); ZNF717:ENST00000477374.1:c.277+3074_277+3078del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787405-C-T [0/1] rs73843014

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1348G>A:p.(Gly450Arg); ZNF717:ENST00000422325.1:c.1369G>A:p.(Gly457Arg); ZNF717:ENST00000478296.1:c.1219G>A:p.(Gly407Arg); ZNF717:ENST00000477374.1:c.277+3022G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.023 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787516-C-G [0/1] rs79870536

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1237G>C:p.(Glu413Gln); ZNF717:ENST00000422325.1:c.1258G>C:p.(Glu420Gln); ZNF717:ENST00000478296.1:c.1108G>C:p.(Glu370Gln); ZNF717:ENST00000477374.1:c.277+2911G>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.021 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787519-C-A [0/1] rs76144260

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1234G>T:p.(Gly412Trp); ZNF717:ENST00000422325.1:c.1255G>T:p.(Gly419Trp); ZNF717:ENST00000478296.1:c.1105G>T:p.(Gly369Trp); ZNF717:ENST00000477374.1:c.277+2908G>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

FRAMESHIFT_TRUNCATION DEL 3-75787645-GAA-G [0/1] rs67579270

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1106_1107del:p.(Phe369Serfs*3); ZNF717:ENST00000422325.1:c.1127_1128del:p.(Phe376Serfs*3); ZNF717:ENST00000478296.1:c.977_978del:p.(Phe326Serfs*3); ZNF717:ENST00000477374.1:c.277+2780_277+2781del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787732-A-C [0/1] rs74776730

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1021T>G:p.(Phe341Val); ZNF717:ENST00000422325.1:c.1042T>G:p.(Phe348Val); ZNF717:ENST00000478296.1:c.892T>G:p.(Phe298Val); ZNF717:ENST00000477374.1:c.277+2695T>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787770-C-T [0/1] rs74873974

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.983G>A:p.(Gly328Glu); ZNF717:ENST00000422325.1:c.1004G>A:p.(Gly335Glu); ZNF717:ENST00000478296.1:c.854G>A:p.(Gly285Glu); ZNF717:ENST00000477374.1:c.277+2657G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.002 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV 3-75788028-G-C [0/1] rs77971486

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.725C>G:p.(Ser242*); ZNF717:ENST00000422325.1:c.746C>G:p.(Ser249*); ZNF717:ENST00000478296.1:c.596C>G:p.(Ser199*); ZNF717:ENST00000477374.1:c.277+2399C>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P)

Frequency Data:: No frequency data

FRAMESHIFT_VARIANT INS 3-75788150-A-AG [0/1] rs143871834

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.602dup:p.(Gln203Serfs*3); ZNF717:ENST00000422325.1:c.623dup:p.(Gln210Serfs*3); ZNF717:ENST00000478296.1:c.473dup:p.(Gln160Serfs*3); ZNF717:ENST00000477374.1:c.277+2276_277+2277insC:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FRAMESHIFT_VARIANT INS 3-75788403-G-GT [0/1] rs140509507

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.349dup:p.(Thr117Asnfs*6); ZNF717:ENST00000422325.1:c.370dup:p.(Thr124Asnfs*6); ZNF717:ENST00000478296.1:c.220dup:p.(Thr74Asnfs*6); ZNF717:ENST00000477374.1:c.277+2023_277+2024insA:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75790466-G-T [0/1] rs78571006

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.217C>A:p.(Pro73Thr); ZNF717:ENST00000422325.1:c.238C>A:p.(Pro80Thr); ZNF717:ENST00000477374.1:c.238C>A:p.(Pro80Thr); ZNF717:ENST00000478296.1:c.88C>A:p.(Pro30Thr)

Pathogenicity Data:: Best Score: 1.0; SIFT: 0.000 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786438-G-A [0/1] rs79994093

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.2315C>T:p.(Thr772Ile); ZNF717:ENST00000422325.1:c.2336C>T:p.(Thr779Ile); ZNF717:ENST00000478296.1:c.2186C>T:p.(Thr729Ile); ZNF717:ENST00000477374.1:c.277+3989C>T:p.(=)

Pathogenicity Data:: Best Score: 0.999999; Mutation Taster: 1.000 (P); SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786759-T-C [0/1] rs75759940

Variant score: 1.000

Transcripts:: ZNF717:ENST00000400845.3:c.1994A>G:p.(Lys665Arg); ZNF717:ENST00000422325.1:c.2015A>G:p.(Lys672Arg); ZNF717:ENST00000478296.1:c.1865A>G:p.(Lys622Arg); ZNF717:ENST00000477374.1:c.277+3668A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.027 (D)

Frequency Data:: gnomAD_E_NFE: 0.0020%

MISSENSE_VARIANT SNV 3-75786288-A-G [0/1] rs76707683

Variant score: 0.999

Transcripts:: ZNF717:ENST00000400845.3:c.2465T>C:p.(Leu822Pro); ZNF717:ENST00000422325.1:c.2486T>C:p.(Leu829Pro); ZNF717:ENST00000478296.1:c.2336T>C:p.(Leu779Pro); ZNF717:ENST00000477374.1:c.277+4139T>C:p.(=)

Pathogenicity Data:: Best Score: 0.999; SIFT: 0.001 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787317-T-A [0/1] rs148436228

Variant score: 0.999

Transcripts:: ZNF717:ENST00000400845.3:c.1436A>T:p.(Lys479Ile); ZNF717:ENST00000422325.1:c.1457A>T:p.(Lys486Ile); ZNF717:ENST00000478296.1:c.1307A>T:p.(Lys436Ile); ZNF717:ENST00000477374.1:c.277+3110A>T:p.(=)

Pathogenicity Data:: Best Score: 0.999; Mutation Taster: 0.864; SIFT: 0.001 (D)

Frequency Data:: No frequency data

FRAMESHIFT_ELONGATION INS 3-75786035-G-GA [0/1] rs149076283

Variant score: 0.999

Transcripts:: ZNF717:ENST00000478296.1:c.2588dup:p.(*865Leuext*19); ZNF717:ENST00000400845.3:c.2717dup:p.(Leu908Leufs*?); ZNF717:ENST00000422325.1:c.2738dup:p.(Leu915Leufs*?); ZNF717:ENST00000477374.1:c.277+4391_277+4392insT:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_NFE: 0.0092%

MISSENSE_VARIANT SNV 3-75786597-C-T [0/1] rs76585055

Variant score: 0.998

Transcripts:: ZNF717:ENST00000400845.3:c.2156G>A:p.(Arg719Gln); ZNF717:ENST00000422325.1:c.2177G>A:p.(Arg726Gln); ZNF717:ENST00000478296.1:c.2027G>A:p.(Arg676Gln); ZNF717:ENST00000477374.1:c.277+3830G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.080 (T)

Frequency Data:: gnomAD_E_EAS: 0.0116%

MISSENSE_VARIANT SNV 3-75786993-T-A [0/1] rs149887072

Variant score: 0.998

Transcripts:: ZNF717:ENST00000400845.3:c.1760A>T:p.(Asn587Ile); ZNF717:ENST00000422325.1:c.1781A>T:p.(Asn594Ile); ZNF717:ENST00000478296.1:c.1631A>T:p.(Asn544Ile); ZNF717:ENST00000477374.1:c.277+3434A>T:p.(=)

Pathogenicity Data:: Best Score: 0.998; SIFT: 0.002 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787416-C-T [0/1] rs10442977

Variant score: 0.996

Transcripts:: ZNF717:ENST00000400845.3:c.1337G>A:p.(Cys446Tyr); ZNF717:ENST00000422325.1:c.1358G>A:p.(Cys453Tyr); ZNF717:ENST00000478296.1:c.1208G>A:p.(Cys403Tyr); ZNF717:ENST00000477374.1:c.277+3011G>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: gnomAD_E_AFR: 0.0290%

MISSENSE_VARIANT SNV 3-75786942-C-A [0/1] rs2918517

Variant score: 0.994

Transcripts:: ZNF717:ENST00000400845.3:c.1811G>T:p.(Arg604Ile); ZNF717:ENST00000422325.1:c.1832G>T:p.(Arg611Ile); ZNF717:ENST00000478296.1:c.1682G>T:p.(Arg561Ile); ZNF717:ENST00000477374.1:c.277+3485G>T:p.(=)

Pathogenicity Data:: Best Score: 0.999999; Mutation Taster: 1.000 (P); SIFT: 0.084 (T)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; gnomAD_E_AFR: 0.0152%; gnomAD_E_EAS: 0.0111%; gnomAD_E_OTH: 0.0275%; gnomAD_G_AFR: 0.0132%

FRAMESHIFT_TRUNCATION DEL 3-75787098-CCT-C [0/1] rs146514807

Variant score: 0.992

Transcripts:: ZNF717:ENST00000400845.3:c.1653_1654del:p.(Glu553Lysfs*4); ZNF717:ENST00000422325.1:c.1674_1675del:p.(Glu560Lysfs*4); ZNF717:ENST00000478296.1:c.1524_1525del:p.(Glu510Lysfs*4); ZNF717:ENST00000477374.1:c.277+3327_277+3328del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0146%; gnomAD_E_NFE: 0.0163%; gnomAD_E_SAS: 0.0551%; gnomAD_G_AFR: 0.0185%; gnomAD_G_NFE: 0.0094%

MISSENSE_VARIANT SNV 3-75788130-C-A [0/1] rs113708852

Variant score: 0.992

Transcripts:: ZNF717:ENST00000400845.3:c.623G>T:p.(Gly208Val); ZNF717:ENST00000422325.1:c.644G>T:p.(Gly215Val); ZNF717:ENST00000478296.1:c.494G>T:p.(Gly165Val); ZNF717:ENST00000477374.1:c.277+2297G>T:p.(=)

Pathogenicity Data:: Best Score: 0.992; SIFT: 0.008 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787032-T-C [0/1] rs111273070

Variant score: 0.991

Transcripts:: ZNF717:ENST00000400845.3:c.1721A>G:p.(His574Arg); ZNF717:ENST00000422325.1:c.1742A>G:p.(His581Arg); ZNF717:ENST00000478296.1:c.1592A>G:p.(His531Arg); ZNF717:ENST00000477374.1:c.277+3395A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.031 (D)

Frequency Data:: gnomAD_E_EAS: 0.0676%

MISSENSE_VARIANT SNV 3-75786211-A-G [0/1] rs77715040

Variant score: 0.986

Transcripts:: ZNF717:ENST00000400845.3:c.2542T>C:p.(Ser848Pro); ZNF717:ENST00000422325.1:c.2563T>C:p.(Ser855Pro); ZNF717:ENST00000478296.1:c.2413T>C:p.(Ser805Pro); ZNF717:ENST00000477374.1:c.277+4216T>C:p.(=)

Pathogenicity Data:: Best Score: 0.987; SIFT: 0.013 (D)

Frequency Data:: gnomAD_E_NFE: 0.0058%

MISSENSE_VARIANT SNV 3-75786036-A-G [0/1] rs113748085

Variant score: 0.982

Transcripts:: ZNF717:ENST00000400845.3:c.2717T>C:p.(Phe906Ser); ZNF717:ENST00000422325.1:c.2738T>C:p.(Phe913Ser); ZNF717:ENST00000478296.1:c.2588T>C:p.(Phe863Ser); ZNF717:ENST00000477374.1:c.277+4391T>C:p.(=)

Pathogenicity Data:: Best Score: 0.982; SIFT: 0.018 (D)

Frequency Data:: TOPMed: 0.0004%

MISSENSE_VARIANT SNV 3-75787927-A-G [0/1] rs75388892

Variant score: 0.978

Transcripts:: ZNF717:ENST00000400845.3:c.826T>C:p.(Tyr276His); ZNF717:ENST00000422325.1:c.847T>C:p.(Tyr283His); ZNF717:ENST00000478296.1:c.697T>C:p.(Tyr233His); ZNF717:ENST00000477374.1:c.277+2500T>C:p.(=)

Pathogenicity Data:: Best Score: 0.978051; Mutation Taster: 0.978 (P); SIFT: 0.124 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75781272-C-A [0/1] rs79724453

Variant score: 0.978

Transcripts:: ZNF717:ENST00000477374.1:c.278G>T:p.(Gly93Val)

Pathogenicity Data:: Best Score: 0.978; SIFT: 0.022 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788227-A-G [0/1] rs79108208

Variant score: 0.977

Transcripts:: ZNF717:ENST00000400845.3:c.526T>C:p.(Cys176Arg); ZNF717:ENST00000422325.1:c.547T>C:p.(Cys183Arg); ZNF717:ENST00000478296.1:c.397T>C:p.(Cys133Arg); ZNF717:ENST00000477374.1:c.277+2200T>C:p.(=)

Pathogenicity Data:: Best Score: 0.977; SIFT: 0.023 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786225-G-A [0/1] rs76757483

Variant score: 0.973

Transcripts:: ZNF717:ENST00000400845.3:c.2528C>T:p.(Thr843Ile); ZNF717:ENST00000422325.1:c.2549C>T:p.(Thr850Ile); ZNF717:ENST00000478296.1:c.2399C>T:p.(Thr800Ile); ZNF717:ENST00000477374.1:c.277+4202C>T:p.(=)

Pathogenicity Data:: Best Score: 0.973; SIFT: 0.027 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75781257-T-G [0/1] rs62250086

Variant score: 0.969

Transcripts:: ZNF717:ENST00000477374.1:c.293A>C:p.(Gln98Pro)

Pathogenicity Data:: Best Score: 0.969; SIFT: 0.031 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786042-G-A [0/1] rs77747132

Variant score: 0.962

Transcripts:: ZNF717:ENST00000400845.3:c.2711C>T:p.(Ser904Phe); ZNF717:ENST00000422325.1:c.2732C>T:p.(Ser911Phe); ZNF717:ENST00000478296.1:c.2582C>T:p.(Ser861Phe); ZNF717:ENST00000477374.1:c.277+4385C>T:p.(=)

Pathogenicity Data:: Best Score: 0.962; SIFT: 0.038 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787204-C-A [0/1] rs75063165

Variant score: 0.951

Transcripts:: ZNF717:ENST00000400845.3:c.1549G>T:p.(Val517Phe); ZNF717:ENST00000422325.1:c.1570G>T:p.(Val524Phe); ZNF717:ENST00000478296.1:c.1420G>T:p.(Val474Phe); ZNF717:ENST00000477374.1:c.277+3223G>T:p.(=)

Pathogenicity Data:: Best Score: 0.951; SIFT: 0.049 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75790472-C-T [0/1] rs200497785

Variant score: 0.939

Transcripts:: ZNF717:ENST00000400845.3:c.211G>A:p.(Ala71Thr); ZNF717:ENST00000422325.1:c.232G>A:p.(Ala78Thr); ZNF717:ENST00000477374.1:c.232G>A:p.(Ala78Thr); ZNF717:ENST00000478296.1:c.82G>A:p.(Ala28Thr)

Pathogenicity Data:: Best Score: 0.939; SIFT: 0.061 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786802-G-A [0/1] rs77826574

Variant score: 0.930

Transcripts:: ZNF717:ENST00000400845.3:c.1951C>T:p.(Arg651Cys); ZNF717:ENST00000422325.1:c.1972C>T:p.(Arg658Cys); ZNF717:ENST00000478296.1:c.1822C>T:p.(Arg608Cys); ZNF717:ENST00000477374.1:c.277+3625C>T:p.(=)

Pathogenicity Data:: Best Score: 0.93299997; SIFT: 0.067 (T)

Frequency Data:: gnomAD_E_AMR: 0.0215%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0270%; gnomAD_E_SAS: 0.0198%; gnomAD_G_AFR: 0.0135%; gnomAD_G_NFE: 0.0148%

MISSENSE_VARIANT SNV 3-75788432-T-A [0/1] rs74703212

Variant score: 0.928

Transcripts:: ZNF717:ENST00000400845.3:c.321A>T:p.(Gln107His); ZNF717:ENST00000422325.1:c.342A>T:p.(Gln114His); ZNF717:ENST00000478296.1:c.192A>T:p.(Gln64His); ZNF717:ENST00000477374.1:c.277+1995A>T:p.(=)

Pathogenicity Data:: Best Score: 0.928; SIFT: 0.072 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786991-C-T [0/1] rs76496075

Variant score: 0.901

Transcripts:: ZNF717:ENST00000400845.3:c.1762G>A:p.(Glu588Lys); ZNF717:ENST00000422325.1:c.1783G>A:p.(Glu595Lys); ZNF717:ENST00000478296.1:c.1633G>A:p.(Glu545Lys); ZNF717:ENST00000477374.1:c.277+3436G>A:p.(=)

Pathogenicity Data:: Best Score: 0.901; SIFT: 0.099 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788115-G-A [0/1] rs62246570

Variant score: 0.900

Transcripts:: ZNF717:ENST00000400845.3:c.638C>T:p.(Thr213Met); ZNF717:ENST00000422325.1:c.659C>T:p.(Thr220Met); ZNF717:ENST00000478296.1:c.509C>T:p.(Thr170Met); ZNF717:ENST00000477374.1:c.277+2312C>T:p.(=)

Pathogenicity Data:: Best Score: 0.902; SIFT: 0.098 (T)

Frequency Data:: gnomAD_E_EAS: 0.0148%

MISSENSE_VARIANT SNV 3-75788484-A-G [0/1] rs74485599

Variant score: 0.898

Transcripts:: ZNF717:ENST00000400845.3:c.269T>C:p.(Ile90Thr); ZNF717:ENST00000422325.1:c.290T>C:p.(Ile97Thr); ZNF717:ENST00000478296.1:c.140T>C:p.(Ile47Thr); ZNF717:ENST00000477374.1:c.277+1943T>C:p.(=)

Pathogenicity Data:: Best Score: 0.898; SIFT: 0.102 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787897-T-C [0/1] rs77452021

Variant score: 0.879

Transcripts:: ZNF717:ENST00000400845.3:c.856A>G:p.(Ile286Val); ZNF717:ENST00000422325.1:c.877A>G:p.(Ile293Val); ZNF717:ENST00000478296.1:c.727A>G:p.(Ile243Val); ZNF717:ENST00000477374.1:c.277+2530A>G:p.(=)

Pathogenicity Data:: Best Score: 0.879; SIFT: 0.121 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786501-T-A [0/1] rs372539402

Variant score: 0.878

Transcripts:: ZNF717:ENST00000400845.3:c.2252A>T:p.(Tyr751Phe); ZNF717:ENST00000422325.1:c.2273A>T:p.(Tyr758Phe); ZNF717:ENST00000478296.1:c.2123A>T:p.(Tyr708Phe); ZNF717:ENST00000477374.1:c.277+3926A>T:p.(=)

Pathogenicity Data:: Best Score: 0.878; SIFT: 0.122 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787159-C-T [0/1] rs77322475

Variant score: 0.871

Transcripts:: ZNF717:ENST00000400845.3:c.1594G>A:p.(Glu532Lys); ZNF717:ENST00000422325.1:c.1615G>A:p.(Glu539Lys); ZNF717:ENST00000478296.1:c.1465G>A:p.(Glu489Lys); ZNF717:ENST00000477374.1:c.277+3268G>A:p.(=)

Pathogenicity Data:: Best Score: 0.943; SIFT: 0.057 (D)

Frequency Data:: gnomAD_E_AFR: 0.0215%; gnomAD_E_NFE: 0.0271%; gnomAD_E_SAS: 0.4466%; gnomAD_G_AFR: 0.0223%; gnomAD_G_NFE: 0.0231%

MISSENSE_VARIANT SNV 3-75786450-G-A [0/1] rs77097895

Variant score: 0.864

Transcripts:: ZNF717:ENST00000400845.3:c.2303C>T:p.(Thr768Met); ZNF717:ENST00000422325.1:c.2324C>T:p.(Thr775Met); ZNF717:ENST00000478296.1:c.2174C>T:p.(Thr725Met); ZNF717:ENST00000477374.1:c.277+3977C>T:p.(=)

Pathogenicity Data:: Best Score: 0.86800003; SIFT: 0.132 (T)

Frequency Data:: gnomAD_E_AFR: 0.0313%

DISRUPTIVE_INFRAME_DELETION DEL 3-75786314-CCTACATTCT-C [0/1] rs66703079

Variant score: 0.850

Transcripts:: ZNF717:ENST00000400845.3:c.2430_2438del:p.(Glu811_Arg813del); ZNF717:ENST00000422325.1:c.2451_2459del:p.(Glu818_Arg820del); ZNF717:ENST00000478296.1:c.2301_2309del:p.(Glu768_Arg770del); ZNF717:ENST00000477374.1:c.277+4104_277+4112del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

INFRAME_DELETION DEL 3-75786817-CACATTCATT-C [0/1] rs57577072

Variant score: 0.850

Transcripts:: ZNF717:ENST00000400845.3:c.1927_1935del:p.(Asn643_Cys645del); ZNF717:ENST00000422325.1:c.1948_1956del:p.(Asn650_Cys652del); ZNF717:ENST00000478296.1:c.1798_1806del:p.(Asn600_Cys602del); ZNF717:ENST00000477374.1:c.277+3601_277+3609del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

DISRUPTIVE_INFRAME_INSERTION INS 3-75787353-G-GAAA [0/1]

Variant score: 0.850

Transcripts:: ZNF717:ENST00000400845.3:c.1399_1400insTTT:p.(Thr467delinsIleSer); ZNF717:ENST00000422325.1:c.1420_1421insTTT:p.(Thr474delinsIleSer); ZNF717:ENST00000478296.1:c.1270_1271insTTT:p.(Thr424delinsIleSer); ZNF717:ENST00000477374.1:c.277+3073_277+3074insTTT:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788226-C-A [0/1] rs74816619

Variant score: 0.837

Transcripts:: ZNF717:ENST00000400845.3:c.527G>T:p.(Cys176Phe); ZNF717:ENST00000422325.1:c.548G>T:p.(Cys183Phe); ZNF717:ENST00000478296.1:c.398G>T:p.(Cys133Phe); ZNF717:ENST00000477374.1:c.277+2201G>T:p.(=)

Pathogenicity Data:: Best Score: 0.837; SIFT: 0.163 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787726-G-A [0/1] rs1962893

Variant score: 0.804

Transcripts:: ZNF717:ENST00000400845.3:c.1027C>T:p.(Arg343Cys); ZNF717:ENST00000422325.1:c.1048C>T:p.(Arg350Cys); ZNF717:ENST00000478296.1:c.898C>T:p.(Arg300Cys); ZNF717:ENST00000477374.1:c.277+2701C>T:p.(=)

Pathogenicity Data:: Best Score: 0.806; SIFT: 0.194 (T)

Frequency Data:: gnomAD_E_SAS: 0.0159%

MISSENSE_VARIANT SNV 3-75788316-C-T [0/1] rs79165653

Variant score: 0.803

Transcripts:: ZNF717:ENST00000400845.3:c.437G>A:p.(Gly146Glu); ZNF717:ENST00000422325.1:c.458G>A:p.(Gly153Glu); ZNF717:ENST00000478296.1:c.308G>A:p.(Gly103Glu); ZNF717:ENST00000477374.1:c.277+2111G>A:p.(=)

Pathogenicity Data:: Best Score: 0.803; SIFT: 0.197 (T)

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 3-75788504-G-A [0/1] rs796592912

Variant score: 0.800

Transcripts:: ZNF717:ENST00000400845.3:c.257-8C>T:p.?; ZNF717:ENST00000422325.1:c.278-8C>T:p.?; ZNF717:ENST00000478296.1:c.128-8C>T:p.?; ZNF717:ENST00000477374.1:c.277+1923C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 3-75790527-T-C [0/1] rs75965304

Variant score: 0.800

Transcripts:: ZNF717:ENST00000400845.3:c.164-8A>G:p.?; ZNF717:ENST00000422325.1:c.185-8A>G:p.?; ZNF717:ENST00000477374.1:c.185-8A>G:p.?; ZNF717:ENST00000478296.1:c.35-8A>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786740-C-G [0/1] rs74699492

Variant score: 0.796

Transcripts:: ZNF717:ENST00000400845.3:c.2013G>C:p.(Met671Ile); ZNF717:ENST00000422325.1:c.2034G>C:p.(Met678Ile); ZNF717:ENST00000478296.1:c.1884G>C:p.(Met628Ile); ZNF717:ENST00000477374.1:c.277+3687G>C:p.(=)

Pathogenicity Data:: Best Score: 0.796; SIFT: 0.204 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786298-T-C [0/1] rs76137150

Variant score: 0.786

Transcripts:: ZNF717:ENST00000400845.3:c.2455A>G:p.(Lys819Glu); ZNF717:ENST00000422325.1:c.2476A>G:p.(Lys826Glu); ZNF717:ENST00000478296.1:c.2326A>G:p.(Lys776Glu); ZNF717:ENST00000477374.1:c.277+4129A>G:p.(=)

Pathogenicity Data:: Best Score: 0.786; SIFT: 0.214 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786490-C-G [0/1] rs113382015

Variant score: 0.763

Transcripts:: ZNF717:ENST00000400845.3:c.2263G>C:p.(Glu755Gln); ZNF717:ENST00000422325.1:c.2284G>C:p.(Glu762Gln); ZNF717:ENST00000478296.1:c.2134G>C:p.(Glu712Gln); ZNF717:ENST00000477374.1:c.277+3937G>C:p.(=)

Pathogenicity Data:: Best Score: 0.763; SIFT: 0.237 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788158-G-C [0/1] rs3009004

Variant score: 0.741

Transcripts:: ZNF717:ENST00000400845.3:c.595C>G:p.(Leu199Val); ZNF717:ENST00000422325.1:c.616C>G:p.(Leu206Val); ZNF717:ENST00000478296.1:c.466C>G:p.(Leu156Val); ZNF717:ENST00000477374.1:c.277+2269C>G:p.(=)

Pathogenicity Data:: Best Score: 0.741; SIFT: 0.259 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788088-C-T [0/1] rs77856895

Variant score: 0.726

Transcripts:: ZNF717:ENST00000400845.3:c.665G>A:p.(Arg222Lys); ZNF717:ENST00000422325.1:c.686G>A:p.(Arg229Lys); ZNF717:ENST00000478296.1:c.536G>A:p.(Arg179Lys); ZNF717:ENST00000477374.1:c.277+2339G>A:p.(=)

Pathogenicity Data:: Best Score: 0.726; SIFT: 0.274 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75790447-G-A [0/1] rs76526276

Variant score: 0.713

Transcripts:: ZNF717:ENST00000400845.3:c.236C>T:p.(Thr79Ile); ZNF717:ENST00000422325.1:c.257C>T:p.(Thr86Ile); ZNF717:ENST00000477374.1:c.257C>T:p.(Thr86Ile); ZNF717:ENST00000478296.1:c.107C>T:p.(Thr36Ile)

Pathogenicity Data:: Best Score: 0.713; SIFT: 0.287 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786071-C-A [0/1] rs111230396

Variant score: 0.700

Transcripts:: ZNF717:ENST00000400845.3:c.2682G>T:p.(Glu894Asp); ZNF717:ENST00000422325.1:c.2703G>T:p.(Glu901Asp); ZNF717:ENST00000478296.1:c.2553G>T:p.(Glu851Asp); ZNF717:ENST00000477374.1:c.277+4356G>T:p.(=)

Pathogenicity Data:: Best Score: 0.7; SIFT: 0.300 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787962-G-C [0/1] rs79540623

Variant score: 0.682

Transcripts:: ZNF717:ENST00000400845.3:c.791C>G:p.(Thr264Ser); ZNF717:ENST00000422325.1:c.812C>G:p.(Thr271Ser); ZNF717:ENST00000478296.1:c.662C>G:p.(Thr221Ser); ZNF717:ENST00000477374.1:c.277+2465C>G:p.(=)

Pathogenicity Data:: Best Score: 0.68200004; SIFT: 0.318 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787224-C-T [0/1] rs112847134

Variant score: 0.671

Transcripts:: ZNF717:ENST00000400845.3:c.1529G>A:p.(Arg510His); ZNF717:ENST00000422325.1:c.1550G>A:p.(Arg517His); ZNF717:ENST00000478296.1:c.1400G>A:p.(Arg467His); ZNF717:ENST00000477374.1:c.277+3203G>A:p.(=)

Pathogenicity Data:: Best Score: 0.671; SIFT: 0.329 (T)

Frequency Data:: TOPMed: 0.0038%

MISSENSE_VARIANT SNV 3-75787305-C-T [0/1] rs77389541

Variant score: 0.649

Transcripts:: ZNF717:ENST00000400845.3:c.1448G>A:p.(Arg483His); ZNF717:ENST00000422325.1:c.1469G>A:p.(Arg490His); ZNF717:ENST00000478296.1:c.1319G>A:p.(Arg440His); ZNF717:ENST00000477374.1:c.277+3122G>A:p.(=)

Pathogenicity Data:: Best Score: 0.649; SIFT: 0.351 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787222-A-G [0/1] rs78680336

Variant score: 0.620

Transcripts:: ZNF717:ENST00000400845.3:c.1531T>C:p.(Cys511Arg); ZNF717:ENST00000422325.1:c.1552T>C:p.(Cys518Arg); ZNF717:ENST00000478296.1:c.1402T>C:p.(Cys468Arg); ZNF717:ENST00000477374.1:c.277+3205T>C:p.(=)

Pathogenicity Data:: Best Score: 0.62; SIFT: 0.380 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786619-T-C [0/1] rs77250491

Variant score: 0.616

Transcripts:: ZNF717:ENST00000400845.3:c.2134A>G:p.(Arg712Gly); ZNF717:ENST00000422325.1:c.2155A>G:p.(Arg719Gly); ZNF717:ENST00000478296.1:c.2005A>G:p.(Arg669Gly); ZNF717:ENST00000477374.1:c.277+3808A>G:p.(=)

Pathogenicity Data:: Best Score: 0.616; SIFT: 0.384 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786079-C-T [0/1] rs202061186

Variant score: 0.613

Transcripts:: ZNF717:ENST00000400845.3:c.2674G>A:p.(Val892Ile); ZNF717:ENST00000422325.1:c.2695G>A:p.(Val899Ile); ZNF717:ENST00000478296.1:c.2545G>A:p.(Val849Ile); ZNF717:ENST00000477374.1:c.277+4348G>A:p.(=)

Pathogenicity Data:: Best Score: 0.62; SIFT: 0.380 (T)

Frequency Data:: gnomAD_G_AFR: 0.0804%

MISSENSE_VARIANT SNV 3-75790444-G-A [0/1] rs1971517

Variant score: 0.609

Transcripts:: ZNF717:ENST00000400845.3:c.239C>T:p.(Pro80Leu); ZNF717:ENST00000422325.1:c.260C>T:p.(Pro87Leu); ZNF717:ENST00000477374.1:c.260C>T:p.(Pro87Leu); ZNF717:ENST00000478296.1:c.110C>T:p.(Pro37Leu)

Pathogenicity Data:: Best Score: 0.60899997; SIFT: 0.391 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788023-C-T [0/1] rs76889571

Variant score: 0.595

Transcripts:: ZNF717:ENST00000400845.3:c.730G>A:p.(Val244Ile); ZNF717:ENST00000422325.1:c.751G>A:p.(Val251Ile); ZNF717:ENST00000478296.1:c.601G>A:p.(Val201Ile); ZNF717:ENST00000477374.1:c.277+2404G>A:p.(=)

Pathogenicity Data:: Best Score: 0.595; SIFT: 0.405 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788366-C-A [0/1] rs80085410

Variant score: 0.544

Transcripts:: ZNF717:ENST00000400845.3:c.387G>T:p.(Leu129Phe); ZNF717:ENST00000422325.1:c.408G>T:p.(Leu136Phe); ZNF717:ENST00000478296.1:c.258G>T:p.(Leu86Phe); ZNF717:ENST00000477374.1:c.277+2061G>T:p.(=)

Pathogenicity Data:: Best Score: 0.593; SIFT: 0.407 (T)

Frequency Data:: gnomAD_E_NFE: 0.0091%; gnomAD_G_AMR: 0.4785%; gnomAD_G_EAS: 0.2252%; gnomAD_G_FIN: 0.4098%; gnomAD_G_NFE: 0.0948%; gnomAD_G_OTH: 0.4608%

MISSENSE_VARIANT SNV 3-75781243-T-C [0/1] rs62250085

Variant score: 0.538

Transcripts:: ZNF717:ENST00000477374.1:c.307A>G:p.(Ile103Val)

Pathogenicity Data:: Best Score: 0.538; SIFT: 0.462 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786379-T-C [0/1] rs80170761

Variant score: 0.525

Transcripts:: ZNF717:ENST00000400845.3:c.2374A>G:p.(Thr792Ala); ZNF717:ENST00000422325.1:c.2395A>G:p.(Thr799Ala); ZNF717:ENST00000478296.1:c.2245A>G:p.(Thr749Ala); ZNF717:ENST00000477374.1:c.277+4048A>G:p.(=)

Pathogenicity Data:: Best Score: 0.525; SIFT: 0.475 (T)

Frequency Data:: gnomAD_E_NFE: 0.0039%

MISSENSE_VARIANT SNV 3-75786245-T-A [0/1] rs149660902

Variant score: 0.513

Transcripts:: ZNF717:ENST00000400845.3:c.2508A>T:p.(Arg836Ser); ZNF717:ENST00000422325.1:c.2529A>T:p.(Arg843Ser); ZNF717:ENST00000478296.1:c.2379A>T:p.(Arg793Ser); ZNF717:ENST00000477374.1:c.277+4182A>T:p.(=)

Pathogenicity Data:: Best Score: 0.513; SIFT: 0.487 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786784-T-C [0/1] rs78490340

Variant score: 0.513

Transcripts:: ZNF717:ENST00000400845.3:c.1969A>G:p.(Ile657Val); ZNF717:ENST00000422325.1:c.1990A>G:p.(Ile664Val); ZNF717:ENST00000478296.1:c.1840A>G:p.(Ile614Val); ZNF717:ENST00000477374.1:c.277+3643A>G:p.(=)

Pathogenicity Data:: Best Score: 0.513; SIFT: 0.487 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788068-A-C [0/1] rs74357986

Variant score: 0.507

Transcripts:: ZNF717:ENST00000400845.3:c.685T>G:p.(Phe229Val); ZNF717:ENST00000422325.1:c.706T>G:p.(Phe236Val); ZNF717:ENST00000478296.1:c.556T>G:p.(Phe186Val); ZNF717:ENST00000477374.1:c.277+2359T>G:p.(=)

Pathogenicity Data:: Best Score: 0.50699997; SIFT: 0.493 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786618-C-A [0/1] rs140085908

Variant score: 0.494

Transcripts:: ZNF717:ENST00000400845.3:c.2135G>T:p.(Arg712Ile); ZNF717:ENST00000422325.1:c.2156G>T:p.(Arg719Ile); ZNF717:ENST00000478296.1:c.2006G>T:p.(Arg669Ile); ZNF717:ENST00000477374.1:c.277+3809G>T:p.(=)

Pathogenicity Data:: Best Score: 0.49400002; SIFT: 0.506 (T)

Frequency Data:: TOPMed: 0.0008%

MISSENSE_VARIANT SNV 3-75787794-A-G [0/1] rs75467043

Variant score: 0.463

Transcripts:: ZNF717:ENST00000400845.3:c.959T>C:p.(Ile320Thr); ZNF717:ENST00000422325.1:c.980T>C:p.(Ile327Thr); ZNF717:ENST00000478296.1:c.830T>C:p.(Ile277Thr); ZNF717:ENST00000477374.1:c.277+2633T>C:p.(=)

Pathogenicity Data:: Best Score: 0.621; SIFT: 0.379 (T)

Frequency Data:: ExAC AFR: 0.3497%; ExAC NFE: 0.2069%; ExAC SAS: 0.0965%; gnomAD_E_AFR: 0.4339%; gnomAD_E_AMR: 1.0563%; gnomAD_E_EAS: 0.6369%; gnomAD_E_FIN: 0.0977%; gnomAD_E_NFE: 0.6241%; gnomAD_E_OTH: 1.0050%; gnomAD_E_SAS: 0.7068%; gnomAD_G_AFR: 0.5263%; gnomAD_G_EAS: 0.4545%; gnomAD_G_FIN: 0.0942%; gnomAD_G_NFE: 0.6169%

MISSENSE_VARIANT SNV 3-75786741-A-G [0/1] rs79103664

Variant score: 0.423

Transcripts:: ZNF717:ENST00000400845.3:c.2012T>C:p.(Met671Thr); ZNF717:ENST00000422325.1:c.2033T>C:p.(Met678Thr); ZNF717:ENST00000478296.1:c.1883T>C:p.(Met628Thr); ZNF717:ENST00000477374.1:c.277+3686T>C:p.(=)

Pathogenicity Data:: Best Score: 0.42299998; SIFT: 0.577 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788010-A-C [1/1] rs3009006

Variant score: 0.407

Transcripts:: ZNF717:ENST00000400845.3:c.743T>G:p.(Val248Gly); ZNF717:ENST00000422325.1:c.764T>G:p.(Val255Gly); ZNF717:ENST00000478296.1:c.614T>G:p.(Val205Gly); ZNF717:ENST00000477374.1:c.277+2417T>G:p.(=)

Pathogenicity Data:: Best Score: 0.531; SIFT: 0.469 (T)

Frequency Data:: gnomAD_E_AFR: 0.0842%; gnomAD_E_AMR: 0.8284%; gnomAD_E_EAS: 1.0030%; gnomAD_E_NFE: 0.1708%; gnomAD_E_OTH: 0.6536%; gnomAD_E_SAS: 0.2796%

MISSENSE_VARIANT SNV 3-75787801-T-C [0/1] rs200891949

Variant score: 0.376

Transcripts:: ZNF717:ENST00000400845.3:c.952A>G:p.(Ser318Gly); ZNF717:ENST00000422325.1:c.973A>G:p.(Ser325Gly); ZNF717:ENST00000478296.1:c.823A>G:p.(Ser275Gly); ZNF717:ENST00000477374.1:c.277+2626A>G:p.(=)

Pathogenicity Data:: Best Score: 0.376; SIFT: 0.624 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75788281-T-C [0/1] rs76243986

Variant score: 0.350

Transcripts:: ZNF717:ENST00000400845.3:c.472A>G:p.(Met158Val); ZNF717:ENST00000422325.1:c.493A>G:p.(Met165Val); ZNF717:ENST00000478296.1:c.343A>G:p.(Met115Val); ZNF717:ENST00000477374.1:c.277+2146A>G:p.(=)

Pathogenicity Data:: Best Score: 0.49400002; SIFT: 0.506 (T)

Frequency Data:: gnomAD_E_AFR: 0.0315%; gnomAD_E_AMR: 0.0160%; gnomAD_E_EAS: 0.0288%; gnomAD_E_NFE: 0.0431%; gnomAD_G_AFR: 0.7027%; gnomAD_G_AMR: 1.1494%; gnomAD_G_EAS: 0.8427%; gnomAD_G_FIN: 0.1264%; gnomAD_G_NFE: 0.5653%; gnomAD_G_OTH: 1.0695%

SPLICE_REGION_VARIANT SNV 3-75790419-T-C [0/1] rs201067375

Variant score: 0.345

Transcripts:: ZNF717:ENST00000400845.3:c.256+8A>G:p.?; ZNF717:ENST00000422325.1:c.277+8A>G:p.?; ZNF717:ENST00000477374.1:c.277+8A>G:p.?; ZNF717:ENST00000478296.1:c.127+8A>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 1.4888%; gnomAD_G_AMR: 1.6484%; gnomAD_G_FIN: 1.0949%; gnomAD_G_NFE: 1.5110%; gnomAD_G_OTH: 0.6098%

SPLICE_REGION_VARIANT SNV 3-75790420-G-A [0/1] rs201879005

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.345

Transcripts:: ZNF717:ENST00000400845.3:c.256+7C>T:p.?; ZNF717:ENST00000422325.1:c.277+7C>T:p.?; ZNF717:ENST00000477374.1:c.277+7C>T:p.?; ZNF717:ENST00000478296.1:c.127+7C>T:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 1.5038%; gnomAD_G_AMR: 1.6484%; gnomAD_G_FIN: 1.0922%; gnomAD_G_NFE: 1.5257%; gnomAD_G_OTH: 0.6250%

MISSENSE_VARIANT SNV 3-75788362-A-T [0/1] rs754406448

Variant score: 0.336

Transcripts:: ZNF717:ENST00000400845.3:c.391T>A:p.(Ser131Thr); ZNF717:ENST00000422325.1:c.412T>A:p.(Ser138Thr); ZNF717:ENST00000478296.1:c.262T>A:p.(Ser88Thr); ZNF717:ENST00000477374.1:c.277+2065T>A:p.(=)

Pathogenicity Data:: Best Score: 0.36699998; SIFT: 0.633 (T)

Frequency Data:: gnomAD_G_AMR: 0.4808%; gnomAD_G_EAS: 0.2273%; gnomAD_G_FIN: 0.2927%; gnomAD_G_NFE: 0.0677%; gnomAD_G_OTH: 0.4405%

MISSENSE_VARIANT SNV 3-75788199-T-C [0/1] rs77110669

Variant score: 0.269

Transcripts:: ZNF717:ENST00000400845.3:c.554A>G:p.(His185Arg); ZNF717:ENST00000422325.1:c.575A>G:p.(His192Arg); ZNF717:ENST00000478296.1:c.425A>G:p.(His142Arg); ZNF717:ENST00000477374.1:c.277+2228A>G:p.(=)

Pathogenicity Data:: Best Score: 0.269; SIFT: 0.731 (T)

Frequency Data:: gnomAD_E_FIN: 0.0080%

MISSENSE_VARIANT SNV 3-75786628-G-C [0/1] rs3009023

Variant score: 0.207

Transcripts:: ZNF717:ENST00000400845.3:c.2125C>G:p.(Gln709Glu); ZNF717:ENST00000422325.1:c.2146C>G:p.(Gln716Glu); ZNF717:ENST00000478296.1:c.1996C>G:p.(Gln666Glu); ZNF717:ENST00000477374.1:c.277+3799C>G:p.(=)

Pathogenicity Data:: Best Score: 0.20899999; SIFT: 0.791 (T)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0599%; gnomAD_E_AMR: 0.0045%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0057%

MISSENSE_VARIANT SNV 3-75790427-C-T [0/1] rs199946555

Variant score: 0.163

Transcripts:: ZNF717:ENST00000400845.3:c.256G>A:p.(Ala86Thr); ZNF717:ENST00000422325.1:c.277G>A:p.(Ala93Thr); ZNF717:ENST00000477374.1:c.277G>A:p.(Gly93Ser); ZNF717:ENST00000478296.1:c.127G>A:p.(Ala43Thr)

Pathogenicity Data:: Best Score: 0.877; SIFT: 0.123 (T)

Frequency Data:: gnomAD_E_AFR: 0.0855%; gnomAD_E_AMR: 0.1728%; gnomAD_E_FIN: 0.3078%; gnomAD_E_NFE: 0.5178%; gnomAD_E_OTH: 0.2488%; gnomAD_E_SAS: 1.0075%; gnomAD_G_AFR: 1.5723%; gnomAD_G_AMR: 1.7442%; gnomAD_G_EAS: 0.5435%; gnomAD_G_FIN: 1.4031%; gnomAD_G_NFE: 1.7981%; gnomAD_G_OTH: 1.9481%

MISSENSE_VARIANT SNV 3-75787464-C-T [0/1] rs74861398

Variant score: 0.146

Transcripts:: ZNF717:ENST00000400845.3:c.1289G>A:p.(Arg430Lys); ZNF717:ENST00000422325.1:c.1310G>A:p.(Arg437Lys); ZNF717:ENST00000478296.1:c.1160G>A:p.(Arg387Lys); ZNF717:ENST00000477374.1:c.277+2963G>A:p.(=)

Pathogenicity Data:: Best Score: 0.14600003; SIFT: 0.854 (T)

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786059-C-T [0/1] rs73843008

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2694G>A:p.(=); ZNF717:ENST00000422325.1:c.2715G>A:p.(=); ZNF717:ENST00000478296.1:c.2565G>A:p.(=); ZNF717:ENST00000477374.1:c.277+4368G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786302-G-A [0/1] rs80001478

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2451C>T:p.(=); ZNF717:ENST00000422325.1:c.2472C>T:p.(=); ZNF717:ENST00000478296.1:c.2322C>T:p.(=); ZNF717:ENST00000477374.1:c.277+4125C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786476-G-A [0/1] rs111381670

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2277C>T:p.(=); ZNF717:ENST00000422325.1:c.2298C>T:p.(=); ZNF717:ENST00000478296.1:c.2148C>T:p.(=); ZNF717:ENST00000477374.1:c.277+3951C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786506-T-C [0/1] rs79902440

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2247A>G:p.(=); ZNF717:ENST00000422325.1:c.2268A>G:p.(=); ZNF717:ENST00000478296.1:c.2118A>G:p.(=); ZNF717:ENST00000477374.1:c.277+3921A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786521-G-A [0/1] rs76396775

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2232C>T:p.(=); ZNF717:ENST00000422325.1:c.2253C>T:p.(=); ZNF717:ENST00000478296.1:c.2103C>T:p.(=); ZNF717:ENST00000477374.1:c.277+3906C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786533-T-G [0/1] rs79051543

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2220A>C:p.(=); ZNF717:ENST00000422325.1:c.2241A>C:p.(=); ZNF717:ENST00000478296.1:c.2091A>C:p.(=); ZNF717:ENST00000477374.1:c.277+3894A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786623-G-T [0/1] rs78134363

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.2130C>A:p.(=); ZNF717:ENST00000422325.1:c.2151C>A:p.(=); ZNF717:ENST00000478296.1:c.2001C>A:p.(=); ZNF717:ENST00000477374.1:c.277+3804C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786854-A-T [0/1] rs76921234

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1899T>A:p.(=); ZNF717:ENST00000422325.1:c.1920T>A:p.(=); ZNF717:ENST00000478296.1:c.1770T>A:p.(=); ZNF717:ENST00000477374.1:c.277+3573T>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786866-G-T [0/1] rs79516801

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1887C>A:p.(=); ZNF717:ENST00000422325.1:c.1908C>A:p.(=); ZNF717:ENST00000478296.1:c.1758C>A:p.(=); ZNF717:ENST00000477374.1:c.277+3561C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786965-C-T [0/1] rs76347222

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1788G>A:p.(=); ZNF717:ENST00000422325.1:c.1809G>A:p.(=); ZNF717:ENST00000478296.1:c.1659G>A:p.(=); ZNF717:ENST00000477374.1:c.277+3462G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787043-G-A [0/1] rs78806516

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1710C>T:p.(=); ZNF717:ENST00000422325.1:c.1731C>T:p.(=); ZNF717:ENST00000478296.1:c.1581C>T:p.(=); ZNF717:ENST00000477374.1:c.277+3384C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787145-T-C [0/1] rs79560192

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1608A>G:p.(=); ZNF717:ENST00000422325.1:c.1629A>G:p.(=); ZNF717:ENST00000478296.1:c.1479A>G:p.(=); ZNF717:ENST00000477374.1:c.277+3282A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787202-G-T [0/1] rs76713735

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1551C>A:p.(=); ZNF717:ENST00000422325.1:c.1572C>A:p.(=); ZNF717:ENST00000478296.1:c.1422C>A:p.(=); ZNF717:ENST00000477374.1:c.277+3225C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787208-G-A [0/1] rs79982156

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1545C>T:p.(=); ZNF717:ENST00000422325.1:c.1566C>T:p.(=); ZNF717:ENST00000478296.1:c.1416C>T:p.(=); ZNF717:ENST00000477374.1:c.277+3219C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787265-C-G [0/1] rs77829652

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1488G>C:p.(=); ZNF717:ENST00000422325.1:c.1509G>C:p.(=); ZNF717:ENST00000478296.1:c.1359G>C:p.(=); ZNF717:ENST00000477374.1:c.277+3162G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787304-A-T [0/1] rs77311242

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1449T>A:p.(=); ZNF717:ENST00000422325.1:c.1470T>A:p.(=); ZNF717:ENST00000478296.1:c.1320T>A:p.(=); ZNF717:ENST00000477374.1:c.277+3123T>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787427-T-C [0/1] rs76082496

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1326A>G:p.(=); ZNF717:ENST00000422325.1:c.1347A>G:p.(=); ZNF717:ENST00000478296.1:c.1197A>G:p.(=); ZNF717:ENST00000477374.1:c.277+3000A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787637-C-T [0/1] rs28632074

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1116G>A:p.(=); ZNF717:ENST00000422325.1:c.1137G>A:p.(=); ZNF717:ENST00000478296.1:c.987G>A:p.(=); ZNF717:ENST00000477374.1:c.277+2790G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787679-T-C [0/1] rs74620322

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1074A>G:p.(=); ZNF717:ENST00000422325.1:c.1095A>G:p.(=); ZNF717:ENST00000478296.1:c.945A>G:p.(=); ZNF717:ENST00000477374.1:c.277+2748A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787688-T-A [0/1] rs77688099

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1065A>T:p.(=); ZNF717:ENST00000422325.1:c.1086A>T:p.(=); ZNF717:ENST00000478296.1:c.936A>T:p.(=); ZNF717:ENST00000477374.1:c.277+2739A>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787802-G-A [0/1] rs201430954

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.951C>T:p.(=); ZNF717:ENST00000422325.1:c.972C>T:p.(=); ZNF717:ENST00000478296.1:c.822C>T:p.(=); ZNF717:ENST00000477374.1:c.277+2625C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787880-A-G [0/1] rs78071099

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.873T>C:p.(=); ZNF717:ENST00000422325.1:c.894T>C:p.(=); ZNF717:ENST00000478296.1:c.744T>C:p.(=); ZNF717:ENST00000477374.1:c.277+2547T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75787961-A-G [0/1] rs76334908

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.792T>C:p.(=); ZNF717:ENST00000422325.1:c.813T>C:p.(=); ZNF717:ENST00000478296.1:c.663T>C:p.(=); ZNF717:ENST00000477374.1:c.277+2466T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75788291-A-G [0/1] rs75972102

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.462T>C:p.(=); ZNF717:ENST00000422325.1:c.483T>C:p.(=); ZNF717:ENST00000478296.1:c.333T>C:p.(=); ZNF717:ENST00000477374.1:c.277+2136T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75788489-C-T [0/1] rs111354562

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.264G>A:p.(=); ZNF717:ENST00000422325.1:c.285G>A:p.(=); ZNF717:ENST00000478296.1:c.135G>A:p.(=); ZNF717:ENST00000477374.1:c.277+1938G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75790446-G-T [0/1] rs79202307

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.237C>A:p.(=); ZNF717:ENST00000422325.1:c.258C>A:p.(=); ZNF717:ENST00000477374.1:c.258C>A:p.(=); ZNF717:ENST00000478296.1:c.108C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75790479-C-T [0/1] rs79902868

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.204G>A:p.(=); ZNF717:ENST00000422325.1:c.225G>A:p.(=); ZNF717:ENST00000477374.1:c.225G>A:p.(=); ZNF717:ENST00000478296.1:c.75G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75790822-A-G [0/1] rs2918520

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.102T>C:p.(=); ZNF717:ENST00000422325.1:c.123T>C:p.(=); ZNF717:ENST00000477374.1:c.123T>C:p.(=); ZNF717:ENST00000478296.1:c.-28T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 3-75786899-T-C [0/1] rs78828372

Variant score: 0.100

Transcripts:: ZNF717:ENST00000400845.3:c.1854A>G:p.(=); ZNF717:ENST00000422325.1:c.1875A>G:p.(=); ZNF717:ENST00000478296.1:c.1725A>G:p.(=); ZNF717:ENST00000477374.1:c.277+3528A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC NFE: 0.0123%; gnomAD_E_AMR: 0.0045%; gnomAD_E_NFE: 0.0093%

SYNONYMOUS_VARIANT SNV 3-75787949-C-T [0/1] rs76105745

Variant score: 0.091

Transcripts:: ZNF717:ENST00000400845.3:c.804G>A:p.(=); ZNF717:ENST00000422325.1:c.825G>A:p.(=); ZNF717:ENST00000478296.1:c.675G>A:p.(=); ZNF717:ENST00000477374.1:c.277+2478G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.2376%; gnomAD_E_AMR: 0.4876%; gnomAD_E_EAS: 0.2569%; gnomAD_E_FIN: 0.1065%; gnomAD_E_NFE: 0.2428%; gnomAD_E_OTH: 0.1225%; gnomAD_E_SAS: 0.1079%; gnomAD_G_AFR: 0.2022%; gnomAD_G_AMR: 0.4854%; gnomAD_G_NFE: 0.1141%

SYNONYMOUS_VARIANT SNV 3-75786080-G-A [0/1] rs2118754

Variant score: 0.085

Transcripts:: ZNF717:ENST00000400845.3:c.2673C>T:p.(=); ZNF717:ENST00000422325.1:c.2694C>T:p.(=); ZNF717:ENST00000478296.1:c.2544C>T:p.(=); ZNF717:ENST00000477374.1:c.277+4347C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_EAS: 0.7576%; gnomAD_G_NFE: 0.0330%

SYNONYMOUS_VARIANT SNV 3-75788258-C-A [0/1] rs79526626

Variant score: 0.065

Transcripts:: ZNF717:ENST00000400845.3:c.495G>T:p.(=); ZNF717:ENST00000422325.1:c.516G>T:p.(=); ZNF717:ENST00000478296.1:c.366G>T:p.(=); ZNF717:ENST00000477374.1:c.277+2169G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0510%; gnomAD_E_AMR: 0.0229%; gnomAD_E_NFE: 0.0047%; gnomAD_E_SAS: 0.0228%; gnomAD_G_AFR: 0.4636%; gnomAD_G_AMR: 1.2821%; gnomAD_G_EAS: 0.2463%; gnomAD_G_FIN: 0.2160%; gnomAD_G_NFE: 0.4739%; gnomAD_G_OTH: 0.7538%

MISSENSE_VARIANT SNV 3-75788434-G-T [0/1] rs4011155

Variant score: 0.021

Transcripts:: ZNF717:ENST00000400845.3:c.319C>A:p.(Gln107Lys); ZNF717:ENST00000422325.1:c.340C>A:p.(Gln114Lys); ZNF717:ENST00000478296.1:c.190C>A:p.(Gln64Lys); ZNF717:ENST00000477374.1:c.277+1993C>A:p.(=)

Pathogenicity Data:: Best Score: 0.021000028; SIFT: 0.979 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786060-A-G [0/1] rs76046078

Variant score: 0.000

Transcripts:: ZNF717:ENST00000400845.3:c.2693T>C:p.(Val898Ala); ZNF717:ENST00000422325.1:c.2714T>C:p.(Val905Ala); ZNF717:ENST00000478296.1:c.2564T>C:p.(Val855Ala); ZNF717:ENST00000477374.1:c.277+4367T>C:p.(=)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75786469-G-A [0/1] rs113197025

Variant score: 0.000

Transcripts:: ZNF717:ENST00000400845.3:c.2284C>T:p.(His762Tyr); ZNF717:ENST00000422325.1:c.2305C>T:p.(His769Tyr); ZNF717:ENST00000478296.1:c.2155C>T:p.(His719Tyr); ZNF717:ENST00000477374.1:c.277+3958C>T:p.(=)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 3-75787458-G-A [0/1] rs76333414

Variant score: 0.000

Transcripts:: ZNF717:ENST00000400845.3:c.1295C>T:p.(Thr432Ile); ZNF717:ENST00000422325.1:c.1316C>T:p.(Thr439Ile); ZNF717:ENST00000478296.1:c.1166C>T:p.(Thr389Ile); ZNF717:ENST00000477374.1:c.277+2969C>T:p.(=)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: No frequency data

METTL25B

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-156702151-C-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: METTL25B:ENST00000524343.1:c.190C>G:p.(Leu64Val); METTL25B:ENST00000368216.4:c.315C>G:p.(=); METTL25B:ENST00000368218.4:c.315C>G:p.(=); METTL25B:ENST00000476229.1:c.9C>G:p.(=)

Pathogenicity Data:: Best Score: 0.999977; Mutation Taster: 1.000 (P); SIFT: 0.174 (T)

Frequency Data:: No frequency data

FRG1

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

Known diseases:: ORPHA:269 Facioscapulohumeral dystrophy - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 4-190881969-G-A [0/1] rs6846627

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG1:ENST00000226798.4:c.604G>A:p.(Val202Ile)

Pathogenicity Data:: Best Score: 0.999968; Polyphen2: 0.038 (B); Mutation Taster: 1.000 (P); SIFT: 0.132 (T)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 4-190881969-G-A [0/1] rs6846627

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FRG1:ENST00000226798.4:c.604G>A:p.(Val202Ile)

Pathogenicity Data:: Best Score: 0.999968; Polyphen2: 0.038 (B); Mutation Taster: 1.000 (P); SIFT: 0.132 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 4-190874255-A-T [0/1] rs17425201

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: FRG1:ENST00000226798.4:c.292A>T:p.(Thr98Ser)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.083 (B); Mutation Taster: 1.000 (P); SIFT: 0.046 (D)

Frequency Data:: gnomAD_E_AFR: 0.0219%; gnomAD_E_AMR: 0.0094%; gnomAD_E_NFE: 0.0077%; gnomAD_E_SAS: 0.0035%

Other passed variants:

MISSENSE_VARIANT SNV 4-190876196-G-A [0/1] rs17425208

Variant score: 0.996

Transcripts:: FRG1:ENST00000226798.4:c.322G>A:p.(Ala108Thr)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.241 (B); Mutation Taster: 1.000 (P); SIFT: 0.038 (D)

Frequency Data:: TOPMed: 0.0019%; ExAC FIN: 0.0303%; ExAC NFE: 0.0075%; ExAC SAS: 0.0121%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0098%

SPLICE_REGION_VARIANT SNV 4-190881997-A-G [0/1] rs77084305

Variant score: 0.800

Transcripts:: FRG1:ENST00000226798.4:c.629+3A>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_NFE: 0.0010%

SPLICE_REGION_VARIANT SNV 4-190881992-T-C [0/1] rs75112782

Variant score: 0.798

Transcripts:: FRG1:ENST00000226798.4:c.627T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_OTH: 0.0204%

MISSENSE_VARIANT SNV 4-190881933-A-G [0/1] rs184307882

Variant score: 0.576

Transcripts:: FRG1:ENST00000226798.4:c.568A>G:p.(Lys190Glu)

Pathogenicity Data:: Best Score: 0.575598; Polyphen2: 0.034 (B); Mutation Taster: 0.576; SIFT: 0.615 (T)

Frequency Data:: No frequency data

DACT2

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-168720112-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: DACT2:ENST00000366795.3:c.202G>A:p.(Glu68Lys); DACT2:ENST00000366796.3:c.202G>A:p.(Glu68Lys); DACT2:ENST00000607983.1:c.-172+140G>A:p.(=); DACT2:ENST00000610183.1:c.-8+222G>A:p.(=)

Pathogenicity Data:: Best Score: 0.99996; Polyphen2: 0.997 (D); Mutation Taster: 1.000 (P); SIFT: 0.003 (D)

Frequency Data:: No frequency data

PPP1R37

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-45649651-T-C [0/1] rs1435233668

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: PPP1R37:ENST00000221462.4:c.1997T>C:p.(Leu666Pro); PPP1R37:ENST00000421905.1:c.1985T>C:p.(Leu662Pro)

Pathogenicity Data:: Best Score: 1.0; Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0004%

RP11-764K9.4

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 9-68433464-C-T [0/1] rs79004307

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.695+1G>A:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.900

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 9-68433464-C-T [0/1] rs79004307

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.695+1G>A:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

SPLICE_REGION_VARIANT SNV 9-68430172-A-G [0/1] rs796550725

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.785T>C:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SPLICE_REGION_VARIANT SNV 9-68430269-T-A [0/1] rs146972178

Variant score: 0.800

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.696-8A>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 9-68433462-T-C [0/1] rs111392331

Variant score: 0.800

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.695+3A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT DEL 9-68438557-CCTT-C [0/1] rs144201632

Variant score: 0.800

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.410_412del:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 9-68438558-C-T [0/1] rs202077200

Variant score: 0.800

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.412G>A:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

SPLICE_REGION_VARIANT SNV 9-68430167-T-C [0/1] rs796325229

Variant score: 0.800

Transcripts:: RP11-764K9.4:ENST00000376334.3:n.787+3A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0045%

ANKRD20A1

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 9-67927076-G-A [0/1] rs1587593556

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ANKRD20A1:ENST00000377477.2:c.203+1G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_DONOR_VARIANT SNV 9-67927076-G-A [0/1] rs1587593556

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: ANKRD20A1:ENST00000377477.2:c.203+1G>A:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

MISSENSE_VARIANT SNV 9-67927062-G-A [0/1] rs1587593550

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: ANKRD20A1:ENST00000377477.2:c.190G>A:p.(Asp64Asn)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.995 (D)

Frequency Data:: No frequency data

Other passed variants:

SYNONYMOUS_VARIANT SNV 9-67927043-C-T [0/1] rs1275954344

Variant score: 0.100

Transcripts:: ANKRD20A1:ENST00000377477.2:c.171C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SYNONYMOUS_VARIANT SNV 9-67927052-G-A [0/1] rs1587593541

Variant score: 0.100

Transcripts:: ANKRD20A1:ENST00000377477.2:c.180G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

FAM104B

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-55172708-T-G [0/1] rs1047034

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FAM104B:ENST00000332132.4:c.160A>C:p.(Ile54Leu); FAM104B:ENST00000358460.4:c.157A>C:p.(Ile53Leu); FAM104B:ENST00000425133.2:c.160A>C:p.(Ile54Leu); FAM104B:ENST00000477847.2:c.148A>C:p.(Ile50Leu); FAM104B:ENST00000489298.1:c.154A>C:p.(Ile52Leu); FAM104B:ENST00000472571.2:c.*23A>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.271 (B); SIFT: 0.000 (D)

Frequency Data:: ExAC NFE: 0.0021%; gnomAD_E_NFE: 0.0012%

X_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-55172708-T-G [0/1] rs1047034

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: FAM104B:ENST00000332132.4:c.160A>C:p.(Ile54Leu); FAM104B:ENST00000358460.4:c.157A>C:p.(Ile53Leu); FAM104B:ENST00000425133.2:c.160A>C:p.(Ile54Leu); FAM104B:ENST00000477847.2:c.148A>C:p.(Ile50Leu); FAM104B:ENST00000489298.1:c.154A>C:p.(Ile52Leu); FAM104B:ENST00000472571.2:c.*23A>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.271 (B); SIFT: 0.000 (D)

Frequency Data:: ExAC NFE: 0.0021%; gnomAD_E_NFE: 0.0012%

Other passed variants:

MISSENSE_VARIANT SNV X-55172716-C-T [0/1] rs5018688

Variant score: 0.993

Transcripts:: FAM104B:ENST00000332132.4:c.152G>A:p.(Ser51Asn); FAM104B:ENST00000358460.4:c.149G>A:p.(Ser50Asn); FAM104B:ENST00000425133.2:c.152G>A:p.(Ser51Asn); FAM104B:ENST00000477847.2:c.140G>A:p.(Ser47Asn); FAM104B:ENST00000489298.1:c.146G>A:p.(Ser49Asn); FAM104B:ENST00000472571.2:c.*15G>A:p.(=)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.760 (P); SIFT: 0.007 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV X-55172687-T-C [0/1] rs1047037

Variant score: 0.986

Transcripts:: FAM104B:ENST00000332132.4:c.181A>G:p.(Ser61Gly); FAM104B:ENST00000358460.4:c.178A>G:p.(Ser60Gly); FAM104B:ENST00000425133.2:c.181A>G:p.(Ser61Gly); FAM104B:ENST00000477847.2:c.169A>G:p.(Ser57Gly); FAM104B:ENST00000489298.1:c.175A>G:p.(Ser59Gly); FAM104B:ENST00000472571.2:c.*44A>G:p.(=)

Pathogenicity Data:: Best Score: 0.986; Polyphen2: 0.062 (B); SIFT: 0.014 (D)

Frequency Data:: No frequency data

STOP_GAINED SNV X-55172537-G-A [0/1] rs1047054

Variant score: 0.930

Transcripts:: FAM104B:ENST00000425133.2:c.331C>T:p.(Arg111*); FAM104B:ENST00000477847.2:c.319C>T:p.(Arg107*); FAM104B:ENST00000489298.1:c.325C>T:p.(Arg109*); FAM104B:ENST00000332132.4:c.254+77C>T:p.(=); FAM104B:ENST00000358460.4:c.251+77C>T:p.(=); FAM104B:ENST00000472571.2:c.*194C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AFR: 0.4172%; ExAC FIN: 0.0244%; ExAC NFE: 0.0070%; ExAC SAS: 0.0112%; gnomAD_E_AFR: 0.0176%; gnomAD_E_NFE: 0.0026%; gnomAD_E_SAS: 0.0054%

MISSENSE_VARIANT SNV X-55172659-A-G [0/1] rs5018687

Variant score: 0.677

Transcripts:: FAM104B:ENST00000332132.4:c.209T>C:p.(Ile70Thr); FAM104B:ENST00000358460.4:c.206T>C:p.(Ile69Thr); FAM104B:ENST00000425133.2:c.209T>C:p.(Ile70Thr); FAM104B:ENST00000477847.2:c.197T>C:p.(Ile66Thr); FAM104B:ENST00000489298.1:c.203T>C:p.(Ile68Thr); FAM104B:ENST00000472571.2:c.*72T>C:p.(=)

Pathogenicity Data:: Best Score: 0.677; Polyphen2: 0.677 (P); SIFT: 0.403 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV X-55172645-C-T [0/1] rs1047042

Variant score: 0.319

Transcripts:: FAM104B:ENST00000332132.4:c.223G>A:p.(Asp75Asn); FAM104B:ENST00000358460.4:c.220G>A:p.(Asp74Asn); FAM104B:ENST00000425133.2:c.223G>A:p.(Asp75Asn); FAM104B:ENST00000477847.2:c.211G>A:p.(Asp71Asn); FAM104B:ENST00000489298.1:c.217G>A:p.(Asp73Asn); FAM104B:ENST00000472571.2:c.*86G>A:p.(=)

Pathogenicity Data:: Best Score: 0.325; Polyphen2: 0.001 (B); SIFT: 0.675 (T)

Frequency Data:: 1000Genomes: 0.1325%; TOPMed: 0.1325%

SYNONYMOUS_VARIANT SNV X-55187581-G-T [0/1] rs1602316798

Variant score: 0.100

Transcripts:: FAM104B:ENST00000332132.4:c.9C>A:p.(=); FAM104B:ENST00000358460.4:c.9C>A:p.(=); FAM104B:ENST00000425133.2:c.9C>A:p.(=); FAM104B:ENST00000472571.2:c.9C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

TLNRD1

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-81294838-G-C [0/1] rs760677834

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 1.000 CONTRIBUTING VARIANT

Transcripts:: TLNRD1:ENST00000267984.2:c.226G>C:p.(Glu76Gln)

Pathogenicity Data:: Best Score: 0.999999; Polyphen2: 0.318 (B); Mutation Taster: 1.000 (P); SIFT: 0.240 (T)

Frequency Data:: TOPMed: 0.0023%; ExAC NFE: 0.0018%; gnomAD_E_NFE: 0.0013%

PCDHA5

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-140201733-A-G [0/1] rs782800067

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: PCDHA5:ENST00000378126.3:c.373A>G:p.(Ile125Val); PCDHA5:ENST00000529619.1:c.373A>G:p.(Ile125Val); PCDHA5:ENST00000529859.1:c.373A>G:p.(Ile125Val); PCDHA5:ENST00000512229.2:c.2385+12576A>G:p.(=); PCDHA5:ENST00000530339.1:c.2385+12576A>G:p.(=); PCDHA5:ENST00000526136.1:c.2388+24796A>G:p.(=); PCDHA5:ENST00000394633.3:c.1602+34256A>G:p.(=); PCDHA5:ENST00000504120.2:c.2394+33464A>G:p.(=); PCDHA5:ENST00000522353.2:c.2394+18557A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.017 (B); Mutation Taster: 1.000 (P); SIFT: 0.261 (T)

Frequency Data:: gnomAD_E_EAS: 0.0058%

ANKRD20A4P

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 9-69423792-A-T [0/1] rs75696372

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.2088A>T:p.(Gln696His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.001 (B); SIFT: 0.000 (D)

Frequency Data:: gnomAD_E_SAS: 0.0069%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 9-69423792-A-T [0/1] rs75696372

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.999 CONTRIBUTING VARIANT

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.2088A>T:p.(Gln696His)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.001 (B); SIFT: 0.000 (D)

Frequency Data:: gnomAD_E_SAS: 0.0069%

MISSENSE_VARIANT SNV 9-69423703-A-C [0/1] rs200741673

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.982 CONTRIBUTING VARIANT

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.1999A>C:p.(Thr667Pro)

Pathogenicity Data:: Best Score: 0.982; Polyphen2: 0.009 (B); SIFT: 0.018 (D)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 9-69423550-G-T [0/1] rs200486187

Variant score: 0.904

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.1846G>T:p.(Ala616Ser)

Pathogenicity Data:: Best Score: 0.904; Polyphen2: 0.662 (P); SIFT: 0.096 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 9-69391111-G-A [0/1] rs796094018

Variant score: 0.491

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.619G>A:p.(Val207Ile)

Pathogenicity Data:: Best Score: 0.549; Polyphen2: 0.013 (B); SIFT: 0.451 (T)

Frequency Data:: gnomAD_G_AFR: 0.5743%; gnomAD_G_AMR: 0.1678%; gnomAD_G_FIN: 0.1068%; gnomAD_G_NFE: 0.0338%; gnomAD_G_OTH: 0.1319%

MISSENSE_VARIANT SNV 9-69391114-T-C [0/1] rs1309858726

Variant score: 0.400

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.622T>C:p.(Tyr208His)

Pathogenicity Data:: Best Score: 0.45499998; Polyphen2: 0.000 (B); SIFT: 0.545 (T)

Frequency Data:: gnomAD_G_AFR: 0.6425%; gnomAD_G_AMR: 0.3322%; gnomAD_G_EAS: 0.0768%; gnomAD_G_FIN: 0.0730%; gnomAD_G_NFE: 0.0595%; gnomAD_G_OTH: 0.1348%

MISSENSE_VARIANT SNV 9-69423755-G-C [0/1] rs77404847

Variant score: 0.288

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.2051G>C:p.(Ser684Thr)

Pathogenicity Data:: Best Score: 0.288; Polyphen2: 0.000 (B); SIFT: 0.712 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 9-69423700-G-A [0/1] rs79174276

Variant score: 0.000

Transcripts:: ANKRD20A4P:ENST00000357336.3:c.1996G>A:p.(Glu666Lys)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B); SIFT: 1.000 (T)

Frequency Data:: No frequency data

SLC35G6

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-7386114-A-G [0/1] rs199996601

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: SLC35G6:ENST00000412468.2:c.811A>G:p.(Ser271Gly); SLC35G6:ENST00000311403.4:c.-81+1209T>C:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.001 (B); Mutation Taster: 1.000 (P); SIFT: 0.605 (T)

Frequency Data:: gnomAD_E_AMR: 0.0032%; gnomAD_E_NFE: 0.0121%; gnomAD_G_NFE: 0.0067%

P3H3

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-6939829-C-T [0/1] rs782204273

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: P3H3:ENST00000251761.8:c.325C>T:p.(Arg109Trp); P3H3:ENST00000396725.2:c.877C>T:p.(Arg293Trp); P3H3:ENST00000606935.1:c.879C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.981 (D); Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0011%; ExAC EAS: 0.0127%; gnomAD_E_EAS: 0.0058%; gnomAD_E_SAS: 0.0033%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.549

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-6939829-C-T [0/1] rs782204273

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.998 CONTRIBUTING VARIANT

Transcripts:: P3H3:ENST00000251761.8:c.325C>T:p.(Arg109Trp); P3H3:ENST00000396725.2:c.877C>T:p.(Arg293Trp); P3H3:ENST00000606935.1:c.879C>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.981 (D); Mutation Taster: 1.000 (P)

Frequency Data:: TOPMed: 0.0011%; ExAC EAS: 0.0127%; gnomAD_E_EAS: 0.0058%; gnomAD_E_SAS: 0.0033%

SYNONYMOUS_VARIANT SNV 12-6937983-C-A [0/1] rs1486125401

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: P3H3:ENST00000396725.2:c.378C>A:p.(=); P3H3:ENST00000606935.1:c.378C>A:p.(=); P3H3:ENST00000251761.8:c.-177C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_G_AFR: 0.0120%

ST14

Exomiser Score: 0.016

Phenotype Score: 0.250

Variant Score: 0.715

Phenotype matches:

Phenotypic similarity 0.403 to mouse mutant involving ST14.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology; HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology

Proximity score 0.500 in interactome to MMP14 and phenotypic similarity 0.638 to Multicentric osteolysis-nodulosis-arthropathy spectrum associated with MMP14.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001230, Broad metacarpals; HP:0001363, Craniosynostosis - HP:0005441, Sclerotic cranial sutures; HP:0011304, Broad thumb - HP:0001230, Broad metacarpals; HP:0010055, Broad hallux - HP:0006234, Osteolysis involving tarsal bones

Proximity score 0.500 in interactome to MMP14 and phenotypic similarity 0.702 to mouse mutant of MMP14.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003055, abnormal long bone epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0002835, abnormal cranial suture morphology; HP:0011304, Broad thumb - MP:0003055, abnormal long bone epiphyseal plate morphology; HP:0010055, Broad hallux - MP:0003055, abnormal long bone epiphyseal plate morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:602400 Ichthyosis, congenital, autosomal recessive 11 - autosomal recessive; ORPHA:91132 Ichthyosis-hypotrichosis syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.250

Variant Score: 0.715

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-130060579-G-A [0/1] rs758552937

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.715 CONTRIBUTING VARIANT

Transcripts:: ST14:ENST00000278742.5:c.865G>A:p.(Ala289Thr)

Pathogenicity Data:: Best Score: 0.71500003; Polyphen2: 0.063 (B); SIFT: 0.285 (T)

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_NFE: 0.0038%

TMEM44

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-194349230-T-C [0/1] rs200109302

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: TMEM44:ENST00000273580.7:c.146A>G:p.(Tyr49Cys); TMEM44:ENST00000347147.4:c.146A>G:p.(Tyr49Cys); TMEM44:ENST00000381975.3:c.146A>G:p.(Tyr49Cys); TMEM44:ENST00000392432.2:c.146A>G:p.(Tyr49Cys); TMEM44:ENST00000473092.1:c.146A>G:p.(Tyr49Cys); TMEM44:ENST00000330115.3:c.-164A>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.999 (D); Mutation Taster: 1.000 (P); SIFT: 0.004 (D)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_OTH: 0.0184%

ELFN1

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-1784444-G-A [0/1] rs746674332

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: ELFN1:ENST00000424383.2:c.212G>A:p.(Arg71His); ELFN1:ENST00000541472.1:c.212G>A:p.(Arg71His); ELFN1:ENST00000561626.1:c.212G>A:p.(Arg71His)

Pathogenicity Data:: Best Score: 0.999; Polyphen2: 0.563 (P); Mutation Taster: 0.904; SIFT: 0.001 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC SAS: 0.0125%; gnomAD_E_SAS: 0.0042%

TNRC6A

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

Phenotype matches:

No phenotype or PPI evidence

Known diseases:: OMIM:618074 ?Epilepsy, familial adult myoclonic, 6 (unconfirmed)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-24762086-G-C [0/1] rs777624725

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.997 CONTRIBUTING VARIANT

Transcripts:: TNRC6A:ENST00000315183.7:c.93G>C:p.(Lys31Asn); TNRC6A:ENST00000395799.3:c.93G>C:p.(Lys31Asn)

Pathogenicity Data:: Best Score: 0.997; Polyphen2: 0.104 (B); SIFT: 0.003 (D)

Frequency Data:: TOPMed: 0.0008%

MOSMO

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_ELONGATION INS 16-22087020-A-ATGATCCTTTTCTGTATGGCTGCCCTAATATTTCCAATAGGATTTTACATCAAT [0/1] rs777064731

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: MOSMO:ENST00000562695.1:c.319_320insTGATCCTTTTCTGTATGGCTGCCCTAATATTTCCAATAGGATTTTACATCAAT:p.(Ser107Metfs*39); MOSMO:ENST00000567004.1:c.265_266insTGATCCTTTTCTGTATGGCTGCCCTAATATTTCCAATAGGATTTTACATCAAT:p.(Ser89Metfs*39); MOSMO:ENST00000542527.2:c.319_319+1insTGATCCTTTTCTGTATGGCTGCCCTAATATTTCCAATAGGATTTTACATCAAT:p.?; MOSMO:ENST00000569656.1:c.250_250+1insTGATCCTTTTCTGTATGGCTGCCCTAATATTTCCAATAGGATTTTACATCAAT:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0138%; gnomAD_E_NFE: 0.0176%; gnomAD_E_OTH: 0.0266%; gnomAD_E_SAS: 0.0176%

APOBR

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 16-28509412-C-T [0/1] rs765533147

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.996 CONTRIBUTING VARIANT

Transcripts:: APOBR:ENST00000328423.5:c.2939C>T:p.(Pro980Leu); APOBR:ENST00000431282.1:c.2939C>T:p.(Pro980Leu); APOBR:ENST00000564831.1:c.2966C>T:p.(Pro989Leu)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: TOPMed: 0.0008%; ExAC EAS: 0.0242%; gnomAD_E_EAS: 0.0315%

KIR3DL2

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.995

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: KIR3DL2:ENST00000270442.5:c.1038G>C:p.(Trp346Cys); KIR3DL2:ENST00000326321.3:c.1089G>C:p.(Trp363Cys)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.995 (D); SIFT: 0.011 (D)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: KIR3DL2:ENST00000270442.5:c.1038G>C:p.(Trp346Cys); KIR3DL2:ENST00000326321.3:c.1089G>C:p.(Trp363Cys)

Pathogenicity Data:: Best Score: 0.995; Polyphen2: 0.995 (D); SIFT: 0.011 (D)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377325-C-T [0/1] rs1338748485

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.993 CONTRIBUTING VARIANT

Transcripts:: KIR3DL2:ENST00000270442.5:c.1015C>T:p.(Leu339Phe); KIR3DL2:ENST00000326321.3:c.1066C>T:p.(Leu356Phe)

Pathogenicity Data:: Best Score: 0.993; Polyphen2: 0.993 (D); SIFT: 0.630 (T)

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 19-55367083-A-G [0/1] rs985925024

Variant score: 0.990

Transcripts:: KIR3DL2:ENST00000270442.5:c.665A>G:p.(Glu222Gly); KIR3DL2:ENST00000326321.3:c.665A>G:p.(Glu222Gly); KIR3DL2:ENST00000402254.2:c.1001-10177A>G:p.(=)

Pathogenicity Data:: Best Score: 0.99; Polyphen2: 0.990 (D); SIFT: 0.118 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377343-C-T [0/1] rs138402445

Variant score: 0.982

Transcripts:: KIR3DL2:ENST00000270442.5:c.1033C>T:p.(Arg345Cys); KIR3DL2:ENST00000326321.3:c.1084C>T:p.(Arg362Cys)

Pathogenicity Data:: Best Score: 0.982; Polyphen2: 0.724 (P); SIFT: 0.018 (D)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0027%

MISSENSE_VARIANT SNV 19-55377302-T-C [0/1] rs1224475740

Variant score: 0.966

Transcripts:: KIR3DL2:ENST00000270442.5:c.992T>C:p.(Val331Ala); KIR3DL2:ENST00000326321.3:c.1043T>C:p.(Val348Ala)

Pathogenicity Data:: Best Score: 0.966; Polyphen2: 0.966 (D); SIFT: 0.105 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377265-T-C [0/1] rs796466301

Variant score: 0.866

Transcripts:: KIR3DL2:ENST00000270442.5:c.955T>C:p.(Cys319Arg); KIR3DL2:ENST00000326321.3:c.1006T>C:p.(Cys336Arg)

Pathogenicity Data:: Best Score: 0.866; SIFT: 0.134 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377280-G-A [0/1] rs796782943

Variant score: 0.848

Transcripts:: KIR3DL2:ENST00000270442.5:c.970G>A:p.(Val324Ile); KIR3DL2:ENST00000326321.3:c.1021G>A:p.(Val341Ile)

Pathogenicity Data:: Best Score: 0.848; Polyphen2: 0.010 (B); SIFT: 0.152 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377875-C-G [0/1] rs973541788

Variant score: 0.600

Transcripts:: KIR3DL2:ENST00000270442.5:c.1105C>G:p.(Gln369Glu); KIR3DL2:ENST00000326321.3:c.1156C>G:p.(Gln386Glu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377319-C-A [0/1] rs1296399738

Variant score: 0.491

Transcripts:: KIR3DL2:ENST00000270442.5:c.1009C>A:p.(Leu337Ile); KIR3DL2:ENST00000326321.3:c.1060C>A:p.(Leu354Ile)

Pathogenicity Data:: Best Score: 0.491; Polyphen2: 0.009 (B); SIFT: 0.509 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 19-55377340-T-C [0/1] rs2915987

Variant score: 0.004

Transcripts:: KIR3DL2:ENST00000270442.5:c.1030T>C:p.(Tyr344His); KIR3DL2:ENST00000326321.3:c.1081T>C:p.(Tyr361His)

Pathogenicity Data:: Best Score: 0.004; Polyphen2: 0.004 (B)

Frequency Data:: gnomAD_E_AMR: 0.0060%

MISSENSE_VARIANT SNV 19-55377307-T-A [0/1] rs2915986

Variant score: 0.001

Transcripts:: KIR3DL2:ENST00000270442.5:c.997T>A:p.(Phe333Ile); KIR3DL2:ENST00000326321.3:c.1048T>A:p.(Phe350Ile)

Pathogenicity Data:: Best Score: 0.001; Polyphen2: 0.001 (B)

Frequency Data:: ExAC NFE: 0.0015%; gnomAD_E_NFE: 0.0009%

BEND5

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.995

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.995

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_VARIANT INS 1-49201966-C-CT [0/1] rs756345162

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.995 CONTRIBUTING VARIANT

Transcripts:: BEND5:ENST00000371833.3:c.1052dup:p.(Lys352Glufs*6); BEND5:ENST00000371838.1:c.635-73054_635-73053insA:p.(=); BEND5:ENST00000371839.1:c.635-73054_635-73053insA:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AFR: 0.0390%; ExAC EAS: 0.0118%; ExAC NFE: 0.0305%; ExAC SAS: 0.0188%

KNG1

Exomiser Score: 0.015

Phenotype Score: 0.285

Variant Score: 0.672

Phenotype matches:

Phenotypic similarity 0.285 to zebrafish mutant involving KNG1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0019878, Meckel's cartilage truncated, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:619363 Angioedema, hereditary, 6 - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.285

Variant Score: 0.672

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-186440260-G-A [0/1] rs775305074

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.672 CONTRIBUTING VARIANT

Transcripts:: KNG1:ENST00000265023.4:c.341G>A:p.(Arg114Lys); KNG1:ENST00000287611.2:c.341G>A:p.(Arg114Lys); KNG1:ENST00000447445.1:c.341G>A:p.(Arg114Lys)

Pathogenicity Data:: Best Score: 0.676; Polyphen2: 0.324 (B); SIFT: 0.324 (T)

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0466%; gnomAD_E_EAS: 0.0232%

FAM47C

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-37027738-C-T [0/1] rs1927713694

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.994 CONTRIBUTING VARIANT

Transcripts:: FAM47C:ENST00000358047.3:c.1255C>T:p.(Pro419Ser)

Pathogenicity Data:: Best Score: 0.994; Polyphen2: 0.994 (D); SIFT: 0.489 (T)

Frequency Data:: No frequency data

X_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-37027738-C-T [0/1] rs1927713694

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.994 CONTRIBUTING VARIANT

Transcripts:: FAM47C:ENST00000358047.3:c.1255C>T:p.(Pro419Ser)

Pathogenicity Data:: Best Score: 0.994; Polyphen2: 0.994 (D); SIFT: 0.489 (T)

Frequency Data:: No frequency data

IMMT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-86393732-T-C [0/1] rs556796647

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.994 CONTRIBUTING VARIANT

Transcripts:: IMMT:ENST00000254636.5:c.394A>G:p.(Thr132Ala); IMMT:ENST00000409051.2:c.550A>G:p.(Thr184Ala); IMMT:ENST00000410111.3:c.691A>G:p.(Thr231Ala); IMMT:ENST00000442664.2:c.688A>G:p.(Thr230Ala); IMMT:ENST00000449247.2:c.658A>G:p.(Thr220Ala)

Pathogenicity Data:: Best Score: 0.999366; Polyphen2: 0.512 (P); Mutation Taster: 0.999 (P); SIFT: 0.171 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0026%; ExAC EAS: 0.0351%; gnomAD_E_EAS: 0.0407%

SDF4

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.993

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.993

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-1159283-G-A [0/1] rs767039287

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.993 CONTRIBUTING VARIANT

Transcripts:: SDF4:ENST00000263741.7:c.392C>T:p.(Thr131Met); SDF4:ENST00000360001.6:c.392C>T:p.(Thr131Met); SDF4:ENST00000545427.1:c.392C>T:p.(Thr131Met)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.980 (D); Mutation Taster: 1.000 (P); SIFT: 0.019 (D)

Frequency Data:: TOPMed: 0.0011%; ExAC FIN: 0.0473%; ExAC NFE: 0.0015%; gnomAD_E_AMR: 0.0030%; gnomAD_E_FIN: 0.0240%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0032%; gnomAD_G_AFR: 0.0116%

UTRN

Exomiser Score: 0.015

Phenotype Score: 0.510

Variant Score: 0.415

Phenotype matches:

Proximity score 0.510 in interactome to FSTL1 and phenotypic similarity 0.735 to mouse mutant of FSTL1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0020040, decreased bone ossification; HP:0011304, Broad thumb - MP:0008730, fused phalanges; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.510

Variant Score: 0.415

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-145073062-C-T [0/1] rs200572757

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.730 CONTRIBUTING VARIANT

Transcripts:: UTRN:ENST00000367526.4:c.994C>T:p.(Leu332Phe); UTRN:ENST00000367545.3:c.8329C>T:p.(Leu2777Phe)

Pathogenicity Data:: Best Score: 0.99938; Polyphen2: 0.934 (P); Mutation Taster: 0.999 (P); SIFT: 0.004 (D)

Frequency Data:: 1000Genomes: 0.1398%; TOPMed: 0.0366%; ExAC EAS: 1.0956%; gnomAD_E_EAS: 1.0302%; gnomAD_E_OTH: 0.0377%; gnomAD_G_EAS: 1.0533%

SYNONYMOUS_VARIANT SNV 6-144898334-G-A [0/1] rs761662499

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: UTRN:ENST00000367545.3:c.7389G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ExAC EAS: 0.0117%; gnomAD_E_EAS: 0.0116%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.510

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-144898334-G-A [0/1] rs761662499

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: UTRN:ENST00000367545.3:c.7389G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ExAC EAS: 0.0117%; gnomAD_E_EAS: 0.0116%

SLC11A2

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.991

Phenotype matches:

No phenotype or PPI evidence

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:206100 Anemia, hypochromic microcytic, with iron overload 1 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.991

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-51385452-G-A [0/1] rs118034836

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.991 CONTRIBUTING VARIANT

Transcripts:: SLC11A2:ENST00000262051.7:c.1351C>T:p.(Pro451Ser); SLC11A2:ENST00000262052.5:c.1351C>T:p.(Pro451Ser); SLC11A2:ENST00000394904.3:c.1438C>T:p.(Pro480Ser); SLC11A2:ENST00000541174.2:c.1351C>T:p.(Pro451Ser); SLC11A2:ENST00000545993.2:c.1339C>T:p.(Pro447Ser); SLC11A2:ENST00000546743.1:c.1114C>T:p.(Pro372Ser); SLC11A2:ENST00000547198.1:c.1351C>T:p.(Pro451Ser); SLC11A2:ENST00000547688.1:c.1438C>T:p.(Pro480Ser)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0200%; ExAC EAS: 0.0604%; gnomAD_E_EAS: 0.0581%; gnomAD_G_EAS: 0.0617%

SAMD1

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.990

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.990

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-14200695-G-A [0/1] rs572586577

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.990 CONTRIBUTING VARIANT

Transcripts:: SAMD1:ENST00000533683.2:c.538C>T:p.(Arg180Cys)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.005 (B); Mutation Taster: 0.995 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0091%; ExAC SAS: 0.0689%; gnomAD_E_NFE: 0.0060%; gnomAD_E_SAS: 0.0263%; gnomAD_G_NFE: 0.0143%

CYP2R1

Exomiser Score: 0.015

Phenotype Score: 0.252

Variant Score: 0.703

Phenotype matches:

Phenotypic similarity 0.506 to Hypocalcemic vitamin D-dependent rickets associated with CYP2R1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002970, Genu varum; HP:0001363, Craniosynostosis - HP:0010537, Wide cranial sutures; HP:0011304, Broad thumb - HP:0002982, Tibial bowing; HP:0010055, Broad hallux - HP:0003029, Enlargement of the ankles

Proximity score 0.504 in interactome to DHCR7 and phenotypic similarity 0.681 to Smith-Lemli-Opitz syndrome associated with DHCR7.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing; HP:0011304, Broad thumb - HP:0009623, Proximal placement of thumb; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Proximity score 0.504 in interactome to DHCR7 and phenotypic similarity 0.737 to mouse mutant of DHCR7.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:600081 Rickets due to defect in vitamin D 25-hydroxylation deficiency - autosomal recessive; ORPHA:289157 Hypocalcemic vitamin D-dependent rickets - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.252

Variant Score: 0.703

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-14913577-A-G [0/1] rs555180485

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.703 CONTRIBUTING VARIANT

Transcripts:: CYP2R1:ENST00000334636.5:c.175T>C:p.(Ser59Pro)

Pathogenicity Data:: Best Score: 0.70500004; Polyphen2: 0.006 (B); SIFT: 0.295 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0004%; gnomAD_E_EAS: 0.0058%

ZFX

Exomiser Score: 0.015

Phenotype Score: 0.501

Variant Score: 0.420

Phenotype matches:

Proximity score 0.501 in interactome to POLA1 and phenotypic similarity 0.625 to X-linked intellectual disability, Van Esch type associated with POLA1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger; HP:0001363, Craniosynostosis - HP:0004440, Coronal craniosynostosis; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.501

Variant Score: 0.420

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-24228952-T-C [0/1] rs371967051

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.420 CONTRIBUTING VARIANT

Transcripts:: ZFX:ENST00000304543.5:c.1877T>C:p.(Ile626Thr); ZFX:ENST00000338565.3:c.1727T>C:p.(Ile576Thr); ZFX:ENST00000379177.1:c.1877T>C:p.(Ile626Thr); ZFX:ENST00000379188.3:c.1877T>C:p.(Ile626Thr); ZFX:ENST00000539115.1:c.1190T>C:p.(Ile397Thr); ZFX:ENST00000540034.1:c.1994T>C:p.(Ile665Thr)

Pathogenicity Data:: Best Score: 0.449; Polyphen2: 0.027 (B); SIFT: 0.551 (T)

Frequency Data:: 1000Genomes: 0.0265%; TOPMed: 0.0185%; ExAC EAS: 0.2411%; ExAC SAS: 0.0099%; gnomAD_E_EAS: 0.2409%; gnomAD_E_SAS: 0.0052%; gnomAD_G_EAS: 0.3854%

FHAD1

Exomiser Score: 0.014

Phenotype Score: 0.000

Variant Score: 0.985

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.014

Phenotype Score: 0.000

Variant Score: 0.985

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-15708597-G-A [0/1] rs138226187

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.985 CONTRIBUTING VARIANT

Transcripts:: FHAD1:ENST00000314740.8:c.1789G>A:p.(Glu597Lys); FHAD1:ENST00000358897.4:c.4030G>A:p.(Glu1344Lys); FHAD1:ENST00000375998.4:c.4030G>A:p.(Glu1344Lys); FHAD1:ENST00000375999.3:c.4030G>A:p.(Glu1344Lys); FHAD1:ENST00000417793.1:c.3922G>A:p.(Glu1308Lys)

Pathogenicity Data:: Best Score: 0.994; Polyphen2: 0.994 (D); SIFT: 0.009 (D)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0004%; gnomAD_E_EAS: 0.0586%; gnomAD_G_EAS: 0.0617%

EVA1C

Exomiser Score: 0.014

Phenotype Score: 0.240

Variant Score: 0.711

Phenotype matches:

Phenotypic similarity 0.240 to mouse mutant involving EVA1C.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002638, abnormal pupillary reflex; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.014

Phenotype Score: 0.240

Variant Score: 0.711

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 21-33840145-T-C [0/1] rs757227833

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.711 CONTRIBUTING VARIANT

Transcripts:: EVA1C:ENST00000300255.2:c.623T>C:p.(Leu208Pro); EVA1C:ENST00000382699.3:c.623T>C:p.(Leu208Pro); EVA1C:ENST00000401402.3:c.623T>C:p.(Leu208Pro)

Pathogenicity Data:: Best Score: 0.71099997; Polyphen2: 0.015 (B); SIFT: 0.289 (T)

Frequency Data:: No frequency data

C15orf39

Exomiser Score: 0.013

Phenotype Score: 0.000

Variant Score: 0.979

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.013

Phenotype Score: 0.000

Variant Score: 0.979

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 15-75500578-C-T [0/1] rs1388490359

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.979 CONTRIBUTING VARIANT

Transcripts:: C15orf39:ENST00000360639.2:c.2189C>T:p.(Ala730Val); C15orf39:ENST00000394987.4:c.2189C>T:p.(Ala730Val); C15orf39:ENST00000567617.1:c.2189C>T:p.(Ala730Val)

Pathogenicity Data:: Best Score: 0.979; Polyphen2: 0.008 (B); SIFT: 0.021 (D)

Frequency Data:: TOPMed: 0.0004%

ZNF407

Exomiser Score: 0.011

Phenotype Score: 0.318

Variant Score: 0.600

Phenotype matches:

Phenotypic similarity 0.318 to mouse mutant involving ZNF407.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.011

Phenotype Score: 0.318

Variant Score: 0.600

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 18-72343286-G-C [0/1] rs200972611

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: ZNF407:ENST00000299687.5:c.311G>C:p.(Gly104Ala); ZNF407:ENST00000309902.6:c.311G>C:p.(Gly104Ala); ZNF407:ENST00000577538.1:c.311G>C:p.(Gly104Ala); ZNF407:ENST00000582337.1:c.311G>C:p.(Gly104Ala)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ExAC NFE: 0.0030%; gnomAD_E_NFE: 0.0018%

POTEC

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.939

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.939

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 18-14513678-T-G [0/1] rs28606506

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.939 CONTRIBUTING VARIANT

Transcripts:: POTEC:ENST00000358970.5:c.1516A>C:p.(Lys506Gln)

Pathogenicity Data:: Best Score: 0.939; Polyphen2: 0.137 (B); SIFT: 0.061 (T)

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.005

Phenotype Score: 0.000

Variant Score: 0.862

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 18-14513678-T-G [0/1] rs28606506

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.939 CONTRIBUTING VARIANT

Transcripts:: POTEC:ENST00000358970.5:c.1516A>C:p.(Lys506Gln)

Pathogenicity Data:: Best Score: 0.939; Polyphen2: 0.137 (B); SIFT: 0.061 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 18-14533084-T-C [0/1] rs202042216

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]

Variant score: 0.785 CONTRIBUTING VARIANT

Transcripts:: POTEC:ENST00000358970.5:c.1031A>G:p.(Tyr344Cys)

Pathogenicity Data:: Best Score: 0.998; Polyphen2: 0.998 (D); SIFT: 0.007 (D)

Frequency Data:: TOPMed: 0.0404%; gnomAD_E_EAS: 0.9464%; gnomAD_E_SAS: 0.0136%; gnomAD_G_EAS: 0.9375%

CCDC88B

Exomiser Score: 0.009

Phenotype Score: 0.500

Variant Score: 0.368

Phenotype matches:

Proximity score 0.500 in interactome to STAMBP and phenotypic similarity 0.666 to Microcephaly-capillary malformation syndrome associated with STAMBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.500 in interactome to STAMBP and phenotypic similarity 0.268 to mouse mutant of STAMBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.009

Phenotype Score: 0.500

Variant Score: 0.368

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-64111665-C-T [0/1] rs79318041

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.492 CONTRIBUTING VARIANT

Transcripts:: CCDC88B:ENST00000356786.5:c.1652C>T:p.(Pro551Leu); CCDC88B:ENST00000301897.4:c.-2193C>T:p.(=)

Pathogenicity Data:: Best Score: 0.996; Polyphen2: 0.056 (B); SIFT: 0.004 (D)

Frequency Data:: 1000Genomes: 0.3395%; TOPMed: 0.2203%; ESP AA: 0.3862%; ESP EA: 0.0116%; ESP All: 0.1385%; ExAC AFR: 0.2759%; ExAC AMR: 0.0346%; ExAC EAS: 1.5552%; ExAC NFE: 0.0046%; ExAC OTH: 0.3341%; ExAC SAS: 0.4931%; gnomAD_E_AFR: 0.2755%; gnomAD_E_AMR: 0.0273%; gnomAD_E_EAS: 1.5382%; gnomAD_E_NFE: 0.0054%; gnomAD_E_OTH: 0.2033%; gnomAD_E_SAS: 0.5660%; gnomAD_G_AFR: 0.2754%; gnomAD_G_AMR: 0.2387%; gnomAD_G_EAS: 1.0481%; gnomAD_G_NFE: 0.0067%; gnomAD_G_OTH: 0.1020%

MISSENSE_VARIANT SNV 11-64121190-C-G [0/1] rs80109197

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.244 CONTRIBUTING VARIANT

Transcripts:: CCDC88B:ENST00000356786.5:c.3837C>G:p.(Asp1279Glu); CCDC88B:ENST00000359902.2:c.1293C>G:p.(Asp431Glu); CCDC88B:ENST00000301897.4:c.-8C>G:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.296 (B); Mutation Taster: 1.000 (P); SIFT: 0.137 (T)

Frequency Data:: 1000Genomes: 0.5791%; TOPMed: 0.1991%; ESP AA: 0.1363%; ESP EA: 0.0233%; ESP All: 0.0616%; ExAC AFR: 0.1445%; ExAC AMR: 0.0432%; ExAC EAS: 1.8848%; ExAC NFE: 0.0075%; ExAC OTH: 0.4415%; ExAC SAS: 0.3696%; gnomAD_E_AFR: 0.1372%; gnomAD_E_AMR: 0.0357%; gnomAD_E_EAS: 1.7683%; gnomAD_E_FIN: 0.0045%; gnomAD_E_NFE: 0.0090%; gnomAD_E_OTH: 0.2007%; gnomAD_E_SAS: 0.4256%; gnomAD_G_AFR: 0.1953%; gnomAD_G_AMR: 0.2387%; gnomAD_G_EAS: 0.9271%; gnomAD_G_NFE: 0.0201%; gnomAD_G_OTH: 0.1020%

Other passed variants:

SYNONYMOUS_VARIANT SNV 11-64109160-G-C [0/1] rs79183699

Variant score: 0.049

Transcripts:: CCDC88B:ENST00000356786.5:c.621G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.3395%; TOPMed: 0.2180%; ESP AA: 0.3635%; ESP EA: 0.0116%; ESP All: 0.1308%; ExAC AFR: 0.2819%; ExAC AMR: 0.0353%; ExAC EAS: 1.5585%; ExAC NFE: 0.0048%; ExAC OTH: 0.3817%; ExAC SAS: 0.5178%; gnomAD_E_AFR: 0.2741%; gnomAD_E_AMR: 0.0277%; gnomAD_E_EAS: 1.5260%; gnomAD_E_NFE: 0.0056%; gnomAD_E_OTH: 0.1701%; gnomAD_E_SAS: 0.5276%; gnomAD_G_AFR: 0.2880%; gnomAD_G_AMR: 0.2392%; gnomAD_G_EAS: 1.0533%; gnomAD_G_NFE: 0.0067%; gnomAD_G_OTH: 0.1033%

SYNONYMOUS_VARIANT SNV 11-64108207-C-T [0/1] rs78194959

Variant score: 0.048

Transcripts:: CCDC88B:ENST00000356786.5:c.189C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.2995%; TOPMed: 0.1557%; ESP AA: 0.0929%; ESP EA: 0.0117%; ESP All: 0.0390%; ExAC AFR: 0.0430%; ExAC AMR: 0.0348%; ExAC EAS: 1.5789%; ExAC NFE: 0.0047%; ExAC OTH: 0.3480%; ExAC SAS: 0.3821%; gnomAD_E_AFR: 0.0594%; gnomAD_E_AMR: 0.0270%; gnomAD_E_EAS: 1.5352%; gnomAD_E_NFE: 0.0056%; gnomAD_E_OTH: 0.2038%; gnomAD_E_SAS: 0.4014%; gnomAD_G_AFR: 0.0575%; gnomAD_G_AMR: 0.2387%; gnomAD_G_EAS: 1.1111%; gnomAD_G_NFE: 0.0067%; gnomAD_G_OTH: 0.1025%

POTED

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.931

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.931

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 21-14982886-G-A [1/1] rs6517869

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.931 CONTRIBUTING VARIANT

Transcripts:: POTED:ENST00000299443.5:c.337G>A:p.(Gly113Ser)

Pathogenicity Data:: Best Score: 0.937; Polyphen2: 0.937 (P); SIFT: 0.153 (T)

Frequency Data:: gnomAD_E_AFR: 0.0481%; gnomAD_E_NFE: 0.0078%; gnomAD_E_SAS: 0.0092%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 21-14992475-T-C [0/1] rs3865072

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: POTED:ENST00000299443.5:c.918-4T>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 21-15013735-A-G [1/1] rs9980783

Variant score: 0.785

Transcripts:: POTED:ENST00000299443.5:c.1603A>G:p.(Met535Val)

Pathogenicity Data:: Best Score: 0.78499997; Polyphen2: 0.007 (B); SIFT: 0.215 (T)

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 21-14982952-A-G [1/1] rs6517870

Variant score: 0.590

Transcripts:: POTED:ENST00000299443.5:c.403A>G:p.(Ile135Val)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.1207%; gnomAD_E_FIN: 0.0120%; gnomAD_E_NFE: 0.0233%; gnomAD_G_FIN: 0.0794%; gnomAD_G_NFE: 0.0210%

MISSENSE_VARIANT SNV 21-14982577-A-G [0/1] rs373326718

Variant score: 0.274

Transcripts:: POTED:ENST00000299443.5:c.28A>G:p.(Thr10Ala)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.1953%; gnomAD_G_EAS: 1.6129%; gnomAD_G_FIN: 0.2466%; gnomAD_G_NFE: 0.0846%

MISSENSE_VARIANT SNV 21-14982586-A-G [0/1] rs200720062

Variant score: 0.100

Transcripts:: POTED:ENST00000299443.5:c.37A>G:p.(Thr13Ala)

Pathogenicity Data:: Best Score: 0.100000024; SIFT: 0.900 (T)

Frequency Data:: No frequency data

AOC2

Exomiser Score: 0.008

Phenotype Score: 0.504

Variant Score: 0.357

Phenotype matches:

Proximity score 0.504 in interactome to COMT and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with COMT.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.008

Phenotype Score: 0.504

Variant Score: 0.357

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 17-40997924-G-T [0/1] rs34351794

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.616 CONTRIBUTING VARIANT

Transcripts:: AOC2:ENST00000253799.3:c.1281G>T:p.(Glu427Asp); AOC2:ENST00000452774.2:c.1281G>T:p.(Glu427Asp)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 1.000 (D); Mutation Taster: 1.000 (P); SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.2995%; TOPMed: 0.0359%; ExAC AMR: 0.0087%; ExAC EAS: 1.2500%; ExAC SAS: 0.0061%; gnomAD_E_EAS: 1.3451%; gnomAD_E_OTH: 0.0182%; gnomAD_G_EAS: 0.8642%; gnomAD_G_NFE: 0.0067%; gnomAD_G_OTH: 0.1018%

SYNONYMOUS_VARIANT SNV 17-40998215-G-A [0/1] rs1268712624

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.098 CONTRIBUTING VARIANT

Transcripts:: AOC2:ENST00000253799.3:c.1572G>A:p.(=); AOC2:ENST00000452774.2:c.1572G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_EAS: 0.0066%; gnomAD_G_AMR: 0.1199%

COL18A1

Exomiser Score: 0.008

Phenotype Score: 0.509

Variant Score: 0.345

Phenotype matches:

Phenotypic similarity 0.426 to Knobloch syndrome associated with COL18A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Phenotypic similarity 0.342 to mouse mutant involving COL18A1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.509 in interactome to CTSK and phenotypic similarity 0.712 to Pycnodysostosis associated with CTSK.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0009839, Osteolytic defects of the distal phalanges of the hand; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.509 in interactome to CTSK and phenotypic similarity 0.698 to mouse mutant of CTSK.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology

Known diseases:: OMIM:267750 Knobloch syndrome, type 1 - autosomal recessive; OMIM:618880 Glaucoma, primary closed-angle - autosomal dominant; ORPHA:1571 Knobloch syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.008

Phenotype Score: 0.509

Variant Score: 0.345

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.426 to ORPHA:1571 Knobloch syndrome

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 21-46925297-C-CCCCCCTGGG [0/1] rs749507428

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.656 CONTRIBUTING VARIANT

Transcripts:: COL18A1:ENST00000355480.5:c.3597_3605dup:p.(Pro1200_Gly1202dup); COL18A1:ENST00000359759.4:c.4302_4310dup:p.(Pro1435_Gly1437dup); COL18A1:ENST00000400337.2:c.3057_3065dup:p.(Pro1020_Gly1022dup); COL18A1:ENST00000567670.1:c.1294-6772_1294-6771insCCCAGGGGG:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ESP AA: 0.1488%; ESP EA: 0.2895%; ESP All: 0.2464%; ExAC AFR: 0.0565%; ExAC AMR: 0.0140%; ExAC EAS: 0.2064%; ExAC FIN: 0.0229%; ExAC NFE: 0.1054%; ExAC SAS: 0.1092%; gnomAD_E_AFR: 0.0430%; gnomAD_E_AMR: 0.0337%; gnomAD_E_EAS: 0.2364%; gnomAD_E_FIN: 0.0187%; gnomAD_E_NFE: 0.0931%; gnomAD_E_OTH: 0.1179%; gnomAD_E_SAS: 0.1207%; gnomAD_G_AFR: 0.0807%; gnomAD_G_EAS: 0.9877%; gnomAD_G_NFE: 0.1943%

SYNONYMOUS_VARIANT SNV 21-46925161-G-C [0/1] rs367651350

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]

ClinVar: BENIGN_OR_LIKELY_BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.034 CONTRIBUTING VARIANT

Transcripts:: COL18A1:ENST00000355480.5:c.3522G>C:p.(=); COL18A1:ENST00000359759.4:c.4227G>C:p.(=); COL18A1:ENST00000400337.2:c.2982G>C:p.(=); COL18A1:ENST00000567670.1:c.1294-6635C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 1.7770%; TOPMed: 0.4922%; ESP AA: 0.0847%; ESP All: 0.0259%; ExAC AFR: 1.3370%; ExAC AMR: 0.0794%; ExAC EAS: 1.6159%; ExAC NFE: 0.0252%; ExAC OTH: 0.4601%; ExAC SAS: 0.0138%; gnomAD_E_AFR: 1.1691%; gnomAD_E_AMR: 0.0758%; gnomAD_E_EAS: 1.4811%; gnomAD_E_NFE: 0.0220%; gnomAD_E_OTH: 0.1177%; gnomAD_E_SAS: 0.0267%; gnomAD_G_AFR: 1.3263%; gnomAD_G_AMR: 0.2410%; gnomAD_G_EAS: 1.4180%; gnomAD_G_NFE: 0.0067%; gnomAD_G_OTH: 0.5165%

FCGBP

Exomiser Score: 0.008

Phenotype Score: 0.286

Variant Score: 0.595

Phenotype matches:

Phenotypic similarity 0.286 to mouse mutant involving FCGBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.008

Phenotype Score: 0.286

Variant Score: 0.595

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-40433068-C-A [0/1] rs773836016

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.595 CONTRIBUTING VARIANT

Transcripts:: FCGBP:ENST00000221347.6:c.1201G>T:p.(Ala401Ser)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0234%; gnomAD_E_EAS: 0.0180%; gnomAD_G_EAS: 0.0617%

ANKRD36

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.903

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.903

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-97911776-T-C [1/1] rs200778176

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.903 CONTRIBUTING VARIANT

Transcripts:: ANKRD36:ENST00000357042.4:c.193T>C:p.(Cys65Arg); ANKRD36:ENST00000420699.2:c.5452T>C:p.(Cys1818Arg); ANKRD36:ENST00000461153.2:c.5452T>C:p.(Cys1818Arg)

Pathogenicity Data:: Best Score: 0.903; Polyphen2: 0.010 (B); SIFT: 0.097 (T)

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 2-97911802-A-G [0/1] rs1262462446

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ANKRD36:ENST00000357042.4:c.219A>G:p.(=); ANKRD36:ENST00000420699.2:c.5478A>G:p.(=); ANKRD36:ENST00000461153.2:c.5478A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

MISSENSE_VARIANT SNV 2-97779551-A-T [0/1] rs531465456

Variant score: 0.613

Transcripts:: ANKRD36:ENST00000420699.2:c.75A>T:p.(Gln25His); ANKRD36:ENST00000461153.2:c.75A>T:p.(Gln25His)

Pathogenicity Data:: Best Score: 0.666; Polyphen2: 0.074 (B); SIFT: 0.334 (T)

Frequency Data:: 1000Genomes: 0.2596%; TOPMed: 0.2596%; ExAC EAS: 0.1058%; ExAC NFE: 0.0045%; gnomAD_E_EAS: 0.0180%; gnomAD_E_NFE: 0.0054%; gnomAD_G_AFR: 0.1516%; gnomAD_G_AMR: 0.2410%; gnomAD_G_EAS: 0.4642%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 2-97779555-C-T [0/1] rs542428195

Variant score: 0.550

Transcripts:: ANKRD36:ENST00000420699.2:c.79C>T:p.(Pro27Ser); ANKRD36:ENST00000461153.2:c.79C>T:p.(Pro27Ser)

Pathogenicity Data:: Best Score: 0.607; SIFT: 0.393 (T)

Frequency Data:: 1000Genomes: 0.3195%; TOPMed: 0.3195%; ExAC EAS: 0.1647%; ExAC NFE: 0.0030%; gnomAD_E_EAS: 0.0479%; gnomAD_E_NFE: 0.0045%; gnomAD_G_AFR: 0.1166%; gnomAD_G_AMR: 0.2398%; gnomAD_G_EAS: 0.5277%; gnomAD_G_NFE: 0.0067%

MISSENSE_VARIANT SNV 2-97779556-C-A [0/1] rs374398264

Variant score: 0.376

Transcripts:: ANKRD36:ENST00000420699.2:c.80C>A:p.(Pro27His); ANKRD36:ENST00000461153.2:c.80C>A:p.(Pro27His)

Pathogenicity Data:: Best Score: 0.41500002; SIFT: 0.585 (T)

Frequency Data:: 1000Genomes: 0.3195%; TOPMed: 0.3195%; ExAC EAS: 0.1646%; ExAC NFE: 0.0030%; gnomAD_E_EAS: 0.1085%; gnomAD_E_NFE: 0.0045%; gnomAD_G_AFR: 0.1164%; gnomAD_G_AMR: 0.2404%; gnomAD_G_EAS: 0.5256%; gnomAD_G_NFE: 0.0067%

ZNF185

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.898

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.898

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-152101490-G-A [0/1] rs782117827

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.898 CONTRIBUTING VARIANT

Transcripts:: ZNF185:ENST00000318504.7:c.916G>A:p.(Val306Ile); ZNF185:ENST00000318529.8:c.430G>A:p.(Val144Ile); ZNF185:ENST00000370268.4:c.1093G>A:p.(Val365Ile); ZNF185:ENST00000370270.2:c.1093G>A:p.(Val365Ile); ZNF185:ENST00000449285.2:c.1096G>A:p.(Val366Ile); ZNF185:ENST00000535861.1:c.1093G>A:p.(Val365Ile); ZNF185:ENST00000539731.1:c.1006G>A:p.(Val336Ile); ZNF185:ENST00000324823.6:c.422+4285G>A:p.(=)

Pathogenicity Data:: Best Score: 0.929; Polyphen2: 0.059 (B); SIFT: 0.071 (T)

Frequency Data:: TOPMed: 0.0068%; ExAC EAS: 0.2218%; gnomAD_E_EAS: 0.1415%; gnomAD_E_OTH: 0.0276%; gnomAD_G_EAS: 0.0966%

LRCH4

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.896

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.896

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-100174621-G-A [0/1] rs199982219

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.896 CONTRIBUTING VARIANT

Transcripts:: LRCH4:ENST00000310300.6:c.1372C>T:p.(Pro458Ser); LRCH4:ENST00000497245.1:c.16C>T:p.(Pro6Ser)

Pathogenicity Data:: Best Score: 0.904; Polyphen2: 0.003 (B); SIFT: 0.096 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0008%; gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.826

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-100174621-G-A [0/1] rs199982219

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.896 CONTRIBUTING VARIANT

Transcripts:: LRCH4:ENST00000310300.6:c.1372C>T:p.(Pro458Ser); LRCH4:ENST00000497245.1:c.16C>T:p.(Pro6Ser)

Pathogenicity Data:: Best Score: 0.904; Polyphen2: 0.003 (B); SIFT: 0.096 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0008%; gnomAD_G_EAS: 0.0617%

MISSENSE_VARIANT SNV 7-100172813-A-G [0/1] rs201639027

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.756 CONTRIBUTING VARIANT

Transcripts:: LRCH4:ENST00000310300.6:c.1969T>C:p.(Ser657Pro); LRCH4:ENST00000497245.1:c.613T>C:p.(Ser205Pro)

Pathogenicity Data:: Best Score: 0.936815; Polyphen2: 0.001 (B); Mutation Taster: 0.937; SIFT: 0.211 (T)

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0144%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC EAS: 0.1047%; ExAC FIN: 0.8862%; ExAC NFE: 0.0647%; ExAC OTH: 0.1333%; ExAC SAS: 0.0067%; gnomAD_E_EAS: 0.0407%; gnomAD_E_FIN: 0.7570%; gnomAD_E_NFE: 0.0318%; gnomAD_E_OTH: 0.1112%; gnomAD_E_SAS: 0.0065%; gnomAD_G_EAS: 0.0617%; gnomAD_G_FIN: 0.7450%; gnomAD_G_NFE: 0.0804%; gnomAD_G_OTH: 0.2049%

ZNF773

Exomiser Score: 0.005

Phenotype Score: 0.500

Variant Score: 0.309

Phenotype matches:

Proximity score 0.500 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003109, short femur; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0003109, short femur; HP:0010055, Broad hallux - MP:0003109, short femur

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.005

Phenotype Score: 0.500

Variant Score: 0.309

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-58018149-G-C [0/1] rs768330529

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.309 CONTRIBUTING VARIANT

Transcripts:: ZNF773:ENST00000282292.4:c.686G>C:p.(Ser229Thr); ZNF773:ENST00000598770.1:c.683G>C:p.(Ser228Thr); ZNF773:ENST00000593916.1:c.259+1381G>C:p.(=); ZNF773:ENST00000599847.1:c.262+1381G>C:p.(=)

Pathogenicity Data:: Best Score: 0.31; Polyphen2: 0.023 (B); SIFT: 0.690 (T)

Frequency Data:: TOPMed: 0.0008%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0174%

NAALADL2

Exomiser Score: 0.004

Phenotype Score: 0.306

Variant Score: 0.504

Phenotype matches:

Phenotypic similarity 0.306 to mouse mutant involving NAALADL2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.306

Variant Score: 0.504

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-175165119-C-A [0/1] rs1485352972

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.504 CONTRIBUTING VARIANT

Transcripts:: NAALADL2:ENST00000454872.1:c.1193C>A:p.(Thr398Asn)

Pathogenicity Data:: Best Score: 0.504; Polyphen2: 0.001 (B); SIFT: 0.496 (T)

Frequency Data:: TOPMed: 0.0004%

GOLGA6L2

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 15-23685922-C-CCCGCATCTTCTCCTCCTGCTT [0/1] rs748500078

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: UNCERTAIN_SIGNIFICANCE (no assertion criteria provided)

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: GOLGA6L2:ENST00000567107.1:c.1699_1700insAAGCAGGAGGAGAAGATGCGG:p.(Ala566_Gly567insGluAlaGlyGlyGluAspAla); GOLGA6L2:ENST00000312015.5:c.1632+67_1632+68insAAGCAGGAGGAGAAGATGCGG:p.(=); GOLGA6L2:ENST00000345070.5:c.811+69_811+70insAAGCAGGAGGAGAAGATGCGG:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

HRCT1

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS 9-35906583-T-TCCACCACCACCA [0/1] rs79156963

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: HRCT1:ENST00000354323.2:c.305_316dup:p.(His102_His105dup)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

NPIPB15

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_DELETION DEL 16-74425558-CCCTCTTCCACCCTCT-C [0/1] rs59612184

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: NPIPB15:ENST00000429990.1:c.927_941del:p.(Pro310_Ser314del)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

RPL14

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.

Variants contributing to score:

INFRAME_DELETION DEL 3-40503520-ACTG-A [-/1] rs57354599

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]

Variant score: 0.850 CONTRIBUTING VARIANT

Transcripts:: RPL14:ENST00000338970.6:c.475_477del:p.(Ala159del); RPL14:ENST00000396203.2:c.475_477del:p.(Ala159del); RPL14:ENST00000416518.1:c.*98_*100del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

PDE4D

Exomiser Score: 0.004

Phenotype Score: 0.663

Variant Score: 0.099

Phenotype matches:

Phenotypic similarity 0.663 to Acrodysostosis with multiple hormone resistance associated with PDE4D.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger; HP:0010055, Broad hallux - HP:0001831, Short toe

Known diseases:: OMIM:614613 Acrodysostosis 2, with or without hormone resistance - autosomal dominant; ORPHA:280651 Acrodysostosis with multiple hormone resistance - autosomal dominant; ORPHA:950 Acrodysostosis - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.663

Variant Score: 0.099

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.663 to ORPHA:280651 Acrodysostosis with multiple hormone resistance
Phenotypic similarity 0.656 to ORPHA:950 Acrodysostosis
Phenotypic similarity 0.654 to OMIM:614613 Acrodysostosis 2, with or without hormone resistance

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 5-59189192-C-T [0/1] rs1013897220

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4, BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PDE4D:ENST00000340635.6:c.258G>A:p.(=); PDE4D:ENST00000502484.2:c.272+95123G>A:p.(=); PDE4D:ENST00000546160.1:c.272+95123G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0026%; gnomAD_G_EAS: 0.0619%

KPTN

Exomiser Score: 0.004

Phenotype Score: 0.741

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.741 to Macrocephaly-developmental delay syndrome associated with KPTN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

Phenotypic similarity 0.318 to mouse mutant involving KPTN.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:615637 Mental retardation, autosomal recessive 41 - autosomal recessive; ORPHA:397612 Macrocephaly-developmental delay syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.159

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-47979804-G-C [0/1] rs562237338

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: KPTN:ENST00000338134.3:c.1167C>G:p.(=); KPTN:ENST00000536339.1:c.447C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0024%; ExAC EAS: 0.0352%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0523%

LSR

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.833

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.833

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-35758059-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.833 CONTRIBUTING VARIANT

Transcripts:: LSR:ENST00000347609.4:c.1162C>T:p.(Pro388Ser); LSR:ENST00000354900.3:c.1279C>T:p.(Pro427Ser); LSR:ENST00000360798.3:c.1132C>T:p.(Pro378Ser); LSR:ENST00000361790.3:c.1336C>T:p.(Pro446Ser); LSR:ENST00000427250.1:c.868C>T:p.(Pro290Ser); LSR:ENST00000602122.1:c.1276C>T:p.(Pro426Ser)

Pathogenicity Data:: Best Score: 0.833; Polyphen2: 0.718 (P); SIFT: 0.167 (T)

Frequency Data:: No frequency data

SMG9

Exomiser Score: 0.004

Phenotype Score: 0.736

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.590 to Heart and brain malformation syndrome associated with SMG9.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0100490, Camptodactyly of finger; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0100490, Camptodactyly of finger

Phenotypic similarity 0.736 to mouse mutant involving SMG9.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis - MP:0001297, microphthalmia; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

Proximity score 0.501 in interactome to RPL27 and phenotypic similarity 0.670 to Blackfan-Diamond anemia associated with RPL27.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb; HP:0010055, Broad hallux - HP:0001199, Triphalangeal thumb

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:616920 Heart and brain malformation syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.368

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-44242304-G-A [0/1] rs774216418

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SMG9:ENST00000270066.6:c.879C>T:p.(=); SMG9:ENST00000601170.1:c.879C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC SAS: 0.0182%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0162%

MUC22

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.832

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.832

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_VARIANT DEL 6-30994887-CCA-C [0/1] rs755828374

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.947 CONTRIBUTING VARIANT

Transcripts:: MUC22:ENST00000561890.1:c.1680_1681del:p.(Ile561Argfs*3)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0348%; gnomAD_E_AMR: 0.2382%; gnomAD_E_EAS: 0.0103%; gnomAD_E_FIN: 0.1303%; gnomAD_E_NFE: 0.3321%; gnomAD_E_OTH: 0.3049%; gnomAD_E_SAS: 0.0802%; gnomAD_G_AFR: 0.0476%; gnomAD_G_AMR: 0.1279%; gnomAD_G_EAS: 0.1882%; gnomAD_G_NFE: 0.2690%; gnomAD_G_OTH: 0.2183%

MISSENSE_VARIANT SNV 6-30994879-G-A [0/1] rs539565454

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.718 CONTRIBUTING VARIANT

Transcripts:: MUC22:ENST00000561890.1:c.1671G>A:p.(Met557Ile)

Pathogenicity Data:: Best Score: 0.909; SIFT: 0.091 (T)

Frequency Data:: 1000Genomes: 0.9385%; TOPMed: 0.9385%; gnomAD_E_AFR: 0.6878%; gnomAD_E_AMR: 0.4289%; gnomAD_E_EAS: 0.3625%; gnomAD_E_FIN: 0.1513%; gnomAD_E_NFE: 0.5904%; gnomAD_E_OTH: 0.5532%; gnomAD_E_SAS: 0.1038%; gnomAD_G_AFR: 0.6377%; gnomAD_G_AMR: 0.3947%; gnomAD_G_EAS: 0.1951%; gnomAD_G_FIN: 0.0311%; gnomAD_G_NFE: 0.4824%; gnomAD_G_OTH: 0.3488%

Other passed variants:

MISSENSE_VARIANT SNV 6-30993419-A-G [0/1] rs117024916

Variant score: 0.456

Transcripts:: MUC22:ENST00000561890.1:c.211A>G:p.(Thr71Ala)

Pathogenicity Data:: Best Score: 0.61; SIFT: 0.390 (T)

Frequency Data:: 1000Genomes: 0.4593%; TOPMed: 0.1949%; UK10K: 0.0661%; ExAC NFE: 0.5654%; ExAC SAS: 0.0534%; gnomAD_E_AFR: 0.0853%; gnomAD_E_AMR: 0.5208%; gnomAD_E_EAS: 1.0548%; gnomAD_E_FIN: 0.0189%; gnomAD_E_NFE: 0.0775%; gnomAD_E_OTH: 0.2576%; gnomAD_E_SAS: 0.0490%; gnomAD_G_AFR: 0.0690%; gnomAD_G_AMR: 0.4773%; gnomAD_G_EAS: 0.2472%; gnomAD_G_NFE: 0.0869%

MISSENSE_VARIANT SNV 6-30997275-C-G [0/1] rs146685560

Variant score: 0.328

Transcripts:: MUC22:ENST00000561890.1:c.4067C>G:p.(Thr1356Arg)

Pathogenicity Data:: Best Score: 0.897; SIFT: 0.103 (T)

Frequency Data:: 1000Genomes: 0.9984%; TOPMed: 1.1600%; UK10K: 0.5157%; ExAC AFR: 1.5957%; ExAC NFE: 0.5499%; ExAC SAS: 0.1866%; gnomAD_E_AFR: 1.7188%; gnomAD_E_AMR: 0.6434%; gnomAD_E_EAS: 1.0870%; gnomAD_E_FIN: 0.2267%; gnomAD_E_NFE: 0.9553%; gnomAD_E_OTH: 1.0321%; gnomAD_E_SAS: 0.1693%; gnomAD_G_AFR: 1.7376%; gnomAD_G_AMR: 0.4773%; gnomAD_G_EAS: 0.2481%; gnomAD_G_FIN: 0.0574%; gnomAD_G_NFE: 0.9964%; gnomAD_G_OTH: 0.7187%

MISSENSE_VARIANT SNV 6-30994878-T-C [0/1] rs770369929

Variant score: 0.310

Transcripts:: MUC22:ENST00000561890.1:c.1670T>C:p.(Met557Thr)

Pathogenicity Data:: Best Score: 0.35799998; SIFT: 0.642 (T)

Frequency Data:: gnomAD_E_AFR: 0.6881%; gnomAD_E_AMR: 0.4515%; gnomAD_E_EAS: 0.3624%; gnomAD_E_FIN: 0.1942%; gnomAD_E_NFE: 0.5975%; gnomAD_E_OTH: 0.5832%; gnomAD_E_SAS: 0.1039%; gnomAD_G_AFR: 0.6418%; gnomAD_G_AMR: 0.3927%; gnomAD_G_EAS: 0.1940%; gnomAD_G_FIN: 0.0310%; gnomAD_G_NFE: 0.4875%; gnomAD_G_OTH: 0.3488%

MISSENSE_VARIANT SNV 6-30994232-A-G [0/1] rs116938859

Variant score: 0.094

Transcripts:: MUC22:ENST00000561890.1:c.1024A>G:p.(Met342Val)

Pathogenicity Data:: Best Score: 0.13499999; SIFT: 0.865 (T)

Frequency Data:: 1000Genomes: 0.5791%; TOPMed: 0.5791%; UK10K: 0.5290%; ExAC AFR: 0.5263%; ExAC NFE: 0.6886%; ExAC SAS: 0.2089%; gnomAD_E_AFR: 0.2236%; gnomAD_E_AMR: 0.6378%; gnomAD_E_EAS: 1.1623%; gnomAD_E_FIN: 0.2587%; gnomAD_E_NFE: 1.0961%; gnomAD_E_OTH: 1.1710%; gnomAD_E_SAS: 0.1863%; gnomAD_G_AFR: 0.2950%; gnomAD_G_AMR: 0.3817%; gnomAD_G_EAS: 0.2522%; gnomAD_G_FIN: 0.0606%; gnomAD_G_NFE: 1.0753%; gnomAD_G_OTH: 0.6593%

SYNONYMOUS_VARIANT SNV 6-30994876-T-C [0/1] rs568996220

Variant score: 0.077

Transcripts:: MUC22:ENST00000561890.1:c.1668T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.9984%; TOPMed: 0.9984%; gnomAD_E_AFR: 0.7052%; gnomAD_E_AMR: 0.4500%; gnomAD_E_EAS: 0.3628%; gnomAD_E_FIN: 0.2160%; gnomAD_E_NFE: 0.6163%; gnomAD_E_OTH: 0.6146%; gnomAD_E_SAS: 0.1039%; gnomAD_G_AFR: 0.6429%; gnomAD_G_AMR: 0.3866%; gnomAD_G_EAS: 0.1926%; gnomAD_G_FIN: 0.0307%; gnomAD_G_NFE: 0.5068%; gnomAD_G_OTH: 0.3409%

MISSENSE_VARIANT SNV 6-30994778-A-G [0/1] rs117058095

Variant score: 0.000

Transcripts:: MUC22:ENST00000561890.1:c.1570A>G:p.(Lys524Glu)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: 1000Genomes: 0.9984%; TOPMed: 0.9984%; UK10K: 0.5554%; ExAC AFR: 1.5957%; ExAC NFE: 0.7645%; ExAC SAS: 0.2083%; gnomAD_E_AFR: 1.7562%; gnomAD_E_AMR: 0.7959%; gnomAD_E_EAS: 1.1526%; gnomAD_E_FIN: 0.2579%; gnomAD_E_NFE: 1.1191%; gnomAD_E_OTH: 1.1417%; gnomAD_E_SAS: 0.1863%; gnomAD_G_AFR: 1.7490%; gnomAD_G_AMR: 0.5141%; gnomAD_G_EAS: 0.2513%; gnomAD_G_FIN: 0.0305%; gnomAD_G_NFE: 1.1230%; gnomAD_G_OTH: 0.8734%

TTC28

Exomiser Score: 0.003

Phenotype Score: 0.552

Variant Score: 0.198

Phenotype matches:

Phenotypic similarity 0.552 to mouse mutant involving TTC28.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology; HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion; HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology; HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.552

Variant Score: 0.198

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 22-29075636-G-T [0/1] rs748336223

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.373 CONTRIBUTING VARIANT

Transcripts:: TTC28:ENST00000397906.2:c.76C>A:p.(Pro26Thr)

Pathogenicity Data:: Best Score: 0.853; Polyphen2: 0.014 (B); SIFT: 0.147 (T)

Frequency Data:: ExAC SAS: 0.0189%; gnomAD_E_AMR: 0.1508%; gnomAD_E_EAS: 0.5597%; gnomAD_E_FIN: 0.0271%; gnomAD_E_NFE: 0.0238%; gnomAD_E_OTH: 0.1422%; gnomAD_E_SAS: 0.0449%; gnomAD_G_AFR: 0.1916%; gnomAD_G_AMR: 1.0234%; gnomAD_G_EAS: 0.0657%; gnomAD_G_FIN: 1.6406%; gnomAD_G_NFE: 0.0556%; gnomAD_G_OTH: 0.2212%

SYNONYMOUS_VARIANT SNV 22-29075634-T-G [0/1] rs1288874226

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.022 CONTRIBUTING VARIANT

Transcripts:: TTC28:ENST00000397906.2:c.78A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.1421%; gnomAD_E_EAS: 0.3257%; gnomAD_E_FIN: 0.0517%; gnomAD_E_NFE: 0.0273%; gnomAD_E_OTH: 0.1979%; gnomAD_E_SAS: 0.0430%; gnomAD_G_AFR: 0.2551%; gnomAD_G_AMR: 1.0938%; gnomAD_G_EAS: 0.2199%; gnomAD_G_FIN: 1.9108%; gnomAD_G_NFE: 0.1018%; gnomAD_G_OTH: 0.2370%

CLTCL1

Exomiser Score: 0.003

Phenotype Score: 0.501

Variant Score: 0.251

Phenotype matches:

Proximity score 0.501 in interactome to ANTXR2 and phenotypic similarity 0.651 to Infantile systemic hyalinosis associated with ANTXR2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.501

Variant Score: 0.251

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 22-19222234-A-G [0/1] rs117574531

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.402 CONTRIBUTING VARIANT

Transcripts:: CLTCL1:ENST00000263200.10:c.970-5T>C:p.?; CLTCL1:ENST00000353891.5:c.970-5T>C:p.?; CLTCL1:ENST00000427926.1:c.970-5T>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1198%; TOPMed: 0.0932%; ExAC EAS: 1.1714%; ExAC SAS: 0.0063%; gnomAD_E_EAS: 1.2929%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0366%; gnomAD_E_SAS: 0.0065%; gnomAD_G_EAS: 1.5432%

SYNONYMOUS_VARIANT SNV 22-19203638-A-C [0/1] rs782014996

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CLTCL1:ENST00000263200.10:c.3048T>G:p.(=); CLTCL1:ENST00000353891.5:c.3048T>G:p.(=); CLTCL1:ENST00000427926.1:c.3048T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC SAS: 0.0062%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0033%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 22-19203638-A-C [0/1] rs782014996

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CLTCL1:ENST00000263200.10:c.3048T>G:p.(=); CLTCL1:ENST00000353891.5:c.3048T>G:p.(=); CLTCL1:ENST00000427926.1:c.3048T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC SAS: 0.0062%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0033%

SP100

Exomiser Score: 0.003

Phenotype Score: 0.503

Variant Score: 0.248

Phenotype matches:

Proximity score 0.503 in interactome to IRF6 and phenotypic similarity 0.533 to Autosomal dominant popliteal pterygium syndrome associated with IRF6.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.503 in interactome to IRF6 and phenotypic similarity 0.715 to mouse mutant of IRF6.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0000060, delayed bone ossification; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.503

Variant Score: 0.248

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-231281027-G-A [0/1] rs151275724

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.402 CONTRIBUTING VARIANT

Transcripts:: SP100:ENST00000264052.5:c.16G>A:p.(Gly6Ser); SP100:ENST00000340126.4:c.16G>A:p.(Gly6Ser); SP100:ENST00000341950.4:c.16G>A:p.(Gly6Ser); SP100:ENST00000409112.1:c.16G>A:p.(Gly6Ser); SP100:ENST00000409341.1:c.16G>A:p.(Gly6Ser); SP100:ENST00000409824.1:c.16G>A:p.(Gly6Ser); SP100:ENST00000427101.2:c.16G>A:p.(Gly6Ser)

Pathogenicity Data:: Best Score: 0.436; Polyphen2: 0.002 (B); SIFT: 0.564 (T)

Frequency Data:: 1000Genomes: 0.0998%; TOPMed: 0.0155%; ExAC EAS: 0.4600%; gnomAD_E_EAS: 0.4531%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0184%; gnomAD_E_SAS: 0.0065%; gnomAD_G_EAS: 0.4326%

SYNONYMOUS_VARIANT SNV 2-231380145-C-T [0/1] rs186365701

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.094 CONTRIBUTING VARIANT

Transcripts:: SP100:ENST00000264052.5:c.2430C>T:p.(=); SP100:ENST00000340126.4:c.2094+4264C>T:p.(=); SP100:ENST00000502802.1:n.408C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0191%; ExAC EAS: 0.2661%; gnomAD_E_EAS: 0.3711%; gnomAD_E_OTH: 0.0183%; gnomAD_G_EAS: 0.3717%

ZNF789

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.814

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.814

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 7-99084932-G-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.814 CONTRIBUTING VARIANT

Transcripts:: ZNF789:ENST00000331410.5:c.1099G>A:p.(Glu367Lys); ZNF789:ENST00000493485.1:c.130+7522G>A:p.(=)

Pathogenicity Data:: Best Score: 0.81406; Polyphen2: 0.001 (B); Mutation Taster: 0.814; SIFT: 1.000 (T)

Frequency Data:: No frequency data

KIR3DL3

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.806

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.806

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55239223-G-A [1/1] rs270790

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.806 CONTRIBUTING VARIANT

Transcripts:: KIR3DL3:ENST00000291860.1:c.502G>A:p.(Val168Ile); KIR3DL3:ENST00000402254.2:c.34+3188G>A:p.(=); KIR3DL3:ENST00000538269.1:c.34+3188G>A:p.(=); KIR3DL3:ENST00000541392.1:c.34+3188G>A:p.(=); KIR3DL3:ENST00000396284.2:c.34+3188G>A:p.(=)

Pathogenicity Data:: Best Score: 0.806; SIFT: 0.194 (T)

Frequency Data:: No frequency data

RBMXL3

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

No phenotype matches to diseases with this MOI.

Variants contributing to score:

INFRAME_INSERTION INS X-114425181-A-AGAGGCCGCTCGCCCAACACCCACAGCG [-/1] rs781849390

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM4]

Variant score: 0.805 CONTRIBUTING VARIANT

Transcripts:: RBMXL3:ENST00000424776.3:c.1191_1192insAACACCCACAGCGGAGGCCGCTCGCCC:p.(Pro397_Asp398insAsnThrHisSerGlyGlyArgSerPro); RBMXL3:ENST00000317135.8:c.350-2249_350-2248insCGCTGTGGGTGTTGGGCGAGCGGCCTC:p.(=); RBMXL3:ENST00000538422.1:c.350-2249_350-2248insCGCTGTGGGTGTTGGGCGAGCGGCCTC:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC EAS: 0.2294%; gnomAD_G_EAS: 0.3279%; gnomAD_G_NFE: 0.0104%

CDC20B

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-54439387-T-C [0/1] rs1214750545

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.805 CONTRIBUTING VARIANT

Transcripts:: CDC20B:ENST00000296733.1:c.440A>G:p.(His147Arg); CDC20B:ENST00000322374.6:c.440A>G:p.(His147Arg); CDC20B:ENST00000331730.3:c.377A>G:p.(His126Arg); CDC20B:ENST00000334206.5:c.440A>G:p.(His147Arg); CDC20B:ENST00000381375.2:c.440A>G:p.(His147Arg)

Pathogenicity Data:: Best Score: 0.805; Polyphen2: 0.004 (B); SIFT: 0.195 (T)

Frequency Data:: gnomAD_E_FIN: 0.0045%

BAGE2

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 21-11021215-T-TA [0/1] rs71222366

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: BAGE2:ENST00000470054.1:n.1714-5_1714-4insT:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT INS 21-11021215-T-TA [0/1] rs71222366

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: BAGE2:ENST00000470054.1:n.1714-5_1714-4insT:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 21-11029594-G-T [0/1] rs10433054

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: BAGE2:ENST00000470054.1:n.1596+4C>A:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

Other passed variants:

SPLICE_REGION_VARIANT SNV 21-11038722-C-A [0/1] rs10433074

Variant score: 0.800

Transcripts:: BAGE2:ENST00000470054.1:n.1476+6G>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT DEL 21-11098703-CACTCCAGCCGCCATCTTACT-C [0/1] rs374894507

Variant score: 0.800

Transcripts:: BAGE2:ENST00000470054.1:n.203_222del:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

ELAPOR2

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 7-86556236-CAAA-C [0/1] rs397698585

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: ELAPOR2:ENST00000297222.6:c.370-7_370-5del:p.?; ELAPOR2:ENST00000416314.1:c.589-7_589-5del:p.?; ELAPOR2:ENST00000444627.1:c.1090-7_1090-5del:p.?; ELAPOR2:ENST00000450689.2:c.1090-7_1090-5del:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MST1P2

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 1-16972920-C-T [0/1] rs4661882

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: MST1P2:ENST00000334429.5:n.158C>T:; MST1P2:ENST00000418421.2:n.123C>T:; MST1P2:ENST00000457982.3:n.114C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

PTAR1

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 9-72349174-TAAA-T [0/1] rs398010830

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: PTAR1:ENST00000340434.4:c.324-7_324-5del:p.?; PTAR1:ENST00000377200.5:c.87-7_87-5del:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

RP11-391M20.1

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 9-68728828-T-G [0/1] rs1587029293

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: RP11-391M20.1:ENST00000427066.1:n.62-6T>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 9-68728828-T-G [0/1] rs1587029293

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: RP11-391M20.1:ENST00000427066.1:n.62-6T>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPLICE_REGION_VARIANT SNV 9-68728895-C-T [0/1] rs1587029322

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: RP11-391M20.1:ENST00000427066.1:n.123C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

RP11-87H9.2

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 9-69082238-TTG-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: RP11-87H9.2:ENST00000424707.1:n.253+7_253+8del:; RP11-87H9.2:ENST00000591037.1:n.1445-1477_1445-1476del:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SRSF10

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT DEL 1-24294450-CA-C [-/1] rs36002299

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: SRSF10:ENST00000374452.5:c.492-5del:p.?; SRSF10:ENST00000374453.3:c.489-5del:p.?; SRSF10:ENST00000344989.6:c.492-238del:p.(=); SRSF10:ENST00000453840.3:c.489-238del:p.(=); SRSF10:ENST00000484146.2:c.438-238del:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

THSD1

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:

No phenotype or PPI evidence

Known diseases:: OMIM:618734 ?Aneurysm, intracranial berry, 12 (unconfirmed); ORPHA:231160 Familial cerebral saccular aneurysm - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 13-52971362-C-A [0/1] rs1594103112

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.800 CONTRIBUTING VARIANT

Transcripts:: THSD1:ENST00000258613.4:c.1021+5G>T:p.?; THSD1:ENST00000349258.4:c.1021+5G>T:p.?; THSD1:ENST00000544466.1:c.-117+8804G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

CDK11B

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.799

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.799

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 1-1573856-A-C [0/1] rs1034314512

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.799 CONTRIBUTING VARIANT

Transcripts:: CDK11B:ENST00000317673.7:c.1345+6T>G:p.?; CDK11B:ENST00000340677.5:c.1312+6T>G:p.?; CDK11B:ENST00000341832.6:c.1210+6T>G:p.?; CDK11B:ENST00000407249.3:c.1351+6T>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_EAS: 0.0096%

DPYD

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.795

Phenotype matches:

Phenotypic similarity 0.333 to Dihydropyrimidine dehydrogenase deficiency associated with DPYD.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001799, Short nail; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0002656, Epiphyseal dysplasia; HP:0010055, Broad hallux - HP:0001799, Short nail

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:274270 Dihydropyrimidine dehydrogenase deficiency - autosomal recessive; ORPHA:1675 Dihydropyrimidine dehydrogenase deficiency - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.795

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 1-97915615-G-A [0/1] rs3918289

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.795 CONTRIBUTING VARIANT

Transcripts:: DPYD:ENST00000370192.3:c.1905C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0253%; UK10K: 0.0264%; ESP EA: 0.0465%; ESP All: 0.0308%; ExAC AMR: 0.0087%; ExAC NFE: 0.0480%; ExAC SAS: 0.0182%; gnomAD_E_AMR: 0.0060%; gnomAD_E_NFE: 0.0188%; gnomAD_E_OTH: 0.0365%; gnomAD_E_SAS: 0.0162%; gnomAD_G_NFE: 0.0133%

PDZD9

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.793

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.793

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 16-22000120-G-C [0/1] rs1363119099

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.793 CONTRIBUTING VARIANT

Transcripts:: PDZD9:ENST00000286143.6:c.26-8C>G:p.?; PDZD9:ENST00000424898.2:c.212-8C>G:p.?; PDZD9:ENST00000537222.2:c.32-8C>G:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; gnomAD_G_EAS: 0.0618%

ZNF815P

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.788

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.788

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 7-5873158-A-G [0/1] rs890163657

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.788 CONTRIBUTING VARIANT

Transcripts:: ZNF815P:ENST00000421890.1:n.471A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_EAS: 0.0646%; gnomAD_G_FIN: 0.0304%; gnomAD_G_NFE: 0.0206%; gnomAD_G_OTH: 0.1073%

SPLICE_REGION_VARIANT SNV 7-5873160-A-G [0/1] rs1316435088

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.788 CONTRIBUTING VARIANT

Transcripts:: ZNF815P:ENST00000421890.1:n.473A>G:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.0241%; gnomAD_G_EAS: 0.0643%; gnomAD_G_FIN: 0.0305%; gnomAD_G_NFE: 0.0275%; gnomAD_G_OTH: 0.1073%

GNPTAB

Exomiser Score: 0.002

Phenotype Score: 0.693

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.693 to Mucolipidosis III alpha/beta associated with GNPTAB.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0006162, Soft tissue swelling of interphalangeal joints; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0006162, Soft tissue swelling of interphalangeal joints; HP:0010055, Broad hallux - HP:0006162, Soft tissue swelling of interphalangeal joints

Phenotypic similarity 0.482 to mouse mutant involving GNPTAB.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0006395, abnormal epiphyseal plate morphology; HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology

Phenotypic similarity 0.463 to zebrafish mutant involving GNPTAB.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0019548, endochondral bone decreased occurrence ossification, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to FURIN and phenotypic similarity 0.935 to mouse mutant of FURIN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Proximity score 0.500 in interactome to FURIN and phenotypic similarity 0.274 to fish mutant of FURIN.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0006947, symplectic in contact with Meckel's cartilage, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:252500 Mucolipidosis II alpha/beta - autosomal recessive; OMIM:252600 Mucolipidosis III alpha/beta - autosomal recessive; ORPHA:576 Mucolipidosis type II - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 12-102158191-G-A [0/1] rs550940255

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.000 CONTRIBUTING VARIANT

Transcripts:: GNPTAB:ENST00000299314.7:c.2504C>T:p.(Pro835Leu)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B); SIFT: 1.000 (T)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0023%; ExAC EAS: 0.0579%; gnomAD_E_EAS: 0.0697%

CASP5

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.768

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.768

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-104878038-C-T [0/1] rs1172126398

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.768 CONTRIBUTING VARIANT

Transcripts:: CASP5:ENST00000260315.3:c.205G>A:p.(Val69Ile); CASP5:ENST00000393139.2:c.106G>A:p.(Val36Ile); CASP5:ENST00000393141.2:c.244G>A:p.(Val82Ile); CASP5:ENST00000444749.2:c.31G>A:p.(Val11Ile); CASP5:ENST00000526056.1:c.244G>A:p.(Val82Ile); CASP5:ENST00000418434.1:c.8-3928G>A:p.(=); CASP5:ENST00000531367.1:c.8-3928G>A:p.(=)

Pathogenicity Data:: Best Score: 0.768; Polyphen2: 0.001 (B); SIFT: 0.232 (T)

Frequency Data:: TOPMed: 0.0011%

IGF2R

Exomiser Score: 0.002

Phenotype Score: 0.382

Variant Score: 0.332

Phenotype matches:

Phenotypic similarity 0.763 to mouse mutant involving IGF2R.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0003416, premature bone ossification; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria; HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003109, short femur; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0003109, short femur; HP:0010055, Broad hallux - MP:0003109, short femur

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:114550 Hepatocellular carcinoma, somatic - somatic

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.382

Variant Score: 0.332

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 6-160485490-G-A [0/1] rs8191859

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.563 CONTRIBUTING VARIANT

Transcripts:: IGF2R:ENST00000356956.1:c.3944G>A:p.(Gly1315Glu)

Pathogenicity Data:: Best Score: 0.985; Polyphen2: 0.867 (P); SIFT: 0.015 (D)

Frequency Data:: 1000Genomes: 0.2396%; TOPMed: 0.0996%; ExAC AMR: 0.0086%; ExAC EAS: 1.3982%; ExAC NFE: 0.0015%; ExAC OTH: 0.1101%; gnomAD_E_AMR: 0.0089%; gnomAD_E_EAS: 1.4263%; gnomAD_E_NFE: 0.0045%; gnomAD_E_OTH: 0.0912%; gnomAD_G_EAS: 0.9864%; gnomAD_G_NFE: 0.0133%; gnomAD_G_OTH: 0.1018%

SYNONYMOUS_VARIANT SNV 6-160455457-G-A [0/1] rs145133650

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: IGF2R:ENST00000356956.1:c.1218G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0096%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0065%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.382

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-160455457-G-A [0/1] rs145133650

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: IGF2R:ENST00000356956.1:c.1218G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0096%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0065%

Other passed variants:

SYNONYMOUS_VARIANT SNV 6-160482897-C-T [0/1] rs116968873

Variant score: 0.091

Transcripts:: IGF2R:ENST00000356956.1:c.3519C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0268%; ESP EA: 0.0233%; ESP All: 0.0154%; ExAC EAS: 0.4622%; ExAC NFE: 0.0225%; gnomAD_E_EAS: 0.5044%; gnomAD_E_NFE: 0.0170%; gnomAD_E_OTH: 0.0182%; gnomAD_E_SAS: 0.0032%; gnomAD_G_AFR: 0.0114%; gnomAD_G_EAS: 0.3083%; gnomAD_G_NFE: 0.0400%

ALG13

Exomiser Score: 0.002

Phenotype Score: 0.541

Variant Score: 0.150

Phenotype matches:

Phenotypic similarity 0.541 to X-linked non-syndromic intellectual disability associated with ALG13.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers; HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly

Phenotypic similarity 0.318 to mouse mutant involving ALG13.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:300884 ?Congenital disorder of glycosylation, type Is (unconfirmed); OMIM:300884 Developmental and epileptic encephalopathy 36 - X-linked dominant; ORPHA:324422 ALG13-CDG - X-linked dominant; ORPHA:777 X-linked non-syndromic intellectual disability - X-linked recessive

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.541

Variant Score: 0.150

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to ORPHA:777 X-linked non-syndromic intellectual disability

Variants contributing to score:

DISRUPTIVE_INFRAME_INSERTION INS X-110987953-T-TACC [0/1] rs762039180

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.150 CONTRIBUTING VARIANT

Transcripts:: ALG13:ENST00000394780.3:c.2796_2798dup:p.(Pro945dup); ALG13:ENST00000251943.4:c.2383+7846_2383+7847insACC:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AMR: 0.0831%; ExAC NFE: 0.0401%; gnomAD_E_AFR: 0.3811%; gnomAD_E_AMR: 0.1167%; gnomAD_E_EAS: 0.2426%; gnomAD_E_FIN: 0.0282%; gnomAD_E_NFE: 0.1428%; gnomAD_E_OTH: 0.2959%; gnomAD_E_SAS: 0.1309%; gnomAD_G_AFR: 0.8772%; gnomAD_G_AMR: 0.2179%; gnomAD_G_EAS: 1.9582%; gnomAD_G_FIN: 0.4594%; gnomAD_G_NFE: 0.8895%; gnomAD_G_OTH: 0.8197%

SERPINA9

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.760

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.760

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 14-94933567-T-A [0/1] rs1358181806

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.760 CONTRIBUTING VARIANT

Transcripts:: SERPINA9:ENST00000298845.7:c.535A>T:p.(Met179Leu); SERPINA9:ENST00000337425.5:c.835A>T:p.(Met279Leu); SERPINA9:ENST00000380365.3:c.781A>T:p.(Met261Leu); SERPINA9:ENST00000424550.2:c.388A>T:p.(Met130Leu); SERPINA9:ENST00000448305.2:c.541A>T:p.(Met181Leu); SERPINA9:ENST00000546329.1:c.727A>T:p.(Met243Leu)

Pathogenicity Data:: Best Score: 0.76; Polyphen2: 0.596 (P); SIFT: 0.240 (T)

Frequency Data:: TOPMed: 0.0015%

EPS8L1

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.756

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.756

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-55598675-G-T [0/1] rs759944712

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]

Variant score: 0.967 CONTRIBUTING VARIANT

Transcripts:: EPS8L1:ENST00000201647.6:c.1957G>T:p.(Val653Leu); EPS8L1:ENST00000245618.5:c.1576G>T:p.(Val526Leu); EPS8L1:ENST00000540810.1:c.1765G>T:p.(Val589Leu); EPS8L1:ENST00000588359.1:c.1015G>T:p.(Val339Leu); EPS8L1:ENST00000586329.1:c.1561-221G>T:p.(=)

Pathogenicity Data:: Best Score: 1.0; Polyphen2: 0.986 (D); Mutation Taster: 1.000 (P); SIFT: 0.005 (D)

Frequency Data:: TOPMed: 0.0032%; ExAC EAS: 0.2187%; gnomAD_E_EAS: 0.0855%

MISSENSE_VARIANT SNV 19-55597526-G-A [0/1] rs140692049

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.544 CONTRIBUTING VARIANT

Transcripts:: EPS8L1:ENST00000201647.6:c.1616G>A:p.(Arg539Gln); EPS8L1:ENST00000245618.5:c.1235G>A:p.(Arg412Gln); EPS8L1:ENST00000540810.1:c.1424G>A:p.(Arg475Gln); EPS8L1:ENST00000588359.1:c.674G>A:p.(Arg225Gln); EPS8L1:ENST00000586329.1:c.1560+185G>A:p.(=)

Pathogenicity Data:: Best Score: 0.61300004; Polyphen2: 0.002 (B); SIFT: 0.387 (T)

Frequency Data:: 1000Genomes: 0.0998%; TOPMed: 0.0113%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AMR: 0.0174%; ExAC EAS: 0.1391%; ExAC FIN: 0.0152%; ExAC NFE: 0.0108%; ExAC OTH: 0.2398%; ExAC SAS: 0.6030%; gnomAD_E_EAS: 0.1051%; gnomAD_E_FIN: 0.0093%; gnomAD_E_NFE: 0.0122%; gnomAD_E_OTH: 0.0572%; gnomAD_E_SAS: 0.4967%; gnomAD_G_NFE: 0.0067%; gnomAD_G_OTH: 0.2045%

TTC7A

Exomiser Score: 0.002

Phenotype Score: 0.667

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.340 to Combined immunodeficiency-enteropathy spectrum associated with TTC7A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0008404, Nail dystrophy; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0008404, Nail dystrophy; HP:0010055, Broad hallux - HP:0008404, Nail dystrophy

Phenotypic similarity 0.667 to mouse mutant involving TTC7A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000579, abnormal nail morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000579, abnormal nail morphology; HP:0010055, Broad hallux - MP:0000579, abnormal nail morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:243150 Gastrointestinal defects and immunodeficiency syndrome - autosomal recessive; ORPHA:2300 Multiple intestinal atresia - autosomal recessive; ORPHA:436252 Combined immunodeficiency-enteropathy spectrum - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.334

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 2-47300999-C-T [0/1] rs200826158

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: TTC7A:ENST00000263737.6:c.1452C>T:p.(=); TTC7A:ENST00000319190.5:c.2514C>T:p.(=); TTC7A:ENST00000394850.2:c.2586C>T:p.(=); TTC7A:ENST00000409245.1:c.2412C>T:p.(=); TTC7A:ENST00000422269.1:c.*656-7723G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0023%; ExAC EAS: 0.0465%; ExAC NFE: 0.0030%; ExAC SAS: 0.0121%; gnomAD_E_EAS: 0.0464%; gnomAD_E_NFE: 0.0036%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0065%

AGTRAP

Exomiser Score: 0.002

Phenotype Score: 0.500

Variant Score: 0.183

Phenotype matches:

Proximity score 0.500 in interactome to PRKD1 and phenotypic similarity 0.756 to Congenital heart defects and ectodermal dysplasia associated with PRKD1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001159, Syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0001159, Syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.500

Variant Score: 0.183

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-11810230-A-G [0/1] rs1393371560

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.183 CONTRIBUTING VARIANT

Transcripts:: AGTRAP:ENST00000314340.5:c.461A>G:p.(Gln154Arg); AGTRAP:ENST00000376629.4:c.440A>G:p.(Gln147Arg); AGTRAP:ENST00000510878.1:c.355A>G:p.(Lys119Glu); AGTRAP:ENST00000376627.2:c.*114A>G:p.(=); AGTRAP:ENST00000376637.3:c.*69A>G:p.(=); AGTRAP:ENST00000400895.2:c.*114A>G:p.(=); AGTRAP:ENST00000452018.2:c.*69A>G:p.(=)

Pathogenicity Data:: Best Score: 0.18300003; Polyphen2: 0.060 (B); SIFT: 0.817 (T)

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_EAS: 0.0058%

NPIPB6

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.747

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.747

No phenotype matches to diseases with this MOI.

Variants contributing to score:

FRAMESHIFT_TRUNCATION DEL 16-28354288-AGC-A [0/1] rs2411938

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.805 CONTRIBUTING VARIANT

Transcripts:: NPIPB6:ENST00000532254.1:c.916_917del:p.(Ala306Serfs*13); NPIPB6:ENST00000533640.1:c.862_863del:p.(Ala288Serfs*13)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0225%; gnomAD_E_FIN: 0.8937%; gnomAD_E_NFE: 0.1165%; gnomAD_E_SAS: 0.0038%; gnomAD_G_AFR: 0.0250%; gnomAD_G_FIN: 0.0309%; gnomAD_G_NFE: 0.0658%

INFRAME_INSERTION INS 16-28354287-G-GGAC [0/1] rs757446940

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]

Variant score: 0.690 CONTRIBUTING VARIANT

Transcripts:: NPIPB6:ENST00000532254.1:c.918_919insGTC:p.(Ala306_Pro307insVal); NPIPB6:ENST00000533640.1:c.864_865insGTC:p.(Ala288_Pro289insVal)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0341%; gnomAD_E_FIN: 0.8713%; gnomAD_E_NFE: 0.1408%; gnomAD_E_SAS: 0.0039%; gnomAD_G_AFR: 0.0238%; gnomAD_G_FIN: 0.0586%; gnomAD_G_NFE: 0.0578%

PTH

Exomiser Score: 0.002

Phenotype Score: 0.571

Variant Score: 0.099

Phenotype matches:

Phenotypic similarity 0.571 to mouse mutant involving PTH.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004634, short metacarpal bones; HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization; HP:0011304, Broad thumb - MP:0004634, short metacarpal bones; HP:0010055, Broad hallux - MP:0004635, short metatarsal bones

Proximity score 0.518 in interactome to MGP and phenotypic similarity 0.623 to Keutel syndrome associated with MGP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009778, Short thumb; HP:0010055, Broad hallux - HP:0010109, Short hallux

Proximity score 0.518 in interactome to MGP and phenotypic similarity 0.527 to mouse mutant of MGP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0003055, abnormal long bone epiphyseal plate morphology; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0003055, abnormal long bone epiphyseal plate morphology; HP:0010055, Broad hallux - MP:0003055, abnormal long bone epiphyseal plate morphology

Known diseases:: OMIM:146200 Hypoparathyroidism, familial isolated 1 - autosomal dominant/recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.571

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 11-13514165-A-G [0/1] rs149916515

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PTH:ENST00000282091.1:c.135T>C:p.(=); PTH:ENST00000529816.1:c.135T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0004%; ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0232%

C1orf87

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.724

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.724

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-60456370-G-A [0/1] rs748270844

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.724 CONTRIBUTING VARIANT

Transcripts:: C1orf87:ENST00000371201.3:c.1616C>T:p.(Ala539Val); C1orf87:ENST00000395552.1:c.518C>T:p.(Ala173Val); C1orf87:ENST00000450089.2:c.929C>T:p.(Ala310Val)

Pathogenicity Data:: Best Score: 0.725; Polyphen2: 0.582 (P); SIFT: 0.275 (T)

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0058%

USP17L18

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.722

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.722

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 4-9250456-G-A [0/1] rs772097128

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.722 CONTRIBUTING VARIANT

Transcripts:: USP17L18:ENST00000504209.1:c.101G>A:p.(Arg34Gln)

Pathogenicity Data:: Best Score: 0.722; Polyphen2: 0.258 (B); SIFT: 0.278 (T)

Frequency Data:: No frequency data

ZNF546

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.694

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.694

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-40512079-C-T [0/1] rs757487205

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.694 CONTRIBUTING VARIANT

Transcripts:: ZNF546:ENST00000347077.4:c.161C>T:p.(Thr54Ile); ZNF546:ENST00000600094.1:c.83C>T:p.(Thr28Ile); ZNF546:ENST00000596894.1:c.76+6502C>T:p.(=)

Pathogenicity Data:: Best Score: 0.7; Polyphen2: 0.035 (B); SIFT: 0.300 (T)

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0233%; gnomAD_G_EAS: 0.0617%

EN2

Exomiser Score: 0.001

Phenotype Score: 0.520

Variant Score: 0.100

Phenotype matches:

Proximity score 0.520 in interactome to ZIC1 and phenotypic similarity 0.698 to Isolated brachycephaly associated with ZIC1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly; HP:0011304, Broad thumb - HP:0009701, Metacarpal synostosis; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.520

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-155251474-A-G [0/1] rs1350806900

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: EN2:ENST00000297375.4:c.402A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_G_NFE: 0.0067%

USP4

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.117

Phenotype matches:

Proximity score 0.501 in interactome to NEPRO and phenotypic similarity 0.710 to Anauxetic dysplasia 3 associated with NEPRO.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0009844, Broad middle phalanx of finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.117

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-49337917-G-A [0/1] rs1263578277

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.117 CONTRIBUTING VARIANT

Transcripts:: USP4:ENST00000265560.4:c.1495C>T:p.(His499Tyr); USP4:ENST00000351842.4:c.1354C>T:p.(His452Tyr)

Pathogenicity Data:: Best Score: 0.116999984; Polyphen2: 0.010 (B); SIFT: 0.883 (T)

Frequency Data:: TOPMed: 0.0042%; gnomAD_E_AFR: 0.0065%; gnomAD_E_NFE: 0.0009%; gnomAD_G_NFE: 0.0067%

RYR2

Exomiser Score: 0.001

Phenotype Score: 0.516

Variant Score: 0.100

Phenotype matches:

Proximity score 0.516 in interactome to ASPH and phenotypic similarity 0.737 to mouse mutant of ASPH.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

Known diseases:: OMIM:115000 Ventricular arrythmias due to cardiac ryanodine receptor calcium release deficiency syndrome - autosomal dominant; OMIM:600996 Arrhythmogenic right ventricular dysplasia 2 - autosomal dominant; OMIM:604772 Ventricular tachycardia, catecholaminergic polymorphic, 1 - autosomal dominant; ORPHA:3286 Catecholaminergic polymorphic ventricular tachycardia - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.516

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-237713945-G-A [0/1] rs1183058696

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]

ClinVar: LIKELY_BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: RYR2:ENST00000360064.6:c.3162G>A:p.(=); RYR2:ENST00000366574.2:c.3168G>A:p.(=); RYR2:ENST00000542537.1:c.3120G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; gnomAD_E_EAS: 0.0232%

FOXE3

Exomiser Score: 0.001

Phenotype Score: 0.514

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.427 to Familial thoracic aortic aneurysm and aortic dissection associated with FOXE3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001166, Arachnodactyly; HP:0010055, Broad hallux - HP:0001166, Arachnodactyly

Phenotypic similarity 0.376 to mouse mutant involving FOXE3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005545, abnormal lens development; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.514 in interactome to ZEB2 and phenotypic similarity 0.818 to Mowat-Wilson syndrome due to monosomy 2q22 associated with ZEB2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis - HP:0011317, Right unicoronal synostosis; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Known diseases:: OMIM:610256 Anterior segment dysgenesis 2, multiple subtypes - autosomal recessive; OMIM:617349 Aortic aneurysm, familial thoracic 11, susceptibility to (susceptibility); ORPHA:708 Peters anomaly - autosomal dominant/recessive; ORPHA:83461 Congenital primary aphakia - autosomal recessive; ORPHA:91387 Familial thoracic aortic aneurysm and aortic dissection - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.514

Variant Score: 0.100

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.427 to ORPHA:91387 Familial thoracic aortic aneurysm and aortic dissection

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-47882536-G-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: FOXE3:ENST00000335071.2:c.549G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

TP73

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

Phenotype matches:

Phenotypic similarity 0.484 to mouse mutant involving TP73.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000440, domed cranium; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.511 in interactome to IFT57 and phenotypic similarity 0.652 to ?Orofaciodigital syndrome XVIII associated with IFT57.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0005819, Short middle phalanx of finger; HP:0010055, Broad hallux - HP:0001852, Sandal gap

Proximity score 0.511 in interactome to IFT57 and phenotypic similarity 0.732 to mouse mutant of IFT57.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0006197, ocular hypotelorism; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-3624160-C-T [0/1] rs201173391

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: TP73:ENST00000346387.4:c.234C>T:p.(=); TP73:ENST00000354437.4:c.234C>T:p.(=); TP73:ENST00000357733.3:c.234C>T:p.(=); TP73:ENST00000378280.1:c.87C>T:p.(=); TP73:ENST00000378285.1:c.87C>T:p.(=); TP73:ENST00000378288.4:c.87C>T:p.(=); TP73:ENST00000378290.4:c.21C>T:p.(=); TP73:ENST00000378295.4:c.234C>T:p.(=); TP73:ENST00000603362.1:c.234C>T:p.(=); TP73:ENST00000604074.1:c.234C>T:p.(=); TP73:ENST00000604479.1:c.234C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0034%; ExAC EAS: 0.0466%; ExAC SAS: 0.0488%; gnomAD_E_EAS: 0.0754%; gnomAD_E_SAS: 0.0455%; gnomAD_G_EAS: 0.0617%

KIF4B

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

Phenotype matches:

Proximity score 0.511 in interactome to KIF22 and phenotypic similarity 0.657 to Spondyloepimetaphyseal dysplasia with joint laxity, type 2 associated with KIF22.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0012296, Slender distal phalanx of finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger; HP:0010055, Broad hallux - HP:0012296, Slender distal phalanx of finger

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 5-154396863-C-T [0/1] rs139879144

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: KIF4B:ENST00000435029.4:c.3444C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0079%; ExAC EAS: 0.0347%; ExAC NFE: 0.0030%; gnomAD_E_AFR: 0.0065%; gnomAD_E_EAS: 0.0870%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0032%; gnomAD_G_NFE: 0.0067%

GPC5

Exomiser Score: 0.001

Phenotype Score: 0.510

Variant Score: 0.100

Phenotype matches:

Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.332 to Hypogonadotropic hypogonadism 15 with or without anosmia associated with HS6ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002857, Genu valgum; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0002857, Genu valgum; HP:0010055, Broad hallux - HP:0002857, Genu valgum

Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.783 to mouse mutant of HS6ST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005104, abnormal tarsal bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.510

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 13-92101163-G-A [0/1] rs942126306

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: GPC5:ENST00000377067.3:c.312G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0033%

KALRN

Exomiser Score: 0.001

Phenotype Score: 0.508

Variant Score: 0.099

Phenotype matches:

Proximity score 0.508 in interactome to GRHL2 and phenotypic similarity 0.347 to Ectodermal dysplasia/short stature syndrome associated with GRHL2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0008404, Nail dystrophy; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0008404, Nail dystrophy; HP:0010055, Broad hallux - HP:0008404, Nail dystrophy

Proximity score 0.508 in interactome to GRHL2 and phenotypic similarity 0.756 to mouse mutant of GRHL2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.508

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-124390619-G-A [0/1] rs201086875

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: KALRN:ENST00000291478.5:c.1722G>A:p.(=); KALRN:ENST00000360013.3:c.6813G>A:p.(=); KALRN:ENST00000393496.1:c.1836G>A:p.(=); KALRN:ENST00000428018.2:c.1626G>A:p.(=); KALRN:ENST00000459915.1:c.1089G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0060%; ExAC AMR: 0.0086%; ExAC EAS: 0.0116%; ExAC NFE: 0.0015%; ExAC SAS: 0.0363%; gnomAD_E_AMR: 0.0089%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0227%; gnomAD_G_NFE: 0.0067%

KCNH2

Exomiser Score: 0.001

Phenotype Score: 0.507

Variant Score: 0.100

Phenotype matches:

Proximity score 0.507 in interactome to KCNJ2 and phenotypic similarity 0.651 to Andersen syndrome associated with KCNJ2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.507 in interactome to KCNJ2 and phenotypic similarity 0.254 to mouse mutant of KCNJ2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0030248, narrow maxilla; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:609620 Short QT syndrome 1 - autosomal dominant; OMIM:613688 Long QT syndrome 2 - autosomal dominant; OMIM:613688 Long QT syndrome 2, acquired, susceptibility to (susceptibility); ORPHA:101016 Romano-Ward syndrome - autosomal dominant; ORPHA:51083 Familial short QT syndrome - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.507

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-150649741-G-A [0/1] rs754215143

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: LIKELY_BENIGN (criteria provided, single submitter)

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: KCNH2:ENST00000262186.5:c.1329C>T:p.(=); KCNH2:ENST00000330883.4:c.309C>T:p.(=); KCNH2:ENST00000392968.2:c.1041C>T:p.(=); KCNH2:ENST00000430723.3:c.1329C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ExAC EAS: 0.0116%; gnomAD_E_EAS: 0.0174%; gnomAD_E_NFE: 0.0009%

PABPC1

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.100

Phenotype matches:

Proximity score 0.506 in interactome to TNRC6B and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with TNRC6B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 8-101721804-A-C [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: PABPC1:ENST00000318607.5:c.1128T>G:p.(=); PABPC1:ENST00000519004.1:c.993T>G:p.(=); PABPC1:ENST00000522387.1:c.1032T>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

UGT2B10

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

Phenotype matches:

Proximity score 0.506 in interactome to SLC35A2 and phenotypic similarity 0.712 to SLC35A2-CDG associated with SLC35A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001840, Metatarsus adductus; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0001840, Metatarsus adductus

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 4-69688084-C-T [0/1] rs374908612

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: UGT2B10:ENST00000265403.7:c.963C>T:p.(=); UGT2B10:ENST00000458688.2:c.711C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0096%; ESP AA: 0.0454%; ESP All: 0.0154%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0065%; gnomAD_G_NFE: 0.0067%

SEPTIN5

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

Phenotype matches:

Phenotypic similarity 0.399 to mouse mutant involving SEPTIN5.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002764, short tibia; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002764, short tibia; HP:0010055, Broad hallux - MP:0002764, short tibia

Proximity score 0.506 in interactome to GP1BB and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with GP1BB.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 22-19707858-C-T [0/1] rs550209881

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: SEPTIN5:ENST00000383045.3:c.405C>T:p.(=); SEPTIN5:ENST00000406395.1:c.378C>T:p.(=); SEPTIN5:ENST00000438754.2:c.405C>T:p.(=); SEPTIN5:ENST00000455784.2:c.378C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0032%; ExAC AMR: 0.0260%; ExAC NFE: 0.0015%; gnomAD_E_AMR: 0.0417%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0009%

NOP56

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

Phenotype matches:

Proximity score 0.506 in interactome to NSUN2 and phenotypic similarity 0.810 to Dubowitz syndrome associated with NSUN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.506 in interactome to NSUN2 and phenotypic similarity 0.571 to mouse mutant of NSUN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005296, abnormal humerus morphology; HP:0001363, Craniosynostosis - MP:0002932, abnormal joint morphology; HP:0011304, Broad thumb - MP:0005296, abnormal humerus morphology; HP:0010055, Broad hallux - MP:0005296, abnormal humerus morphology

Known diseases:: OMIM:614153 Spinocerebellar ataxia 36 - autosomal dominant; ORPHA:276198 Spinocerebellar ataxia type 36 - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 20-2635995-G-A [0/1] rs200115137

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: NOP56:ENST00000329276.5:c.594G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0024%; ExAC SAS: 0.0121%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0195%; gnomAD_G_AFR: 0.0115%; gnomAD_G_EAS: 0.0617%

KCNA7

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

Phenotype matches:

Proximity score 0.505 in interactome to KCNH1 and phenotypic similarity 0.856 to Temple-Baraitser syndrome associated with KCNH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-49575510-G-A [0/1] rs754428544

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: KCNA7:ENST00000221444.1:c.333C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0024%

ULK4

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.483 to mouse mutant involving ULK4.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000440, domed cranium; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.505 in interactome to SUFU and phenotypic similarity 0.657 to Gorlin syndrome associated with SUFU.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly; HP:0011304, Broad thumb - HP:0001166, Arachnodactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.505 in interactome to SUFU and phenotypic similarity 0.722 to mouse mutant of SUFU.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-41979618-G-A [0/1] rs747260126

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ULK4:ENST00000301831.4:c.210C>T:p.(=); ULK4:ENST00000414606.1:c.210C>T:p.(=); ULK4:ENST00000420927.1:c.210C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; ExAC SAS: 0.0061%; gnomAD_E_SAS: 0.0130%

RNF11

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

Phenotype matches:

Proximity score 0.505 in interactome to STAMBP and phenotypic similarity 0.666 to Microcephaly-capillary malformation syndrome associated with STAMBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.505 in interactome to STAMBP and phenotypic similarity 0.268 to mouse mutant of STAMBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-51702485-T-C [0/1] rs144300978

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: RNF11:ENST00000242719.3:c.57T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0056%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC EAS: 0.0118%; ExAC NFE: 0.0015%; gnomAD_E_EAS: 0.0233%; gnomAD_E_NFE: 0.0009%

TENM1

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

Phenotype matches:

Proximity score 0.504 in interactome to FLNA and phenotypic similarity 0.812 to ?FG syndrome 2 associated with FLNA.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0010055, Broad hallux; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.504 in interactome to FLNA and phenotypic similarity 0.583 to mouse mutant of FLNA.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000157, abnormal sternum morphology; HP:0001363, Craniosynostosis - MP:0001319, irregularly shaped pupil; HP:0011304, Broad thumb - MP:0000157, abnormal sternum morphology; HP:0010055, Broad hallux - MP:0000157, abnormal sternum morphology

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV X-123785959-G-A [0/1] rs1207491156

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: TENM1:ENST00000371130.3:c.1384C>T:p.(=); TENM1:ENST00000422452.2:c.1384C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0019%; gnomAD_E_EAS: 0.0079%

X_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV X-123785959-G-A [0/1] rs1207491156

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: TENM1:ENST00000371130.3:c.1384C>T:p.(=); TENM1:ENST00000422452.2:c.1384C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0019%; gnomAD_E_EAS: 0.0079%

IKBKB

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.303 to mouse mutant involving IKBKB.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to TWIST1 and phenotypic similarity 0.871 to Robinow-Sorauf syndrome associated with TWIST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0010055, Broad hallux; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.504 in interactome to TWIST1 and phenotypic similarity 1.000 to mouse mutant of TWIST1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Known diseases:: OMIM:615592 Immunodeficiency 15B - autosomal recessive; OMIM:618204 Immunodeficiency 15A - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 8-42147746-G-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: IKBKB:ENST00000416505.2:c.96G>A:p.(=); IKBKB:ENST00000519735.1:c.273G>A:p.(=); IKBKB:ENST00000520810.1:c.273G>A:p.(=); IKBKB:ENST00000520835.1:c.267G>A:p.(=); IKBKB:ENST00000379708.3:c.23+18023G>A:p.(=); IKBKB:ENST00000522147.1:c.105+18023G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SEPTIN14

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

Phenotype matches:

Proximity score 0.503 in interactome to PIAS2 and phenotypic similarity 0.727 to mouse mutant of PIAS2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0001325, abnormal retina morphology; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-55902184-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SEPTIN14:ENST00000388975.3:c.654T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MYO1C

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.099

Phenotype matches:

Phenotypic similarity 0.307 to mouse mutant involving MYO1C.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to EXOC8 and phenotypic similarity 0.635 to ?Neurodevelopmental disorder with microcephaly, seizures, and brain atrophy associated with EXOC8.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 17-1383860-C-T [0/1] rs200873831

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: MYO1C:ENST00000359786.5:c.867G>A:p.(=); MYO1C:ENST00000361007.2:c.762G>A:p.(=); MYO1C:ENST00000438665.2:c.810G>A:p.(=); MYO1C:ENST00000545534.2:c.795G>A:p.(=); MYO1C:ENST00000575158.1:c.762G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0045%; ExAC EAS: 0.0924%; gnomAD_E_EAS: 0.0928%; gnomAD_G_EAS: 0.0617%

MMP19

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

Phenotype matches:

Proximity score 0.503 in interactome to ACAN and phenotypic similarity 0.885 to Short stature and advanced bone age, with or without early-onset osteoarthritis and/or osteochondritis dissecans associated with ACAN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0009778, Short thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.503 in interactome to ACAN and phenotypic similarity 0.853 to mouse mutant of ACAN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0030420, short basicranium; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Known diseases:: OMIM:611543 Cavitary optic disc anomalies - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-56236591-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: MMP19:ENST00000322569.4:c.24G>A:p.(=); MMP19:ENST00000409200.3:c.24G>A:p.(=); MMP19:ENST00000548629.1:c.24G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SMN1

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.318 to mouse mutant involving SMN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.502 in interactome to SNRPN and phenotypic similarity 0.664 to Prader-Willi syndrome due to translocation associated with SNRPN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0005469, Flat occiput; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001845, Overlapping toe

Known diseases:: OMIM:253300 Spinal muscular atrophy-1 - autosomal recessive; OMIM:253400 Spinal muscular atrophy-3 - autosomal recessive; OMIM:253550 Spinal muscular atrophy-2 - autosomal recessive; OMIM:271150 Spinal muscular atrophy-4 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 5-70238373-A-G [1/1] rs4915

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]

ClinVar: BENIGN_OR_LIKELY_BENIGN (criteria provided, multiple submitters, no conflicts)

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SMN1:ENST00000351205.4:c.462A>G:p.(=); SMN1:ENST00000380707.4:c.462A>G:p.(=); SMN1:ENST00000503079.2:c.462A>G:p.(=); SMN1:ENST00000506163.1:c.462A>G:p.(=); SMN1:ENST00000514951.1:c.274-172A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 5-70247773-C-T [0/1] rs1164325688

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SMN1:ENST00000351205.4:c.744C>T:p.(=); SMN1:ENST00000380707.4:c.840C>T:p.(=); SMN1:ENST00000503079.2:c.744C>T:p.(=); SMN1:ENST00000514951.1:c.639C>T:p.(=); SMN1:ENST00000506163.1:c.835-493C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

ARHGAP22

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:

Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.621 to Mental retardation, X-linked syndromic 16 associated with FGD1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.272 to mouse mutant of FGD1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001297, microphthalmia; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 10-49663075-G-A [0/1] rs773894826

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ARHGAP22:ENST00000249601.4:c.762C>T:p.(=); ARHGAP22:ENST00000374172.1:c.435C>T:p.(=); ARHGAP22:ENST00000417247.2:c.492C>T:p.(=); ARHGAP22:ENST00000417912.2:c.810C>T:p.(=); ARHGAP22:ENST00000435790.2:c.780C>T:p.(=); ARHGAP22:ENST00000374170.1:c.390-1607C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ExAC AMR: 0.0091%; ExAC EAS: 0.0118%; ExAC SAS: 0.0071%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0116%; gnomAD_E_NFE: 0.0018%; gnomAD_E_SAS: 0.0066%; gnomAD_G_NFE: 0.0067%

PTCRA

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:

Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.662 to Adams-Oliver syndrome associated with RBPJ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0010760, Absent toe

Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.245 to mouse mutant of RBPJ.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0010124, decreased bone mineral content; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-42893093-C-T [0/1] rs766577832

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: PTCRA:ENST00000304672.1:c.519C>T:p.(=); PTCRA:ENST00000441198.1:c.444C>T:p.(=); PTCRA:ENST00000446507.1:c.198C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_FIN: 0.0081%; gnomAD_E_NFE: 0.0063%

TSC1

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.313 to Tuberous sclerosis-1 associated with TSC1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009724, Subungual fibromas; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009724, Subungual fibromas; HP:0010055, Broad hallux - HP:0009724, Subungual fibromas

Proximity score 0.502 in interactome to SFN and phenotypic similarity 0.710 to mouse mutant of SFN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology; HP:0001363, Craniosynostosis - MP:0000454, abnormal jaw morphology; HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology; HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology

Known diseases:: OMIM:191100 Tuberous sclerosis-1 - autosomal dominant; OMIM:606690 Lymphangioleiomyomatosis - somatic; OMIM:607341 Focal cortical dysplasia, type II, somatic - somatic; ORPHA:538 Lymphangioleiomyomatosis (unconfirmed); ORPHA:805 Tuberous sclerosis complex - autosomal dominant

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.313 to OMIM:191100 Tuberous sclerosis-1
Phenotypic similarity 0.296 to ORPHA:805 Tuberous sclerosis complex

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 9-135802630-C-T [0/1] rs781483110

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: TSC1:ENST00000298552.3:c.168G>A:p.(=); TSC1:ENST00000403810.1:c.168G>A:p.(=); TSC1:ENST00000440111.2:c.168G>A:p.(=); TSC1:ENST00000545250.1:c.168G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0026%; ExAC NFE: 0.0030%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0182%; gnomAD_G_AFR: 0.0115%

OAZ1

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:

Proximity score 0.502 in interactome to PSMD12 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with PSMD12.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010109, Short hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-2271460-C-T [0/1] rs755649263

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: OAZ1:ENST00000322297.4:c.219C>T:p.(=); OAZ1:ENST00000582888.4:c.216C>T:p.(=); OAZ1:ENST00000583542.4:c.222C>T:p.(=); OAZ1:ENST00000588673.2:c.309C>T:p.(=); OAZ1:ENST00000602676.2:c.222C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; gnomAD_E_NFE: 0.0010%

EMX1

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.271 to mouse mutant involving EMX1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.501 in interactome to FGF8 and phenotypic similarity 0.681 to Holoprosencephaly associated with FGF8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0005469, Flat occiput; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.501 in interactome to FGF8 and phenotypic similarity 0.737 to mouse mutant of FGF8.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 2-73151467-C-T [0/1] rs1383337307

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: EMX1:ENST00000258106.6:c.550C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

H2AC7

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.099

Phenotype matches:

Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.656 to 2q37 microdeletion syndrome associated with HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0006101, Finger syndactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.934 to mouse mutant of HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0001363, Craniosynostosis - MP:0030356, premature lambdoid suture closure; HP:0011304, Broad thumb - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0010055, Broad hallux - MP:0000165, abnormal long bone hypertrophic chondrocyte zone

Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.614 to fish mutant of HDAC4.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0107238, anguloarticular premature ossification, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-26199376-G-A [0/1] rs745708378

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: H2AC7:ENST00000341023.1:c.96C>T:p.(=); H2AC7:ENST00000377831.5:c.-309C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0083%; gnomAD_E_AFR: 0.0394%; gnomAD_E_AMR: 0.0030%; gnomAD_G_AFR: 0.0114%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.087

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-26199376-G-A [0/1] rs745708378

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: H2AC7:ENST00000341023.1:c.96C>T:p.(=); H2AC7:ENST00000377831.5:c.-309C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0083%; gnomAD_E_AFR: 0.0394%; gnomAD_E_AMR: 0.0030%; gnomAD_G_AFR: 0.0114%

SYNONYMOUS_VARIANT SNV 6-26199442-C-T [0/1] rs117678923

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.076 CONTRIBUTING VARIANT

Transcripts:: H2AC7:ENST00000341023.1:c.30G>A:p.(=); H2AC7:ENST00000377831.5:c.-375G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.2995%; TOPMed: 0.2102%; ESP AA: 0.4085%; ESP EA: 0.0233%; ESP All: 0.1538%; ExAC AFR: 0.4792%; ExAC AMR: 0.0266%; ExAC EAS: 1.0328%; ExAC NFE: 0.0062%; gnomAD_E_AFR: 0.3846%; gnomAD_E_AMR: 0.0229%; gnomAD_E_EAS: 0.8937%; gnomAD_E_NFE: 0.0046%; gnomAD_E_OTH: 0.0569%; gnomAD_E_SAS: 0.0070%; gnomAD_G_AFR: 0.3091%; gnomAD_G_EAS: 0.1850%

DFFA

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:

Proximity score 0.501 in interactome to CASP3 and phenotypic similarity 0.631 to mouse mutant of CASP3.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-10529295-T-G [0/1] rs1407270291

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: DFFA:ENST00000377036.2:c.237A>C:p.(=); DFFA:ENST00000377038.3:c.237A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

IQSEC3

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.435 to mouse mutant involving IQSEC3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002764, short tibia; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002764, short tibia; HP:0010055, Broad hallux - MP:0002764, short tibia

Proximity score 0.501 in interactome to IQSEC2 and phenotypic similarity 0.701 to Smith-Magenis syndrome associated with IQSEC2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-176273-G-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: IQSEC3:ENST00000326261.4:c.225G>A:p.(=); IQSEC3:ENST00000538872.1:c.225G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

PBK

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

Phenotype matches:

Proximity score 0.501 in interactome to CHD4 and phenotypic similarity 0.639 to Sifrim-Hitz-Weiss syndrome associated with CHD4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001182, Tapered finger; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0001182, Tapered finger

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 8-27667969-C-T [-/1] rs2294092

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PBK:ENST00000301905.4:c.822G>A:p.(=); PBK:ENST00000522944.1:c.855G>A:p.(=); PBK:ENST00000397418.2:c.*111-853C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC AMR: 0.0087%; ExAC EAS: 0.0463%; ExAC NFE: 0.0015%; gnomAD_E_EAS: 0.0174%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0183%

CIP2A

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:

Proximity score 0.501 in interactome to PPP2R1A and phenotypic similarity 0.847 to Mental retardation, autosomal dominant 36 associated with PPP2R1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0009179, Deviation of the 5th finger; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-108273267-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CIP2A:ENST00000295746.8:c.2280G>A:p.(=); CIP2A:ENST00000491772.1:c.1803G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MAGI1

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:

Proximity score 0.501 in interactome to LRP4 and phenotypic similarity 0.561 to Cenani-Lenz syndrome associated with LRP4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009778, Short thumb; HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing; HP:0011304, Broad thumb - HP:0009778, Short thumb; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Proximity score 0.501 in interactome to LRP4 and phenotypic similarity 0.953 to mouse mutant of LRP4.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0008730, fused phalanges; HP:0011304, Broad thumb - MP:0008730, fused phalanges; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-65365051-G-A [0/1] rs1172897922

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: MAGI1:ENST00000330909.8:c.2964C>T:p.(=); MAGI1:ENST00000402939.2:c.2880C>T:p.(=); MAGI1:ENST00000483466.1:c.2964C>T:p.(=); MAGI1:ENST00000497477.2:c.2880C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0011%

PLEKHG4B

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to NOTCH1 and phenotypic similarity 0.662 to Adams-Oliver syndrome associated with NOTCH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect; HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger; HP:0010055, Broad hallux - HP:0010760, Absent toe

Proximity score 0.500 in interactome to NOTCH1 and phenotypic similarity 0.254 to mouse mutant of NOTCH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0010097, abnormal retinal blood vessel morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 5-143229-G-A [0/1] rs1579283441

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: PLEKHG4B:ENST00000283426.6:c.477G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

NOD1

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to AIM2 and phenotypic similarity 0.755 to mouse mutant of AIM2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-30490966-C-T [0/1] rs757195335

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: NOD1:ENST00000222823.4:c.2067G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ExAC NFE: 0.0030%; gnomAD_E_NFE: 0.0027%

PPP6R1

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to PUF60 and phenotypic similarity 0.818 to Intellectual disability-cardiac anomalies-short stature-joint laxity syndrome associated with PUF60.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0009237, Short 5th finger; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-55751233-C-T [0/1] rs1212266113

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: PPP6R1:ENST00000412770.2:c.1524G>A:p.(=); PPP6R1:ENST00000587283.1:c.1524G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

FBXO39

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to NEPRO and phenotypic similarity 0.710 to Anauxetic dysplasia 3 associated with NEPRO.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0009844, Broad middle phalanx of finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 17-6683278-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: FBXO39:ENST00000321535.4:c.91C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

RIMBP3

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to L1CAM and phenotypic similarity 0.481 to Hydrocephalus with congenital idiopathic intestinal pseudoobstruction associated with L1CAM.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001181, Adducted thumb; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0001181, Adducted thumb

Proximity score 0.500 in interactome to L1CAM and phenotypic similarity 0.675 to mouse mutant of L1CAM.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000583, long toenails; HP:0001363, Craniosynostosis - MP:0006198, enophthalmos; HP:0011304, Broad thumb - MP:0000583, long toenails; HP:0010055, Broad hallux - MP:0000583, long toenails

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 22-20456772-G-T [1/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: RIMBP3:ENST00000426804.1:c.4530C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

BDH1

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

Phenotype matches:

Proximity score 0.501 in interactome to SOX14 and phenotypic similarity 0.755 to mouse mutant of SOX14.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-197241247-G-A [0/1] rs369406870

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: BDH1:ENST00000358186.2:c.450C>T:p.(=); BDH1:ENST00000392378.2:c.450C>T:p.(=); BDH1:ENST00000392379.1:c.450C>T:p.(=); BDH1:ENST00000441275.1:c.189C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0242%; UK10K: 0.0264%; ESP AA: 0.0227%; ESP EA: 0.0116%; ESP All: 0.0154%; ExAC AFR: 0.0096%; ExAC AMR: 0.0173%; ExAC NFE: 0.0317%; ExAC SAS: 0.0065%; gnomAD_E_AFR: 0.0066%; gnomAD_E_AMR: 0.0331%; gnomAD_E_NFE: 0.0441%; gnomAD_E_SAS: 0.0033%; gnomAD_G_NFE: 0.0400%

C2CD5

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to FIBP and phenotypic similarity 0.656 to Tall stature-intellectual disability-renal anomalies syndrome associated with FIBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001847, Long hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001172, Abnormal thumb morphology; HP:0010055, Broad hallux - HP:0001847, Long hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-22637717-T-C [0/1] rs766920763

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: C2CD5:ENST00000333957.4:c.1464A>G:p.(=); C2CD5:ENST00000396028.2:c.1437A>G:p.(=); C2CD5:ENST00000446597.1:c.1464A>G:p.(=); C2CD5:ENST00000536386.1:c.1470A>G:p.(=); C2CD5:ENST00000542676.1:c.1464A>G:p.(=); C2CD5:ENST00000544930.1:c.909A>G:p.(=); C2CD5:ENST00000545552.1:c.1503A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0116%; ExAC NFE: 0.0015%; gnomAD_E_EAS: 0.0117%; gnomAD_E_NFE: 0.0018%

ADCK1

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to TELO2 and phenotypic similarity 0.650 to TELO2-related intellectual disability-neurodevelopmental disorder associated with TELO2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0004692, 4-5 toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 14-78365556-T-C [0/1] rs1334605165

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ADCK1:ENST00000238561.5:c.696T>C:p.(=); ADCK1:ENST00000341211.5:c.492T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0032%

ARL14EP

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to PLOD2 and phenotypic similarity 0.617 to Bruck syndrome 2 associated with PLOD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0002980, Femoral bowing; HP:0001363, Craniosynostosis - HP:0002645, Wormian bones; HP:0011304, Broad thumb - HP:0002980, Femoral bowing; HP:0010055, Broad hallux - HP:0002980, Femoral bowing

Proximity score 0.500 in interactome to PLOD2 and phenotypic similarity 0.265 to mouse mutant of PLOD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005544, corneal deposits; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to PLOD2 and phenotypic similarity 0.433 to fish mutant of PLOD2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0006781, bone mineralization increased process quality, abnormal; HP:0011304, Broad thumb - ZP:0020434, rib curved, abnormal; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 11-30352717-A-T [0/1] rs769433126

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ARL14EP:ENST00000282032.3:c.222A>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0232%

MEGF6

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to FBN2 and phenotypic similarity 0.510 to Contractural arachnodactyly, congenital associated with FBN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly; HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly; HP:0011304, Broad thumb - HP:0001181, Adducted thumb; HP:0010055, Broad hallux - HP:0001166, Arachnodactyly

Proximity score 0.500 in interactome to FBN2 and phenotypic similarity 0.790 to mouse mutant of FBN2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis - MP:0008730, fused phalanges; HP:0011304, Broad thumb - MP:0008730, fused phalanges; HP:0010055, Broad hallux - MP:0000564, syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-3422002-G-A [0/1] rs758885697

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: MEGF6:ENST00000294599.4:c.1722C>T:p.(=); MEGF6:ENST00000356575.4:c.2037C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0023%; ExAC NFE: 0.0106%; ExAC SAS: 0.0206%; gnomAD_E_NFE: 0.0047%; gnomAD_E_SAS: 0.0099%; gnomAD_G_NFE: 0.0067%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.077

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-3422002-G-A [0/1] rs758885697

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: MEGF6:ENST00000294599.4:c.1722C>T:p.(=); MEGF6:ENST00000356575.4:c.2037C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0023%; ExAC NFE: 0.0106%; ExAC SAS: 0.0206%; gnomAD_E_NFE: 0.0047%; gnomAD_E_SAS: 0.0099%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 1-3431226-C-T [0/1] rs372060403

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.055 CONTRIBUTING VARIANT

Transcripts:: MEGF6:ENST00000294599.4:c.426G>A:p.(=); MEGF6:ENST00000356575.4:c.741G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0397%; ESP EA: 0.0241%; ESP All: 0.0163%; ExAC AMR: 0.0362%; ExAC EAS: 1.4658%; ExAC NFE: 0.0185%; gnomAD_E_AMR: 0.0034%; gnomAD_E_EAS: 1.0591%; gnomAD_E_NFE: 0.0116%; gnomAD_E_OTH: 0.0217%; gnomAD_G_EAS: 0.8631%; gnomAD_G_NFE: 0.0067%

SLCO1B7

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to RXRA and phenotypic similarity 0.772 to mouse mutant of RXRA.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-21207493-C-T [0/1] rs753670409

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SLCO1B7:ENST00000421593.2:c.1464C>T:p.(=); SLCO1B7:ENST00000554957.1:c.1605C>T:p.(=); SLCO1B7:ENST00000381541.3:c.1605C>T:p.(=); SLCO1B7:ENST00000553473.1:c.1866-12760C>T:p.(=); SLCO1B7:ENST00000540229.1:c.1866-12760C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0048%; ExAC AMR: 0.0266%; ExAC EAS: 0.0234%; gnomAD_E_AMR: 0.0278%; gnomAD_E_EAS: 0.0118%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0187%

CUL9

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to SIAH1 and phenotypic similarity 0.858 to Buratti-Harel syndrome associated with SIAH1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0011304, Broad thumb; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-43172273-G-A [0/1] rs779402516

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CUL9:ENST00000252050.4:c.4335G>A:p.(=); CUL9:ENST00000354495.3:c.4005G>A:p.(=); CUL9:ENST00000372647.2:c.4335G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0011%; ExAC EAS: 0.0347%; gnomAD_E_EAS: 0.0174%

STK32C

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

Phenotype matches:

Proximity score 0.500 in interactome to TELO2 and phenotypic similarity 0.650 to TELO2-related intellectual disability-neurodevelopmental disorder associated with TELO2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0004692, 4-5 toe syndactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 10-134040457-G-A [0/1] rs377335124

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: STK32C:ENST00000368622.1:c.135C>T:p.(=); STK32C:ENST00000368625.4:c.525C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0129%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0196%; ExAC NFE: 0.0031%; gnomAD_E_AFR: 0.0131%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0018%; gnomAD_E_OTH: 0.0183%; gnomAD_G_AFR: 0.0458%; gnomAD_G_NFE: 0.0133%

SLC16A1

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

Phenotype matches:

Proximity score 0.500 in interactome to FGFR2 and phenotypic similarity 0.880 to Jackson-Weiss syndrome associated with FGFR2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010055, Broad hallux; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0001783, Broad metatarsal; HP:0010055, Broad hallux - HP:0010055, Broad hallux

Proximity score 0.500 in interactome to FGFR2 and phenotypic similarity 1.000 to mouse mutant of FGFR2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000157, abnormal sternum morphology; HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure; HP:0011304, Broad thumb - MP:0000157, abnormal sternum morphology; HP:0010055, Broad hallux - MP:0000157, abnormal sternum morphology

Known diseases:: OMIM:245340 Erythrocyte lactate transporter defect - autosomal dominant; OMIM:610021 Hyperinsulinemic hypoglycemia, familial, 7 - autosomal dominant; OMIM:616095 Monocarboxylate transporter 1 deficiency - autosomal dominant/recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-113456674-A-G [0/1] rs773196238

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: SLC16A1:ENST00000369626.3:c.1342T>C:p.(=); SLC16A1:ENST00000538576.1:c.1342T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0040%; ExAC EAS: 0.0347%; ExAC SAS: 0.0182%; gnomAD_E_EAS: 0.0348%; gnomAD_E_SAS: 0.0162%; gnomAD_G_EAS: 0.0617%

PPP1R9A

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

Phenotype matches:

Proximity score 0.500 in interactome to FIBP and phenotypic similarity 0.656 to Tall stature-intellectual disability-renal anomalies syndrome associated with FIBP.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001847, Long hallux; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001172, Abnormal thumb morphology; HP:0010055, Broad hallux - HP:0001847, Long hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-94540787-T-C [0/1] rs144417105

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PPP1R9A:ENST00000289495.5:c.1362T>C:p.(=); PPP1R9A:ENST00000340694.4:c.1362T>C:p.(=); PPP1R9A:ENST00000424654.1:c.1362T>C:p.(=); PPP1R9A:ENST00000433360.1:c.1362T>C:p.(=); PPP1R9A:ENST00000433881.1:c.1362T>C:p.(=); PPP1R9A:ENST00000456331.2:c.1362T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0178%; ESP AA: 0.0908%; ESP EA: 0.0349%; ESP All: 0.0538%; ExAC AFR: 0.0195%; ExAC AMR: 0.0261%; ExAC FIN: 0.0303%; ExAC NFE: 0.0213%; gnomAD_E_AFR: 0.0131%; gnomAD_E_AMR: 0.0238%; gnomAD_E_FIN: 0.0730%; gnomAD_E_NFE: 0.0199%; gnomAD_G_AFR: 0.0229%; gnomAD_G_FIN: 0.0573%; gnomAD_G_NFE: 0.0267%

DUSP9

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.095

Phenotype matches:

Proximity score 0.500 in interactome to MAPK1 and phenotypic similarity 0.619 to Noonan syndrome 13 associated with MAPK1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0030084, Clinodactyly; HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge; HP:0011304, Broad thumb - HP:0001182, Tapered finger; HP:0010055, Broad hallux - HP:0001845, Overlapping toe

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.095

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV X-152915087-C-T [0/1] rs145220210

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.095 CONTRIBUTING VARIANT

Transcripts:: DUSP9:ENST00000342782.3:c.774C>T:p.(=); DUSP9:ENST00000370167.4:c.774C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0265%; TOPMed: 0.0111%; ExAC EAS: 0.2718%; ExAC NFE: 0.0021%; gnomAD_E_EAS: 0.2021%; gnomAD_E_NFE: 0.0025%; gnomAD_E_OTH: 0.0494%; gnomAD_G_EAS: 0.2882%; gnomAD_G_OTH: 0.1376%

PGAP3

Exomiser Score: 0.001

Phenotype Score: 0.570

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.570 to Hyperphosphatasia-intellectual disability syndrome associated with PGAP3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0030084, Clinodactyly; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers; HP:0010055, Broad hallux - HP:0030084, Clinodactyly

Phenotypic similarity 0.315 to mouse mutant involving PGAP3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002111, abnormal tail morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002111, abnormal tail morphology; HP:0010055, Broad hallux - MP:0002111, abnormal tail morphology

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers; HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput; HP:0011304, Broad thumb - HP:0010557, Overlapping fingers; HP:0010055, Broad hallux - HP:0010557, Overlapping fingers

Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:615716 Hyperphosphatasia with mental retardation syndrome 4 - autosomal recessive; ORPHA:247262 Hyperphosphatasia-intellectual disability syndrome - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 17-37844262-G-A [0/1] rs199645746

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: PGAP3:ENST00000300658.4:c.6C>T:p.(=); PGAP3:ENST00000378011.4:c.6C>T:p.(=); PGAP3:ENST00000429199.2:c.6C>T:p.(=); PGAP3:ENST00000579146.1:c.6C>T:p.(=); PGAP3:ENST00000584601.1:c.-702G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0068%; ExAC SAS: 0.0370%; gnomAD_E_SAS: 0.0171%; gnomAD_G_EAS: 0.0617%

SLC4A11

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.077

Phenotype matches:

Phenotypic similarity 0.346 to mouse mutant involving SLC4A11.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005301, abnormal corneal endothelium morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.500 in interactome to CCNQ and phenotypic similarity 0.780 to STAR syndrome associated with CCNQ.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001770, Toe syndactyly

Known diseases:: OMIM:217400 Corneal endothelial dystrophy and perceptive deafness - autosomal recessive; OMIM:217700 Corneal endothelial dystrophy, autosomal recessive - autosomal recessive; OMIM:613268 Corneal dystrophy, Fuchs endothelial, 4 - autosomal dominant; ORPHA:1490 Corneal dystrophy-perceptive deafness syndrome - autosomal recessive; ORPHA:293603 Congenital hereditary endothelial dystrophy type II - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.077

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 20-3212021-C-T [0/1] rs193080010

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.079 CONTRIBUTING VARIANT

Transcripts:: SLC4A11:ENST00000380056.3:c.951G>A:p.(=); SLC4A11:ENST00000380059.3:c.1032G>A:p.(=); SLC4A11:ENST00000539553.2:c.903G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1198%; TOPMed: 0.1043%; ExAC AMR: 0.0087%; ExAC EAS: 0.9024%; ExAC NFE: 0.0090%; ExAC SAS: 0.0787%; gnomAD_E_AMR: 0.0119%; gnomAD_E_EAS: 0.9508%; gnomAD_E_NFE: 0.0090%; gnomAD_E_SAS: 0.0780%; gnomAD_G_EAS: 0.8631%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 20-3211616-G-A [0/1] rs139297339

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)

Variant score: 0.076 CONTRIBUTING VARIANT

Transcripts:: SLC4A11:ENST00000380056.3:c.1179C>T:p.(=); SLC4A11:ENST00000380059.3:c.1260C>T:p.(=); SLC4A11:ENST00000539553.2:c.1131C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1797%; TOPMed: 0.1311%; ESP AA: 0.1135%; ESP All: 0.0384%; ExAC AFR: 0.1784%; ExAC AMR: 0.0087%; ExAC EAS: 0.8958%; ExAC NFE: 0.0121%; ExAC OTH: 0.1119%; ExAC SAS: 0.0730%; gnomAD_E_AFR: 0.2299%; gnomAD_E_AMR: 0.0179%; gnomAD_E_EAS: 1.0214%; gnomAD_E_NFE: 0.0109%; gnomAD_E_OTH: 0.0367%; gnomAD_E_SAS: 0.0845%; gnomAD_G_AFR: 0.2070%; gnomAD_G_EAS: 0.9864%; gnomAD_G_NFE: 0.0067%

FLG2

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.637

Phenotype matches:

No phenotype or PPI evidence

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:618084 Peeling skin syndrome 6 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.637

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-152324836-C-G [0/1] rs1254496666

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.637 CONTRIBUTING VARIANT

Transcripts:: FLG2:ENST00000388718.5:c.5426G>C:p.(Ser1809Thr)

Pathogenicity Data:: Best Score: 0.63699996; Polyphen2: 0.007 (B); SIFT: 0.363 (T)

Frequency Data:: TOPMed: 0.0008%

CDSN

Exomiser Score: 0.000

Phenotype Score: 0.332

Variant Score: 0.237

Phenotype matches:

Phenotypic similarity 0.323 to Peeling skin syndrome 1 associated with CDSN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001806, Onycholysis; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001806, Onycholysis; HP:0010055, Broad hallux - HP:0001806, Onycholysis

Phenotypic similarity 0.332 to mouse mutant involving CDSN.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases:: OMIM:146520 Hypotrichosis 2 - autosomal dominant; OMIM:270300 Peeling skin syndrome 1 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.332

Variant Score: 0.237

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.323 to OMIM:270300 Peeling skin syndrome 1

Variants contributing to score:

MISSENSE_VARIANT SNV 6-31084941-T-A [0/1] rs200396521

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.238 CONTRIBUTING VARIANT

Transcripts:: CDSN:ENST00000376288.2:c.451A>T:p.(Ser151Cys); CDSN:ENST00000259881.9:c.-229+2273T>A:p.(=)

Pathogenicity Data:: Best Score: 1.0; SIFT: 0.000 (D)

Frequency Data:: 1000Genomes: 0.5192%; TOPMed: 0.1058%; ExAC AFR: 0.0325%; ExAC AMR: 0.2715%; ExAC EAS: 1.7176%; ExAC FIN: 0.1224%; ExAC NFE: 0.0177%; ExAC OTH: 0.1144%; ExAC SAS: 0.0379%; gnomAD_E_AFR: 0.0282%; gnomAD_E_AMR: 0.2316%; gnomAD_E_EAS: 1.4615%; gnomAD_E_FIN: 0.1096%; gnomAD_E_NFE: 0.0143%; gnomAD_E_OTH: 0.0377%; gnomAD_E_SAS: 0.0304%; gnomAD_G_AFR: 0.0121%; gnomAD_G_AMR: 0.2421%; gnomAD_G_EAS: 1.8916%; gnomAD_G_FIN: 0.2367%

MISSENSE_VARIANT SNV 6-31084936-G-C [0/1] rs144038841

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]

ClinVar: BENIGN (criteria provided, single submitter)

Variant score: 0.236 CONTRIBUTING VARIANT

Transcripts:: CDSN:ENST00000376288.2:c.456C>G:p.(Ser152Arg); CDSN:ENST00000259881.9:c.-229+2268G>C:p.(=)

Pathogenicity Data:: Best Score: 0.99; SIFT: 0.010 (D)

Frequency Data:: 1000Genomes: 0.5192%; TOPMed: 0.1633%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0322%; ExAC AMR: 0.2714%; ExAC EAS: 1.7163%; ExAC FIN: 0.1224%; ExAC NFE: 0.0176%; ExAC OTH: 0.1142%; ExAC SAS: 0.0379%; gnomAD_E_AFR: 0.0282%; gnomAD_E_AMR: 0.2320%; gnomAD_E_EAS: 1.4669%; gnomAD_E_FIN: 0.1096%; gnomAD_E_NFE: 0.0143%; gnomAD_E_OTH: 0.0378%; gnomAD_E_SAS: 0.0305%; gnomAD_G_AFR: 0.0121%; gnomAD_G_AMR: 0.2421%; gnomAD_G_EAS: 1.8916%; gnomAD_G_FIN: 0.2365%

Other passed variants:

SYNONYMOUS_VARIANT SNV 6-31084723-G-A [0/1] rs117764398

Variant score: 0.063

Transcripts:: CDSN:ENST00000376288.2:c.669C>T:p.(=); CDSN:ENST00000259881.9:c.-229+2055G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.3794%; TOPMed: 0.0808%; UK10K: 0.0264%; ESP AA: 0.1135%; ESP EA: 0.0465%; ESP All: 0.0692%; ExAC AFR: 0.0483%; ExAC AMR: 0.0432%; ExAC EAS: 1.3179%; ExAC NFE: 0.0435%; ExAC OTH: 0.2208%; ExAC SAS: 0.0182%; gnomAD_E_AFR: 0.0458%; gnomAD_E_AMR: 0.0774%; gnomAD_E_EAS: 1.1887%; gnomAD_E_FIN: 0.0090%; gnomAD_E_NFE: 0.0376%; gnomAD_E_OTH: 0.1094%; gnomAD_E_SAS: 0.0292%; gnomAD_G_AFR: 0.0344%; gnomAD_G_EAS: 0.2469%; gnomAD_G_NFE: 0.0334%

NDC80

Exomiser Score: 0.000

Phenotype Score: 0.506

Variant Score: 0.029

Phenotype matches:

Phenotypic similarity 0.325 to zebrafish mutant involving NDC80.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0000399, head flat, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.506 in interactome to SMC1A and phenotypic similarity 0.790 to Developmental and epileptic encephalopathy 85, with or without midline brain defects associated with SMC1A.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0030084, Clinodactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0009471, Contracture of the proximal interphalangeal joint of the 3rd finger; HP:0010055, Broad hallux - HP:0010055, Broad hallux

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.506

Variant Score: 0.029

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 18-2608826-G-A [0/1] rs775421948

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.029 CONTRIBUTING VARIANT

Transcripts:: NDC80:ENST00000261597.4:c.1685G>A:p.(Arg562Gln)

Pathogenicity Data:: Best Score: 0.028999984; Polyphen2: 0.002 (B); SIFT: 0.971 (T)

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_AFR: 0.0196%; gnomAD_E_EAS: 0.0465%; gnomAD_E_SAS: 0.0195%; gnomAD_G_EAS: 0.0617%

FAM27B

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 9-67793922-C-T [0/1] rs796614575

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: FAM27B:ENST00000377484.3:c.53G>A:p.(Arg18Lys); FAM27B:ENST00000315762.5:n.1756C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.595

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 9-67793922-C-T [0/1] rs796614575

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: FAM27B:ENST00000377484.3:c.53G>A:p.(Arg18Lys); FAM27B:ENST00000315762.5:n.1756C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

MISSENSE_VARIANT SNV 9-67793952-G-A [0/1] rs367573394

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.591 CONTRIBUTING VARIANT

Transcripts:: FAM27B:ENST00000377484.3:c.23C>T:p.(Thr8Met); FAM27B:ENST00000315762.5:n.1786G>A:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0102%; gnomAD_E_EAS: 0.1059%; gnomAD_E_NFE: 0.0060%; gnomAD_E_OTH: 0.0722%; gnomAD_E_SAS: 0.0157%

Other passed variants:

SYNONYMOUS_VARIANT SNV 9-67793951-C-A [0/1] rs375326774

Variant score: 0.100

Transcripts:: FAM27B:ENST00000377484.3:c.24G>T:p.(=); FAM27B:ENST00000315762.5:n.1785C>A:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

LINC02897

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-247274889-C-A [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: LINC02897:ENST00000408893.2:c.638G>T:p.(Trp213Leu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

SPATA31A2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 9-39888542-T-C [1/1] rs1556461968

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: SPATA31A2:ENST00000456183.2:c.1529T>C:p.(Leu510Pro)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

CTD-3193O13.9

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-7934244-G-C [0/1] rs569642414

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: CTD-3193O13.9:ENST00000539422.1:c.3716C>G:p.(Pro1239Arg)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0032%

ZNF584

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 19-58926946-G-T [0/1] rs372304121

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.600 CONTRIBUTING VARIANT

Transcripts:: ZNF584:ENST00000596281.1:c.74G>T:p.(Arg25Leu); ZNF584:ENST00000306910.4:c.225G>T:p.(=); ZNF584:ENST00000322834.7:c.201G>T:p.(=); ZNF584:ENST00000593920.1:c.90G>T:p.(=); ZNF584:ENST00000599238.1:c.90G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0024%; gnomAD_E_EAS: 0.0058%

NBPF10

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.599

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.599

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-145298363-C-T [0/1] rs200081155

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.599 CONTRIBUTING VARIANT

Transcripts:: NBPF10:ENST00000342960.5:c.775C>T:p.(Pro259Ser); NBPF10:ENST00000369339.3:c.176-3357C>T:p.(=); NBPF10:ENST00000468030.1:c.*882C>T:p.(=); NBPF10:ENST00000369338.1:c.-35-1367C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0086%; gnomAD_E_NFE: 0.0038%; gnomAD_E_SAS: 0.0043%; gnomAD_G_AFR: 0.0115%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.598

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-145298363-C-T [0/1] rs200081155

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.599 CONTRIBUTING VARIANT

Transcripts:: NBPF10:ENST00000342960.5:c.775C>T:p.(Pro259Ser); NBPF10:ENST00000369339.3:c.176-3357C>T:p.(=); NBPF10:ENST00000468030.1:c.*882C>T:p.(=); NBPF10:ENST00000369338.1:c.-35-1367C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0086%; gnomAD_E_NFE: 0.0038%; gnomAD_E_SAS: 0.0043%; gnomAD_G_AFR: 0.0115%

MISSENSE_VARIANT SNV 1-145298247-C-T [0/1] rs782682192

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.598 CONTRIBUTING VARIANT

Transcripts:: NBPF10:ENST00000342960.5:c.659C>T:p.(Ser220Phe); NBPF10:ENST00000369339.3:c.176-3473C>T:p.(=); NBPF10:ENST00000468030.1:c.*766C>T:p.(=); NBPF10:ENST00000369338.1:c.-35-1483C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0061%; gnomAD_E_NFE: 0.0058%; gnomAD_G_FIN: 0.0287%; gnomAD_G_NFE: 0.0133%

Other passed variants:

MISSENSE_VARIANT SNV 1-145368473-G-C [0/1] rs1043749

Variant score: 0.589

Transcripts:: NBPF10:ENST00000342960.5:c.10451G>C:p.(Arg3484Pro); NBPF10:ENST00000369338.1:c.1799G>C:p.(Arg600Pro); NBPF10:ENST00000369339.3:c.1805G>C:p.(Arg602Pro)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.1309%; gnomAD_E_EAS: 0.0061%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0557%; gnomAD_E_SAS: 0.0034%

NBPF1

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.593

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.593

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-16902844-G-T [0/1] rs199969012

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.593 CONTRIBUTING VARIANT

Transcripts:: NBPF1:ENST00000287968.8:c.132C>A:p.(Asp44Glu); NBPF1:ENST00000430580.2:c.2037C>A:p.(Asp679Glu); NBPF1:ENST00000432949.1:c.411C>A:p.(Asp137Glu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0440%; gnomAD_E_EAS: 0.0066%; gnomAD_E_FIN: 0.0804%; gnomAD_E_NFE: 0.0324%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.593

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-16902844-G-T [0/1] rs199969012

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.593 CONTRIBUTING VARIANT

Transcripts:: NBPF1:ENST00000287968.8:c.132C>A:p.(Asp44Glu); NBPF1:ENST00000430580.2:c.2037C>A:p.(Asp679Glu); NBPF1:ENST00000432949.1:c.411C>A:p.(Asp137Glu)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0440%; gnomAD_E_EAS: 0.0066%; gnomAD_E_FIN: 0.0804%; gnomAD_E_NFE: 0.0324%

MISSENSE_VARIANT SNV 1-16918468-T-A [0/1] rs368239045

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.592 CONTRIBUTING VARIANT

Transcripts:: NBPF1:ENST00000430580.2:c.49A>T:p.(Ile17Phe)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0064%; ExAC EAS: 0.0925%; ExAC SAS: 0.0061%; gnomAD_E_EAS: 0.0290%

Other passed variants:

MISSENSE_VARIANT SNV 1-16895721-C-G [0/1] rs745573919

Variant score: 0.534

Transcripts:: NBPF1:ENST00000430580.2:c.2461G>C:p.(Glu821Gln); NBPF1:ENST00000432949.1:c.825-1196G>C:p.(=); NBPF1:ENST00000287968.8:c.*64G>C:p.(=); NBPF1:ENST00000420031.2:c.*13G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0871%; gnomAD_E_AMR: 0.0151%; gnomAD_E_EAS: 0.3599%; gnomAD_E_FIN: 0.0094%; gnomAD_E_NFE: 0.0225%; gnomAD_E_OTH: 0.0190%; gnomAD_E_SAS: 0.0427%; gnomAD_G_AFR: 0.2393%; gnomAD_G_EAS: 0.5921%; gnomAD_G_NFE: 0.0745%; gnomAD_G_OTH: 0.1129%

SYNONYMOUS_VARIANT SNV 1-16912138-A-G [0/1] rs201223391

Variant score: 0.097

Transcripts:: NBPF1:ENST00000430580.2:c.834T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.1955%; gnomAD_E_AMR: 0.1293%; gnomAD_E_EAS: 0.0557%; gnomAD_E_FIN: 0.1477%; gnomAD_E_NFE: 0.1257%; gnomAD_E_OTH: 0.2194%; gnomAD_E_SAS: 0.0810%

SYNONYMOUS_VARIANT SNV 1-16895707-C-T [0/1] rs764129354

Variant score: 0.084

Transcripts:: NBPF1:ENST00000430580.2:c.2475G>A:p.(=); NBPF1:ENST00000432949.1:c.825-1182G>A:p.(=); NBPF1:ENST00000287968.8:c.*78G>A:p.(=); NBPF1:ENST00000420031.2:c.*27G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0870%; gnomAD_E_AMR: 0.0091%; gnomAD_E_EAS: 0.3785%; gnomAD_E_FIN: 0.0183%; gnomAD_E_NFE: 0.0187%; gnomAD_E_OTH: 0.0568%; gnomAD_E_SAS: 0.0427%; gnomAD_G_AFR: 0.2390%; gnomAD_G_EAS: 0.7864%; gnomAD_G_NFE: 0.0811%; gnomAD_G_OTH: 0.1134%

KRTAP10-1

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.012

Phenotype matches:

Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly; HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.012

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 21-45959293-A-G [0/1] rs782221526

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.025 CONTRIBUTING VARIANT

Transcripts:: KRTAP10-1:ENST00000400375.1:c.741T>C:p.(=); KRTAP10-1:ENST00000323084.4:c.304-5487T>C:p.(=); KRTAP10-1:ENST00000397916.1:c.100-5487T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.5391%; TOPMed: 0.3321%; ExAC AFR: 0.5305%; ExAC AMR: 0.5221%; ExAC EAS: 1.8813%; ExAC FIN: 0.1979%; ExAC NFE: 0.1598%; ExAC OTH: 1.0090%; ExAC SAS: 0.2124%; gnomAD_E_AFR: 0.4915%; gnomAD_E_AMR: 0.3905%; gnomAD_E_EAS: 1.8480%; gnomAD_E_FIN: 0.0901%; gnomAD_E_NFE: 0.1697%; gnomAD_E_OTH: 0.4750%; gnomAD_E_SAS: 0.1885%; gnomAD_G_AFR: 0.6438%; gnomAD_G_AMR: 0.1193%; gnomAD_G_EAS: 1.4180%; gnomAD_G_FIN: 0.0859%; gnomAD_G_NFE: 0.1942%; gnomAD_G_OTH: 0.2045%

MISSENSE_VARIANT SNV 21-45959298-T-C [0/1] rs147442908

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.000 CONTRIBUTING VARIANT

Transcripts:: KRTAP10-1:ENST00000400375.1:c.736A>G:p.(Met246Val); KRTAP10-1:ENST00000323084.4:c.304-5492A>G:p.(=); KRTAP10-1:ENST00000397916.1:c.100-5492A>G:p.(=)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B); SIFT: 1.000 (T)

Frequency Data:: 1000Genomes: 0.6190%; TOPMed: 0.3560%; ESP AA: 0.5901%; ESP EA: 0.0581%; ESP All: 0.2384%; ExAC AFR: 0.4883%; ExAC AMR: 0.2523%; ExAC EAS: 1.8817%; ExAC FIN: 0.0304%; ExAC NFE: 0.0949%; ExAC OTH: 0.1116%; ExAC SAS: 0.1274%; gnomAD_E_AFR: 0.5501%; gnomAD_E_AMR: 0.2235%; gnomAD_E_EAS: 1.8129%; gnomAD_E_FIN: 0.0090%; gnomAD_E_NFE: 0.0610%; gnomAD_E_OTH: 0.2925%; gnomAD_E_SAS: 0.1008%; gnomAD_G_AFR: 0.5295%; gnomAD_G_AMR: 0.3580%; gnomAD_G_EAS: 1.2963%; gnomAD_G_FIN: 0.0573%; gnomAD_G_NFE: 0.0336%

HLA-DRB1

Exomiser Score: 0.000

Phenotype Score: 0.504

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.479 to Autoimmune pulmonary alveolar proteinosis associated with HLA-DRB1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Proximity score 0.504 in interactome to SEC24C and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with SEC24C.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly; HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis; HP:0011304, Broad thumb - HP:0001161, Hand polydactyly; HP:0010055, Broad hallux - HP:0001829, Foot polydactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:126200 Multiple sclerosis, susceptibility to, 1 (susceptibility); OMIM:181000 Sarcoidosis, susceptibility to, 1 (susceptibility); ORPHA:2073 Narcolepsy type 1 (susceptibility); ORPHA:220402 Limited cutaneous systemic sclerosis (susceptibility); ORPHA:397 Giant cell arteritis (susceptibility); ORPHA:545 Follicular lymphoma (susceptibility); ORPHA:747 Autoimmune pulmonary alveolar proteinosis (susceptibility); ORPHA:797 Sarcoidosis (susceptibility); ORPHA:85414 Systemic-onset juvenile idiopathic arthritis (susceptibility)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.162

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_REGION_VARIANT SNV 6-32548053-A-G [0/1] rs28732251

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.299 CONTRIBUTING VARIANT

Transcripts:: HLA-DRB1:ENST00000360004.5:c.764-6T>C:p.?

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.4631%; gnomAD_E_AMR: 0.2896%; gnomAD_E_EAS: 0.8238%; gnomAD_E_FIN: 0.1160%; gnomAD_E_NFE: 0.3312%; gnomAD_E_OTH: 0.3086%; gnomAD_E_SAS: 0.3272%; gnomAD_G_AFR: 1.4742%; gnomAD_G_AMR: 0.6211%; gnomAD_G_EAS: 1.7271%; gnomAD_G_FIN: 0.6720%; gnomAD_G_NFE: 1.5136%; gnomAD_G_OTH: 1.5000%

SYNONYMOUS_VARIANT SNV 6-32549587-T-G [0/1] rs2308761

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.025 CONTRIBUTING VARIANT

Transcripts:: HLA-DRB1:ENST00000360004.5:c.399A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.4615%; gnomAD_E_AMR: 0.3676%; gnomAD_E_EAS: 0.8338%; gnomAD_E_FIN: 0.0143%; gnomAD_E_NFE: 0.2176%; gnomAD_E_OTH: 0.3798%; gnomAD_E_SAS: 0.2057%; gnomAD_G_AFR: 1.2306%; gnomAD_G_AMR: 0.7062%; gnomAD_G_EAS: 1.8822%; gnomAD_G_FIN: 1.0424%; gnomAD_G_NFE: 1.0781%; gnomAD_G_OTH: 1.3447%

Other passed variants:

SYNONYMOUS_VARIANT SNV 6-32549392-C-T [0/1] rs16822972

Variant score: 0.021

Transcripts:: HLA-DRB1:ENST00000360004.5:c.594G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 1.4300%; gnomAD_G_AMR: 0.9434%; gnomAD_G_EAS: 1.9203%; gnomAD_G_FIN: 0.4012%; gnomAD_G_NFE: 1.4284%; gnomAD_G_OTH: 0.9346%

HEG1

Exomiser Score: 0.000

Phenotype Score: 0.501

Variant Score: 0.000

Phenotype matches:

Proximity score 0.501 in interactome to ITGB1BP1 and phenotypic similarity 0.750 to mouse mutant of ITGB1BP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology; HP:0001363, Craniosynostosis - MP:0003840, abnormal coronal suture morphology; HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology; HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.501

Variant Score: 0.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-124739825-T-C [0/1] rs746734858

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.000 CONTRIBUTING VARIANT

Transcripts:: HEG1:ENST00000311127.4:c.1063A>G:p.(Lys355Glu)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B); SIFT: 1.000 (T)

Frequency Data:: TOPMed: 0.0038%; ExAC AMR: 0.0088%; ExAC EAS: 0.0117%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0522%

IBA57

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.274 to Autosomal recessive spastic paraplegia type 74 associated with IBA57.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb -; HP:0010055, Broad hallux - HP:0001761, Pes cavus

Proximity score 0.500 in interactome to NUBP1 and phenotypic similarity 0.794 to mouse mutant of NUBP1.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0001304, cataract; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:615330 Multiple mitochondrial dysfunctions syndrome 3 - autosomal recessive; OMIM:616451 ?Spastic paraplegia 74, autosomal recessive (unconfirmed); ORPHA:468661 Autosomal recessive spastic paraplegia type 74 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.278

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-228362991-G-A [0/1] rs749840888

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.278 CONTRIBUTING VARIANT

Transcripts:: IBA57:ENST00000366711.3:c.848G>A:p.(Arg283Gln); IBA57:ENST00000546123.1:c.269G>A:p.(Arg90Gln)

Pathogenicity Data:: Best Score: 0.278; Polyphen2: 0.022 (B); SIFT: 0.722 (T)

Frequency Data:: ExAC NFE: 0.0031%; gnomAD_E_NFE: 0.0027%

ABCA3

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.479 to Surfactant metabolism dysfunction, pulmonary, 3 associated with ABCA3.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001217, Clubbing; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0001217, Clubbing; HP:0010055, Broad hallux - HP:0001217, Clubbing

Proximity score 0.500 in interactome to ETV5 and phenotypic similarity 0.737 to mouse mutant of ETV5.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000562, polydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0000562, polydactyly; HP:0010055, Broad hallux - MP:0000562, polydactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:610921 Surfactant metabolism dysfunction, pulmonary, 3 - autosomal recessive; ORPHA:2032 Idiopathic pulmonary fibrosis - polygenic; ORPHA:70587 Infant acute respiratory distress syndrome - unknown

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 16-2336835-C-T [0/1] rs764759666

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ABCA3:ENST00000301732.5:c.3138G>A:p.(=); ABCA3:ENST00000382381.3:c.2964G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0034%; ExAC AFR: 0.0096%; ExAC AMR: 0.0086%; ExAC EAS: 0.0116%; ExAC NFE: 0.0090%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0058%; gnomAD_E_FIN: 0.0090%; gnomAD_E_NFE: 0.0045%; gnomAD_E_SAS: 0.0065%

NPIPA5

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.538

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.538

No phenotype matches to diseases with this MOI.

Variants contributing to score:

DISRUPTIVE_INFRAME_DELETION DEL 16-15457556-AGTGAGCAGACACACTCGGGAGGTGTCTTGAGAT-A [0/1] rs773123485

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.588 CONTRIBUTING VARIANT

Transcripts:: NPIPA5:ENST00000360151.4:c.980_1012del:p.(Asn327_Leu338delinsIle)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0035%; gnomAD_E_EAS: 0.0382%; gnomAD_E_NFE: 0.0047%; gnomAD_E_OTH: 0.0393%; gnomAD_G_AFR: 0.1902%; gnomAD_G_AMR: 0.7163%; gnomAD_G_EAS: 1.1881%; gnomAD_G_FIN: 0.7033%; gnomAD_G_NFE: 0.2903%; gnomAD_G_OTH: 0.5580%

FRAMESHIFT_TRUNCATION DEL 16-15457591-ATCATCCGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGT-A [0/1] rs764101650

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.487 CONTRIBUTING VARIANT

Transcripts:: NPIPA5:ENST00000360151.4:c.940_977del:p.(Thr314fs)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.0072%; gnomAD_E_AMR: 0.0070%; gnomAD_E_EAS: 0.0398%; gnomAD_E_NFE: 0.0028%; gnomAD_E_OTH: 0.0394%; gnomAD_G_AFR: 0.2922%; gnomAD_G_AMR: 0.7862%; gnomAD_G_EAS: 1.5660%; gnomAD_G_FIN: 1.0480%; gnomAD_G_NFE: 0.5083%; gnomAD_G_OTH: 0.8373%

PCDHA8

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.521

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.521

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 5-140221071-G-T [0/1] rs62384463

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]

Variant score: 0.946 CONTRIBUTING VARIANT

Transcripts:: PCDHA8:ENST00000378123.3:c.165G>T:p.(Glu55Asp); PCDHA8:ENST00000531613.1:c.165G>T:p.(Glu55Asp); PCDHA8:ENST00000527624.1:c.1602+11793G>T:p.(=); PCDHA8:ENST00000529310.1:c.2394+11001G>T:p.(=); PCDHA8:ENST00000525929.1:c.2355+4748G>T:p.(=); PCDHA8:ENST00000529619.1:c.2352+17359G>T:p.(=); PCDHA8:ENST00000529859.1:c.2352+17359G>T:p.(=); PCDHA8:ENST00000512229.2:c.2385+31914G>T:p.(=); PCDHA8:ENST00000530339.1:c.2385+31914G>T:p.(=); PCDHA8:ENST00000526136.1:c.2388+44134G>T:p.(=); PCDHA8:ENST00000394633.3:c.1602+53594G>T:p.(=); PCDHA8:ENST00000504120.2:c.2394+52802G>T:p.(=); PCDHA8:ENST00000522353.2:c.2394+37895G>T:p.(=)

Pathogenicity Data:: Best Score: 0.999959; Polyphen2: 0.012 (B); Mutation Taster: 1.000 (P); SIFT: 0.169 (T)

Frequency Data:: gnomAD_E_AFR: 0.0270%; gnomAD_E_AMR: 0.3382%; gnomAD_E_EAS: 0.1847%; gnomAD_E_FIN: 0.0433%; gnomAD_E_NFE: 0.0789%; gnomAD_E_OTH: 0.1034%; gnomAD_E_SAS: 0.0645%; gnomAD_G_EAS: 0.1312%; gnomAD_G_FIN: 0.0296%; gnomAD_G_NFE: 0.0275%

SYNONYMOUS_VARIANT SNV 5-140221065-G-A [0/1] rs62384462

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.097 CONTRIBUTING VARIANT

Transcripts:: PCDHA8:ENST00000378123.3:c.159G>A:p.(=); PCDHA8:ENST00000531613.1:c.159G>A:p.(=); PCDHA8:ENST00000527624.1:c.1602+11787G>A:p.(=); PCDHA8:ENST00000529310.1:c.2394+10995G>A:p.(=); PCDHA8:ENST00000525929.1:c.2355+4742G>A:p.(=); PCDHA8:ENST00000529619.1:c.2352+17353G>A:p.(=); PCDHA8:ENST00000529859.1:c.2352+17353G>A:p.(=); PCDHA8:ENST00000512229.2:c.2385+31908G>A:p.(=); PCDHA8:ENST00000530339.1:c.2385+31908G>A:p.(=); PCDHA8:ENST00000526136.1:c.2388+44128G>A:p.(=); PCDHA8:ENST00000394633.3:c.1602+53588G>A:p.(=); PCDHA8:ENST00000504120.2:c.2394+52796G>A:p.(=); PCDHA8:ENST00000522353.2:c.2394+37889G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 0.1581%; gnomAD_E_AMR: 0.1267%; gnomAD_E_EAS: 0.0075%; gnomAD_E_FIN: 0.0605%; gnomAD_E_NFE: 0.0718%; gnomAD_E_OTH: 0.0217%; gnomAD_E_SAS: 0.0193%; gnomAD_G_AFR: 0.1074%; gnomAD_G_EAS: 0.0663%; gnomAD_G_FIN: 0.0600%; gnomAD_G_NFE: 0.0279%; gnomAD_G_OTH: 0.2123%

MUC5B

Exomiser Score: 0.000

Phenotype Score: 0.432

Variant Score: 0.000

Phenotype matches:

Phenotypic similarity 0.432 to Idiopathic pulmonary fibrosis associated with MUC5B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0100759, Clubbing of fingers; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0100759, Clubbing of fingers; HP:0010055, Broad hallux - HP:0100759, Clubbing of fingers

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:178500 Pulmonary fibrosis, idiopathic, susceptibility to (susceptibility); ORPHA:2032 Idiopathic pulmonary fibrosis (susceptibility)

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.184

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 11-1268488-C-T [0/1] rs200106077

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.298 CONTRIBUTING VARIANT

Transcripts:: MUC5B:ENST00000447027.1:c.10387C>T:p.(Pro3463Ser); MUC5B:ENST00000529681.1:c.10378C>T:p.(Pro3460Ser)

Pathogenicity Data:: Best Score: 0.41900003; SIFT: 0.581 (T)

Frequency Data:: gnomAD_E_AFR: 0.0198%; gnomAD_E_AMR: 0.0030%; gnomAD_E_EAS: 0.0767%; gnomAD_E_NFE: 0.0054%; gnomAD_E_SAS: 0.0228%; gnomAD_G_AFR: 0.0577%; gnomAD_G_EAS: 1.1436%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 11-1254268-G-A [0/1] rs567233629

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.070 CONTRIBUTING VARIANT

Transcripts:: MUC5B:ENST00000447027.1:c.2100G>A:p.(=); MUC5B:ENST00000529681.1:c.2091G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0295%; ExAC EAS: 0.9442%; ExAC OTH: 0.2146%; ExAC SAS: 0.0090%; gnomAD_E_EAS: 0.6938%; gnomAD_E_OTH: 0.0194%; gnomAD_E_SAS: 0.0034%; gnomAD_G_EAS: 1.1714%

AMN

Exomiser Score: 0.000

Phenotype Score: 0.291

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.583 to mouse mutant involving AMN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000157, abnormal sternum morphology; HP:0001363, Craniosynostosis - MP:0001297, microphthalmia; HP:0011304, Broad thumb - MP:0000157, abnormal sternum morphology; HP:0010055, Broad hallux - MP:0000157, abnormal sternum morphology

Proximity score 0.500 in interactome to CBL and phenotypic similarity 0.642 to Noonan syndrome associated with CBL.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger; HP:0010055, Broad hallux - HP:0001156, Brachydactyly

Proximity score 0.500 in interactome to CBL and phenotypic similarity 0.299 to mouse mutant of CBL.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:618882 Imerslund-Grasbeck syndrome 2 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.291

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 14-103394846-C-A [0/1] rs775510849

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: AMN:ENST00000299155.5:c.291C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC EAS: 0.0165%; ExAC SAS: 0.0078%; gnomAD_E_EAS: 0.0060%; gnomAD_E_SAS: 0.0033%

LTN1

Exomiser Score: 0.000

Phenotype Score: 0.278

Variant Score: 0.099

Phenotype matches:

Phenotypic similarity 0.278 to mouse mutant involving LTN1.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.278

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 21-30313625-G-A [0/1] rs554472667

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: LTN1:ENST00000361371.5:c.4399C>T:p.(=); LTN1:ENST00000389194.2:c.4537C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0030%; ExAC EAS: 0.0462%; gnomAD_E_EAS: 0.0580%

LAMB2

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

Phenotype matches:

Phenotypic similarity 0.293 to Synaptic congenital myasthenic syndromes associated with LAMB2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - HP:0003691, Scapular winging; HP:0010055, Broad hallux - HP:0001762, Talipes equinovarus

Phenotypic similarity 0.340 to mouse mutant involving LAMB2.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - MP:0005551, abnormal eye electrophysiology; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Proximity score 0.504 in interactome to LAMA5 and phenotypic similarity 0.739 to mouse mutant of LAMA5.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:609049 Pierson syndrome - autosomal recessive; OMIM:614199 Nephrotic syndrome, type 5, with or without ocular abnormalities - autosomal recessive; ORPHA:98915 Synaptic congenital myasthenic syndromes - unknown

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-49160932-T-C [0/1] rs1190966266

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: LAMB2:ENST00000305544.4:c.3930A>G:p.(=); LAMB2:ENST00000418109.1:c.3930A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0019%

MCM9

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

Phenotype matches:

Proximity score 0.503 in interactome to CDC45 and phenotypic similarity 0.703 to Ear-patella-short stature syndrome associated with CDC45.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger; HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis; HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger; HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:616185 Ovarian dysgenesis 4 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-119252724-C-A [0/1] rs1221350810

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: MCM9:ENST00000316068.3:c.165G>T:p.(=); MCM9:ENST00000316316.6:c.165G>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_EAS: 0.0058%

SERPINB8

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.100

Phenotype matches:

Proximity score 0.502 in interactome to FURIN and phenotypic similarity 0.935 to mouse mutant of FURIN.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002544, brachydactyly; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002544, brachydactyly; HP:0010055, Broad hallux - MP:0002544, brachydactyly

Proximity score 0.502 in interactome to FURIN and phenotypic similarity 0.274 to fish mutant of FURIN.
Best Phenotype Matches:: HP:0001156, Brachydactyly -; HP:0001363, Craniosynostosis - ZP:0006947, symplectic in contact with Meckel's cartilage, abnormal; HP:0011304, Broad thumb -; HP:0010055, Broad hallux -

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:617115 Peeling skin syndrome 5 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 18-61648960-T-C [0/1] rs2050674105

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SERPINB8:ENST00000353706.2:c.312T>C:p.(=); SERPINB8:ENST00000397985.2:c.312T>C:p.(=); SERPINB8:ENST00000397988.3:c.312T>C:p.(=); SERPINB8:ENST00000542677.1:c.-235T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%

SLC26A3

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.099

Phenotype matches:

Proximity score 0.503 in interactome to SLC26A2 and phenotypic similarity 0.668 to Atelosteogenesis type II associated with SLC26A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - HP:0001156, Brachydactyly; HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly; HP:0011304, Broad thumb - HP:0001234, Hitchhiker thumb; HP:0010055, Broad hallux - HP:0001852, Sandal gap

Proximity score 0.503 in interactome to SLC26A2 and phenotypic similarity 0.560 to mouse mutant of SLC26A2.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone; HP:0001363, Craniosynostosis - MP:0003419, delayed endochondral bone ossification; HP:0011304, Broad thumb - MP:0004358, bowed tibia; HP:0010055, Broad hallux - MP:0004358, bowed tibia

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:214700 Diarrhea 1, secretory chloride, congenital - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-107420200-C-G [0/1] rs577337450

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: SLC26A3:ENST00000340010.5:c.1320G>C:p.(=); SLC26A3:ENST00000422236.2:c.1215G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0015%; ExAC EAS: 0.0813%; gnomAD_E_EAS: 0.0754%

SLC25A20

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to CS and phenotypic similarity 0.755 to mouse mutant of CS.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis -; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:212138 Carnitine-acylcarnitine translocase deficiency - autosomal recessive; ORPHA:159 Carnitine-acylcarnitine translocase deficiency - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-48936201-G-A [0/1] rs1279750269

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: SLC25A20:ENST00000319017.4:c.27C>T:p.(=); SLC25A20:ENST00000430379.1:c.27C>T:p.(=); SLC25A20:ENST00000544097.1:c.-185C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0019%

AVIL

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

Phenotype matches:

Proximity score 0.500 in interactome to MYO10 and phenotypic similarity 0.730 to mouse mutant of MYO10.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0000564, syndactyly; HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system; HP:0011304, Broad thumb - MP:0000564, syndactyly; HP:0010055, Broad hallux - MP:0000564, syndactyly

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:618594 Nephrotic syndrome, type 21 - autosomal recessive

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-58197108-G-A [0/1] rs758880730

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: AVIL:ENST00000257861.3:c.1884C>T:p.(=); AVIL:ENST00000537081.1:c.1863C>T:p.(=); AVIL:ENST00000548851.1:c.572-4539G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

APOL1

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.099

Phenotype matches:

Proximity score 0.500 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:: HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology; HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage; HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology; HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology

Known diseases - observed variants incompatible with mode of inheritance:: OMIM:612551 End-stage renal disease, nondiabetic, susceptibility to (susceptibility)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 22-36661545-C-T [0/1] rs201375679

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: APOL1:ENST00000319136.4:c.711C>T:p.(=); APOL1:ENST00000347595.7:c.300C>T:p.(=); APOL1:ENST00000397278.3:c.663C>T:p.(=); APOL1:ENST00000397279.4:c.663C>T:p.(=); APOL1:ENST00000422706.1:c.663C>T:p.(=); APOL1:ENST00000426053.1:c.609C>T:p.(=); APOL1:ENST00000440669.2:c.*425C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0072%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0288%; ExAC NFE: 0.0045%; gnomAD_E_AFR: 0.0261%; gnomAD_E_FIN: 0.0045%; gnomAD_E_NFE: 0.0054%; gnomAD_G_AFR: 0.0115%

PAGE2B

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.309

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.309

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV X-55103931-T-C [0/1] rs149758580

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]

Variant score: 0.309 CONTRIBUTING VARIANT

Transcripts:: PAGE2B:ENST00000374971.1:c.293T>C:p.(Phe98Ser); PAGE2B:ENST00000374974.3:c.242T>C:p.(Phe81Ser)

Pathogenicity Data:: Best Score: 0.784; Polyphen2: 0.659 (P); SIFT: 0.216 (T)

Frequency Data:: 1000Genomes: 0.1325%; TOPMed: 0.0385%; ExAC AMR: 0.0107%; ExAC EAS: 1.2975%; ExAC SAS: 0.0297%; gnomAD_E_EAS: 1.1351%; gnomAD_E_OTH: 0.0494%; gnomAD_E_SAS: 0.0419%; gnomAD_G_EAS: 1.7013%

CRYBG3

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.294

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.294

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 3-97611805-C-G [0/1] rs139188566

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.488 CONTRIBUTING VARIANT

Transcripts:: CRYBG3:ENST00000182096.4:c.1698C>G:p.(His566Gln)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.1398%; TOPMed: 0.0552%; ExAC EAS: 0.7452%; ExAC NFE: 0.0030%; ExAC SAS: 0.0121%; gnomAD_E_EAS: 0.7579%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0071%; gnomAD_G_EAS: 0.8663%; gnomAD_G_NFE: 0.0067%

SYNONYMOUS_VARIANT SNV 3-97607242-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CRYBG3:ENST00000182096.4:c.1503C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 3-97607242-C-T [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CRYBG3:ENST00000182096.4:c.1503C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

XIRP2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.273

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.273

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 2-167992429-T-C [0/1] rs74698684

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.450 CONTRIBUTING VARIANT

Transcripts:: XIRP2:ENST00000295237.9:c.419T>C:p.(Ile140Thr); XIRP2:ENST00000409043.1:c.419T>C:p.(Ile140Thr); XIRP2:ENST00000409195.1:c.419T>C:p.(Ile140Thr); XIRP2:ENST00000409728.1:c.419T>C:p.(Ile140Thr); XIRP2:ENST00000409756.2:c.419T>C:p.(Ile140Thr); XIRP2:ENST00000420519.1:c.419T>C:p.(Ile140Thr)

Pathogenicity Data:: Best Score: 0.978; Polyphen2: 0.677 (P); SIFT: 0.022 (D)

Frequency Data:: 1000Genomes: 0.3594%; TOPMed: 0.0680%; ExAC EAS: 1.4830%; ExAC NFE: 0.0046%; ExAC SAS: 0.0069%; gnomAD_E_EAS: 1.5688%; gnomAD_E_NFE: 0.0037%; gnomAD_E_SAS: 0.0241%; gnomAD_G_EAS: 1.6069%

SYNONYMOUS_VARIANT SNV 2-168108351-G-A [0/1] rs186691484

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.095 CONTRIBUTING VARIANT

Transcripts:: XIRP2:ENST00000295237.9:c.10449G>A:p.(=); XIRP2:ENST00000409195.1:c.10449G>A:p.(=); XIRP2:ENST00000409273.1:c.9783G>A:p.(=); XIRP2:ENST00000409043.1:c.1177-2191G>A:p.(=); XIRP2:ENST00000409605.1:c.511-2191G>A:p.(=); XIRP2:ENST00000409728.1:c.1276-2191G>A:p.(=); XIRP2:ENST00000409756.2:c.1177-2191G>A:p.(=); XIRP2:ENST00000420519.1:c.1276-2191G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0094%; UK10K: 0.0132%; ESP EA: 0.0122%; ESP All: 0.0084%; ExAC EAS: 0.1398%; ExAC NFE: 0.0151%; ExAC SAS: 0.0367%; gnomAD_E_AMR: 0.0060%; gnomAD_E_EAS: 0.2962%; gnomAD_E_NFE: 0.0118%; gnomAD_E_SAS: 0.0456%; gnomAD_G_AMR: 0.1196%; gnomAD_G_EAS: 0.2541%

TEKT4P2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.269

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.269

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SPLICE_ACCEPTOR_VARIANT SNV 21-9909279-T-A [0/1] rs796504204

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.275 CONTRIBUTING VARIANT

Transcripts:: TEKT4P2:ENST00000416067.1:n.130-2A>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.7353%; gnomAD_G_AMR: 1.7544%; gnomAD_G_EAS: 1.1765%; gnomAD_G_FIN: 1.8499%; gnomAD_G_NFE: 1.0155%; gnomAD_G_OTH: 0.6623%

SPLICE_REGION_VARIANT SNV 21-9909282-G-A [0/1] rs796601648

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.263 CONTRIBUTING VARIANT

Transcripts:: TEKT4P2:ENST00000416067.1:n.130-5C>T:

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_G_AFR: 0.7991%; gnomAD_G_AMR: 1.7857%; gnomAD_G_EAS: 1.2821%; gnomAD_G_FIN: 1.5963%; gnomAD_G_NFE: 1.1327%; gnomAD_G_OTH: 0.6849%

GPLD1

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 6-24429329-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: GPLD1:ENST00000230036.1:c.2454T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

RALGAPA2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 20-20453523-G-A [0/1] rs1602474521

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: RALGAPA2:ENST00000202677.7:c.5445C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

UGT2A3

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 4-69795762-A-G [0/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: UGT2A3:ENST00000251566.4:c.1353T>C:p.(=); UGT2A3:ENST00000420231.2:c.486T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

ZNF432

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-52537597-G-T [1/1]

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: ZNF432:ENST00000221315.5:c.1335C>A:p.(=); ZNF432:ENST00000594154.1:c.1335C>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: No frequency data

C10orf12

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 10-98742362-G-A [0/1] rs1194780039

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: C10orf12:ENST00000286067.2:c.1215G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

FAM189A1

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 15-29428644-A-G [0/1] rs978303869

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: FAM189A1:ENST00000261275.4:c.852T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%

CDKL4

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 2-39417507-G-C [0/1] rs1341397520

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CDKL4:ENST00000378803.1:c.591C>G:p.(=); CDKL4:ENST00000395035.3:c.591C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; gnomAD_E_AMR: 0.0030%

POU6F2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

Known diseases:: OMIM:601583 Wilms tumor susceptibility-5 (susceptibility); ORPHA:654 Nephroblastoma (susceptibility)

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-39472856-C-T [0/1] rs770670204

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: POU6F2:ENST00000403058.1:c.1207C>T:p.(=); POU6F2:ENST00000518318.2:c.1207C>T:p.(=); POU6F2:ENST00000559001.1:c.1042C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; ExAC AMR: 0.0087%; ExAC NFE: 0.0015%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0009%

CDC42BPG

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 11-64602405-G-A [0/1] rs1319739374

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: CDC42BPG:ENST00000342711.5:c.2091C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0011%; gnomAD_E_EAS: 0.0116%

RNPEPL1

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 2-241515989-G-A [0/1] rs777178847

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: RNPEPL1:ENST00000270357.4:c.855G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0034%; gnomAD_E_EAS: 0.0117%; gnomAD_E_NFE: 0.0009%; gnomAD_E_SAS: 0.0033%; gnomAD_G_NFE: 0.0134%

TMCO4

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 1-20073747-G-A [0/1] rs138797643

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: TMCO4:ENST00000294543.6:c.522C>T:p.(=); TMCO4:ENST00000375122.2:c.522C>T:p.(=); TMCO4:ENST00000375127.1:c.522C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0024%; ESP EA: 0.0116%; ESP All: 0.0077%; ExAC AFR: 0.0101%; ExAC NFE: 0.0061%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0066%; gnomAD_E_EAS: 0.0058%; gnomAD_E_NFE: 0.0063%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0033%

RUSF1

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 16-31503397-T-C [0/1] rs190298510

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.100 CONTRIBUTING VARIANT

Transcripts:: RUSF1:ENST00000327237.2:c.1242A>G:p.(=); RUSF1:ENST00000567994.1:c.1107A>G:p.(=); RUSF1:ENST00000570164.1:c.1236A>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0023%; ExAC EAS: 0.0232%; gnomAD_E_EAS: 0.0348%; gnomAD_E_SAS: 0.0032%

KRTAP5-2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 11-1619403-A-G [0/1] rs569804144

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: KRTAP5-2:ENST00000412090.1:c.78T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0030%; gnomAD_E_FIN: 0.0284%; gnomAD_E_NFE: 0.0426%; gnomAD_E_OTH: 0.0380%; gnomAD_E_SAS: 0.0443%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.052

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 11-1619403-A-G [0/1] rs569804144

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: KRTAP5-2:ENST00000412090.1:c.78T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AMR: 0.0030%; gnomAD_E_FIN: 0.0284%; gnomAD_E_NFE: 0.0426%; gnomAD_E_OTH: 0.0380%; gnomAD_E_SAS: 0.0443%

MISSENSE_VARIANT SNV 11-1619423-T-C [0/1] rs538571214

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.005 CONTRIBUTING VARIANT

Transcripts:: KRTAP5-2:ENST00000412090.1:c.58A>G:p.(Ser20Gly)

Pathogenicity Data:: Best Score: 0.005; Polyphen2: 0.005 (B)

Frequency Data:: gnomAD_E_AFR: 0.0135%; gnomAD_E_AMR: 0.0213%; gnomAD_E_FIN: 0.0767%; gnomAD_E_NFE: 0.1038%; gnomAD_E_OTH: 0.1151%; gnomAD_E_SAS: 0.1383%; gnomAD_G_AFR: 0.0708%; gnomAD_G_AMR: 0.3049%; gnomAD_G_EAS: 0.0761%; gnomAD_G_FIN: 0.3261%; gnomAD_G_NFE: 0.2889%; gnomAD_G_OTH: 0.1235%

Other passed variants:

MISSENSE_VARIANT SNV 11-1619459-T-C [0/1] rs542255670

Variant score: 0.000

Transcripts:: KRTAP5-2:ENST00000412090.1:c.22A>G:p.(Arg8Gly)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B)

Frequency Data:: 1000Genomes: 0.0399%; TOPMed: 0.0399%; gnomAD_E_AFR: 0.0601%; gnomAD_G_AFR: 0.0234%; gnomAD_G_EAS: 0.0637%

CLEC12B

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-10168342-T-C [0/1] rs531439346

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: CLEC12B:ENST00000396502.1:c.696T>C:p.(=); CLEC12B:ENST00000338896.5:c.680+16T>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0023%; ExAC EAS: 0.0116%; ExAC NFE: 0.0015%; gnomAD_E_EAS: 0.0581%; gnomAD_E_NFE: 0.0009%

TTLL6

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 17-46847448-G-A [0/1] rs199679267

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: TTLL6:ENST00000393382.3:c.2052C>T:p.(=); TTLL6:ENST00000433608.2:c.1131C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0599%; TOPMed: 0.0079%; ExAC AFR: 0.0099%; ExAC EAS: 0.0231%; ExAC NFE: 0.0015%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0175%; gnomAD_E_NFE: 0.0018%; gnomAD_G_NFE: 0.0067%

ARNTL2

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 12-27571026-A-C [0/1] rs951223490

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: ARNTL2:ENST00000261178.5:c.1527A>C:p.(=); ARNTL2:ENST00000266503.5:c.1671A>C:p.(=); ARNTL2:ENST00000311001.5:c.1629A>C:p.(=); ARNTL2:ENST00000395901.2:c.1560A>C:p.(=); ARNTL2:ENST00000542388.1:c.1416A>C:p.(=); ARNTL2:ENST00000544915.1:c.1569A>C:p.(=); ARNTL2:ENST00000546179.1:c.1554+2146A>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0008%; gnomAD_E_EAS: 0.0117%; gnomAD_G_EAS: 0.0617%

ZC3HAV1

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-138764604-G-A [0/1] rs768822061

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: ZC3HAV1:ENST00000242351.5:c.1083C>T:p.(=); ZC3HAV1:ENST00000464606.1:c.1083C>T:p.(=); ZC3HAV1:ENST00000471652.1:c.1083C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0174%; gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 7-138764604-G-A [0/1] rs768822061

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: ZC3HAV1:ENST00000242351.5:c.1083C>T:p.(=); ZC3HAV1:ENST00000464606.1:c.1083C>T:p.(=); ZC3HAV1:ENST00000471652.1:c.1083C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0004%; ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0174%; gnomAD_G_EAS: 0.0617%

SYNONYMOUS_VARIANT SNV 7-138764808-G-C [0/1] rs767144137

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: ZC3HAV1:ENST00000242351.5:c.879C>G:p.(=); ZC3HAV1:ENST00000464606.1:c.879C>G:p.(=); ZC3HAV1:ENST00000471652.1:c.879C>G:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: ExAC EAS: 0.0231%; gnomAD_E_EAS: 0.0174%; gnomAD_G_EAS: 0.0617%

CYP2D7

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 22-42536461-C-T [0/1] rs777649126

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: CYP2D7:ENST00000358097.4:c.1323G>A:p.(=); CYP2D7:ENST00000433992.1:c.1380G>A:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0094%; gnomAD_E_AMR: 0.0084%; gnomAD_E_EAS: 0.0587%; gnomAD_E_NFE: 0.0019%; gnomAD_G_EAS: 0.0617%

TMEM133

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 11-100863297-C-T [0/1] rs544581252

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: TMEM133:ENST00000303130.2:c.258C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; ExAC EAS: 0.0116%; gnomAD_E_AFR: 0.0131%; gnomAD_E_EAS: 0.0116%; gnomAD_G_EAS: 0.0618%

CEMIP

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 15-81172082-C-T [0/1] rs147426682

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: CEMIP:ENST00000220244.3:c.267C>T:p.(=); CEMIP:ENST00000356249.5:c.267C>T:p.(=); CEMIP:ENST00000394685.3:c.267C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0223%; ESP AA: 0.0454%; ESP All: 0.0154%; ExAC AFR: 0.0673%; ExAC EAS: 0.0463%; ExAC SAS: 0.0061%; gnomAD_E_AFR: 0.0653%; gnomAD_E_AMR: 0.0089%; gnomAD_E_EAS: 0.0464%; gnomAD_E_NFE: 0.0009%; gnomAD_E_OTH: 0.0183%; gnomAD_E_SAS: 0.0032%; gnomAD_G_AFR: 0.0115%

CCDC106

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 19-56163962-C-T [0/1] rs368332551

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.099 CONTRIBUTING VARIANT

Transcripts:: CCDC106:ENST00000308964.3:c.693C>T:p.(=); CCDC106:ENST00000586790.1:c.693C>T:p.(=); CCDC106:ENST00000588740.1:c.693C>T:p.(=); CCDC106:ENST00000591241.1:c.588C>T:p.(=); CCDC106:ENST00000591578.1:c.693C>T:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: TOPMed: 0.0272%; ESP AA: 0.0227%; ESP All: 0.0077%; ExAC AFR: 0.0683%; gnomAD_E_AFR: 0.0788%; gnomAD_E_AMR: 0.0030%; gnomAD_E_NFE: 0.0009%; gnomAD_G_AFR: 0.0805%

RP11-830F9.6

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.063

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.063

No phenotype matches to diseases with this MOI.

Variants contributing to score:

SYNONYMOUS_VARIANT SNV 16-89017483-C-G [1/1] rs200170070

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.063 CONTRIBUTING VARIANT

Transcripts:: RP11-830F9.6:ENST00000378347.2:c.957C>G:p.(=); RP11-830F9.6:ENST00000268679.4:c.151+25582G>C:p.(=); RP11-830F9.6:ENST00000436887.2:c.151+25582G>C:p.(=); RP11-830F9.6:ENST00000448839.1:c.151+25582G>C:p.(=); RP11-830F9.6:ENST00000360302.2:c.-33+25582G>C:p.(=)

Pathogenicity Data:: No pathogenicity data

Frequency Data:: gnomAD_E_AFR: 1.1911%; gnomAD_E_AMR: 0.1741%; gnomAD_E_EAS: 0.0120%; gnomAD_E_FIN: 0.0314%; gnomAD_E_NFE: 0.0788%; gnomAD_E_OTH: 0.0368%; gnomAD_E_SAS: 0.1701%; gnomAD_G_AFR: 0.8479%; gnomAD_G_AMR: 0.6276%; gnomAD_G_EAS: 0.2252%; gnomAD_G_FIN: 1.3185%; gnomAD_G_NFE: 0.5303%; gnomAD_G_OTH: 0.8811%

ANKRD62

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 18-12127835-G-A [0/1] rs999033599

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.000 CONTRIBUTING VARIANT

Transcripts:: ANKRD62:ENST00000314074.8:c.2609G>A:p.(Arg870His); ANKRD62:ENST00000587848.2:c.2651G>A:p.(Arg884His)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B)

Frequency Data:: TOPMed: 0.0030%; gnomAD_E_AMR: 0.0047%; gnomAD_E_NFE: 0.0079%

NUTM2B

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 10-81471597-C-G [0/1] rs1317635955

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]

Variant score: 0.000 CONTRIBUTING VARIANT

Transcripts:: NUTM2B:ENST00000429828.1:c.1993C>G:p.(Gln665Glu); NUTM2B:ENST00000372321.1:c.1650+475C>G:p.(=); NUTM2B:ENST00000448135.1:c.1851+475C>G:p.(=)

Pathogenicity Data:: Best Score: 0.0; SIFT: 1.000 (T)

Frequency Data:: gnomAD_E_EAS: 0.0140%; gnomAD_E_FIN: 0.0402%; gnomAD_E_NFE: 0.0029%; gnomAD_E_SAS: 0.0087%; gnomAD_G_AFR: 0.0659%; gnomAD_G_EAS: 0.0797%; gnomAD_G_FIN: 0.0634%; gnomAD_G_NFE: 0.0143%

SPRR2F

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

Phenotype matches:

No phenotype or PPI evidence

No known disease

Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

No phenotype matches to diseases with this MOI.

Variants contributing to score:

MISSENSE_VARIANT SNV 1-153085095-A-G [0/1] rs533901980

Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []

Variant score: 0.000 CONTRIBUTING VARIANT

Transcripts:: SPRR2F:ENST00000468739.1:c.115T>C:p.(Ser39Pro); SPRR2F:ENST00000368752.4:c.-20+28808T>C:p.(=)

Pathogenicity Data:: Best Score: 0.0; Polyphen2: 0.000 (B)

Frequency Data:: 1000Genomes: 0.0200%; TOPMed: 0.0212%; gnomAD_E_AFR: 0.0458%; gnomAD_E_NFE: 0.0009%; gnomAD_G_AFR: 0.0574%

About

The Exomizer is a Java program that functionally annotates variants from whole-exome sequencing data starting from a VCF file (version 4). The functional annotation code is based on Jannovar and uses UCSC KnownGene transcript definitions and hg19 genomic coordinates

Variants are prioritized according to user-defined criteria on variant frequency, pathogenicity, quality, inheritance pattern, and model organism phenotype data. Predicted pathogenicity data was extracted from the dbNSFP resource.

Developed by the Computational Biology and Bioinformatics group at the Institute for Medical Genetics and Human Genetics of the Charité - Universitätsmedizin Berlin, the Mouse Informatics Group at the Sanger Institute and the Smedley group at Queen Mary University of London.

Problems, suggestions, or comments? Please let us know