Exomiser Analysis Results for Anonymous

Analysis Settings

Settings used for this analysis:

---
sample:
  genomeAssembly: "hg19"
  vcf: "/exomiser/challenge02.vcf.gz"
  hpoIds:
  - "HP:0001156"
  - "HP:0001363"
  - "HP:0011304"
  - "HP:0010055"
  pedigree: {}
  age: {}
analysis:
  inheritanceModes:
    AUTOSOMAL_RECESSIVE_COMP_HET: 2.0
    MITOCHONDRIAL: 0.2
    AUTOSOMAL_RECESSIVE_HOM_ALT: 0.1
    X_DOMINANT: 0.1
    AUTOSOMAL_DOMINANT: 0.1
    X_RECESSIVE_COMP_HET: 2.0
    X_RECESSIVE_HOM_ALT: 0.1
  frequencySources:
  - "THOUSAND_GENOMES"
  - "TOPMED"
  - "UK10K"
  - "ESP_AFRICAN_AMERICAN"
  - "ESP_EUROPEAN_AMERICAN"
  - "ESP_ALL"
  - "EXAC_AFRICAN_INC_AFRICAN_AMERICAN"
  - "EXAC_AMERICAN"
  - "EXAC_EAST_ASIAN"
  - "EXAC_FINNISH"
  - "EXAC_NON_FINNISH_EUROPEAN"
  - "EXAC_OTHER"
  - "EXAC_SOUTH_ASIAN"
  - "GNOMAD_E_AFR"
  - "GNOMAD_E_AMR"
  - "GNOMAD_E_EAS"
  - "GNOMAD_E_FIN"
  - "GNOMAD_E_NFE"
  - "GNOMAD_E_OTH"
  - "GNOMAD_E_SAS"
  - "GNOMAD_G_AFR"
  - "GNOMAD_G_AMR"
  - "GNOMAD_G_EAS"
  - "GNOMAD_G_FIN"
  - "GNOMAD_G_NFE"
  - "GNOMAD_G_OTH"
  - "GNOMAD_G_SAS"
  pathogenicitySources:
  - "POLYPHEN"
  - "MUTATION_TASTER"
  - "SIFT"
  steps:
  - variantEffectFilter:
      remove:
      - "CODING_TRANSCRIPT_INTRON_VARIANT"
      - "FIVE_PRIME_UTR_EXON_VARIANT"
      - "THREE_PRIME_UTR_EXON_VARIANT"
      - "FIVE_PRIME_UTR_INTRON_VARIANT"
      - "THREE_PRIME_UTR_INTRON_VARIANT"
      - "NON_CODING_TRANSCRIPT_EXON_VARIANT"
      - "NON_CODING_TRANSCRIPT_INTRON_VARIANT"
      - "UPSTREAM_GENE_VARIANT"
      - "DOWNSTREAM_GENE_VARIANT"
      - "INTERGENIC_VARIANT"
      - "REGULATORY_REGION_VARIANT"
  - frequencyFilter:
      maxFrequency: 2.0
  - pathogenicityFilter:
      keepNonPathogenic: true
  - inheritanceFilter: {}
  - omimPrioritiser: {}
  - hiPhivePrioritiser:
      runParams: "human, mouse, fish, ppi"
outputOptions:
  outputPrefix: "results/Pfeiffer-hiphive-exome-PASS_ONLY"
  outputFormats:
  - "HTML"
  - "VCF"
  - "TSV_GENE"
  - "TSV_VARIANT"
  - "JSON"

Filtering Summary

Filter Report Passed filter Failed filter
Variant effect
    Removed variants with effects of type: [CODING_TRANSCRIPT_INTRON_VARIANT, FIVE_PRIME_UTR_EXON_VARIANT, THREE_PRIME_UTR_EXON_VARIANT, FIVE_PRIME_UTR_INTRON_VARIANT, THREE_PRIME_UTR_INTRON_VARIANT, NON_CODING_TRANSCRIPT_EXON_VARIANT, NON_CODING_TRANSCRIPT_INTRON_VARIANT, UPSTREAM_GENE_VARIANT, DOWNSTREAM_GENE_VARIANT, INTERGENIC_VARIANT, REGULATORY_REGION_VARIANT]
1081 0
Frequency
    Variants filtered for maximum allele frequency of 2.00%
1081 0
Pathogenicity
    Retained all non-pathogenic variants of all types. Scoring was applied, but the filter passed all variants.
1081 0
Inheritance
    Genes filtered for compatibility with AUTOSOMAL_DOMINANT, AUTOSOMAL_RECESSIVE, X_RECESSIVE, X_DOMINANT, MITOCHONDRIAL inheritance.
418 0

Variant Type Distribution

Variant Type sample
FRAMESHIFT_ELONGATION 16
FRAMESHIFT_TRUNCATION 16
FRAMESHIFT_VARIANT 11
INTERNAL_FEATURE_ELONGATION 0
FEATURE_TRUNCATION 0
MNV 0
STOP_GAINED 19
STOP_LOST 1
START_LOST 1
SPLICE_ACCEPTOR_VARIANT 8
SPLICE_DONOR_VARIANT 11
MISSENSE_VARIANT 602
INFRAME_INSERTION 6
DISRUPTIVE_INFRAME_INSERTION 11
INFRAME_DELETION 6
DISRUPTIVE_INFRAME_DELETION 9
FIVE_PRIME_UTR_TRUNCATION 0
THREE_PRIME_UTR_TRUNCATION 0
SPLICE_REGION_VARIANT 86
STOP_RETAINED_VARIANT 0
INITIATOR_CODON_VARIANT 0
SYNONYMOUS_VARIANT 278
CODING_TRANSCRIPT_INTRON_VARIANT 0
THREE_PRIME_UTR_EXON_VARIANT 0
FIVE_PRIME_UTR_INTRON_VARIANT 0
THREE_PRIME_UTR_INTRON_VARIANT 0
NON_CODING_TRANSCRIPT_EXON_VARIANT 0
NON_CODING_TRANSCRIPT_INTRON_VARIANT 0
UPSTREAM_GENE_VARIANT 0
DOWNSTREAM_GENE_VARIANT 0
INTERGENIC_VARIANT 0
REGULATORY_REGION_VARIANT 0

Prioritised Genes

Exomiser Score: 0.984

Phenotype Score: 0.869

Variant Score: 0.910

Phenotype matches:
Phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with BCORL1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.501 in interactome to HDAC4 and phenotypic similarity 0.656 to 2q37 microdeletion syndrome associated with HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.501 in interactome to HDAC4 and phenotypic similarity 0.934 to mouse mutant of HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0001363, Craniosynostosis - MP:0030356, premature lambdoid suture closure
HP:0011304, Broad thumb - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0010055, Broad hallux - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
Proximity score 0.501 in interactome to HDAC4 and phenotypic similarity 0.614 to fish mutant of HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0107238, anguloarticular premature ossification, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:301029 Shukla-Vernon syndrome - X-linked recessive
ORPHA:528084 Non-specific syndromic intellectual disability - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.984

Phenotype Score: 0.869

Variant Score: 0.910

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.869 to ORPHA:528084 Non-specific syndromic intellectual disability
Phenotypic similarity 0.432 to OMIM:301029 Shukla-Vernon syndrome
Variants contributing to score:
MISSENSE_VARIANT SNV X-129162702-G-A [0/1] rs199973665
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]
Pathogenicity Data:
Best Score: 0.996
Mutation Taster: 0.865
SIFT: 0.004 (D)
Frequency Data:
1000Genomes: 0.0530%
TOPMed: 0.0302%
ExAC EAS: 0.3767%
gnomAD_E_EAS: 0.4429%
gnomAD_G_EAS: 0.4936%

Exomiser Score: 0.974

Phenotype Score: 0.744

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.744 to mouse mutant involving CPLANE2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0002639, micrognathia
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Proximity score 0.539 in interactome to FUZ and phenotypic similarity 0.251 to Caudal regression sequence associated with FUZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0000921, Missing ribs
HP:0010055, Broad hallux - HP:0001762, Talipes equinovarus
Proximity score 0.539 in interactome to FUZ and phenotypic similarity 0.752 to mouse mutant of FUZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0001293, anophthalmia
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.974

Phenotype Score: 0.744

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-16560112-G-C [0/1] rs1557558792
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
CPLANE2:ENST00000375599.3:c.260C>G:p.(Thr87Ser)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.367 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.971

Phenotype Score: 0.734

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.734 to mouse mutant involving BAIAP2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000565, oligodactyly
HP:0001363, Craniosynostosis - MP:0000079, abnormal basioccipital bone morphology
HP:0011304, Broad thumb - MP:0000565, oligodactyly
HP:0010055, Broad hallux - MP:0000565, oligodactyly
Proximity score 0.501 in interactome to ACTB and phenotypic similarity 0.706 to Baraitser-Winter cerebrofrontofacial syndrome associated with ACTB.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009942, Duplication of thumb phalanx
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0009942, Duplication of thumb phalanx
HP:0010055, Broad hallux - HP:0009942, Duplication of thumb phalanx
Proximity score 0.501 in interactome to ACTB and phenotypic similarity 0.239 to mouse mutant of ACTB.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004527, abnormal outer hair cell stereociliary bundle morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.971

Phenotype Score: 0.734

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-79082790-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.971 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.935

Phenotype Score: 0.652

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.479 to Primary ciliary dyskinesia associated with HYDIN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Phenotypic similarity 0.652 to mouse mutant involving HYDIN.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.502 in interactome to IFT80 and phenotypic similarity 0.662 to Jeune syndrome associated with IFT80.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.502 in interactome to IFT80 and phenotypic similarity 0.702 to mouse mutant of IFT80.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
Known diseases:
OMIM:608647 Ciliary dyskinesia, primary, 5 - autosomal recessive
ORPHA:244 Primary ciliary dyskinesia - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.935

Phenotype Score: 0.652

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.479 to ORPHA:244 Primary ciliary dyskinesia
Variants contributing to score:
FRAMESHIFT_VARIANT DEL 16-70896015-GA-G [0/1] rs11337008
Exomiser ACMG: PATHOGENIC [PVS1, PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
HYDIN:ENST00000393567.2:c.11712del:p.(Ile3904Ilefs*6)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
STOP_LOST SNV 16-71061495-A-G [0/1] rs1022220
Exomiser ACMG: PATHOGENIC [PVS1, PM2]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.328

Phenotype Score: 0.326

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_VARIANT DEL 16-70896015-GA-G [0/1] rs11337008
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
HYDIN:ENST00000393567.2:c.11712del:p.(Ile3904Ilefs*6)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 16-71098649-T-C [0/1] rs3817211
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 0.971 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70926334-G-C [0/1] rs1774423
Variant score: 0.996
Transcripts:
HYDIN:ENST00000393567.2:c.9347C>G:p.(Thr3116Arg)
Pathogenicity Data:
Best Score: 0.996
Mutation Taster: 0.597
SIFT: 0.004 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70896033-C-T [0/1] rs1626593
Variant score: 0.994
Transcripts:
HYDIN:ENST00000393567.2:c.11695G>A:p.(Val3899Met)
Pathogenicity Data:
Best Score: 0.995
SIFT: 0.005 (D)
Frequency Data:
gnomAD_E_SAS: 0.0065%
MISSENSE_VARIANT SNV 16-70917855-A-G [0/1] rs1774331
Variant score: 0.994
Transcripts:
HYDIN:ENST00000393567.2:c.9947T>C:p.(Leu3316Pro)
Pathogenicity Data:
Best Score: 0.994072
Mutation Taster: 0.994 (P)
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70972620-G-C [0/1] rs1774360
Variant score: 0.983
Transcripts:
HYDIN:ENST00000393567.2:c.6892C>G:p.(Arg2298Gly)
Pathogenicity Data:
Best Score: 0.983
Mutation Taster: 0.954 (P)
SIFT: 0.017 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70989335-G-A [0/1] rs1774541
Variant score: 0.982
Transcripts:
HYDIN:ENST00000393567.2:c.6259C>T:p.(Arg2087Cys)
Pathogenicity Data:
Best Score: 0.99982
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0151%
gnomAD_E_EAS: 0.0232%
gnomAD_G_EAS: 0.1235%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 16-70884524-C-G [0/1] rs1798314
Variant score: 0.971
Transcripts:
HYDIN:ENST00000393567.2:c.12478G>C:p.(Glu4160Gln)
Pathogenicity Data:
Best Score: 0.971
SIFT: 0.029 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70902559-C-T [0/1] rs1798413
Variant score: 0.944
Transcripts:
HYDIN:ENST00000393567.2:c.11224G>A:p.(Val3742Ile)
Pathogenicity Data:
Best Score: 0.944
SIFT: 0.056 (D)
Frequency Data:
No frequency data
INFRAME_DELETION DEL 16-70954703-GGCGCTCCTTCTCCGT-G [0/1] rs67115747
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70894087-T-C [0/1] rs1539302
Variant score: 0.849
Transcripts:
HYDIN:ENST00000393567.2:c.12013A>G:p.(Thr4005Ala)
Pathogenicity Data:
Best Score: 0.949
Mutation Taster: 0.937
SIFT: 0.051 (D)
Frequency Data:
gnomAD_E_AMR: 0.0032%
gnomAD_E_NFE: 0.0009%
gnomAD_G_AFR: 0.3475%
gnomAD_G_AMR: 0.4587%
gnomAD_G_EAS: 0.0714%
gnomAD_G_FIN: 0.5756%
gnomAD_G_NFE: 0.1181%
gnomAD_G_OTH: 0.3788%
MISSENSE_VARIANT SNV 16-71101200-T-C [0/1] rs10744982
Pathogenicity Data:
Best Score: 0.967
Polyphen2: 0.491 (P)
Mutation Taster: 0.947 (P)
SIFT: 0.033 (D)
Frequency Data:
gnomAD_E_AFR: 0.1663%
gnomAD_E_AMR: 0.0756%
gnomAD_E_EAS: 0.0945%
gnomAD_E_NFE: 0.0289%
gnomAD_E_OTH: 0.0554%
gnomAD_E_SAS: 0.0328%
gnomAD_G_AFR: 0.7378%
gnomAD_G_EAS: 0.3708%
gnomAD_G_FIN: 0.2583%
gnomAD_G_NFE: 0.3007%
gnomAD_G_OTH: 0.3074%
SPLICE_REGION_VARIANT SNV 16-70913501-T-C [0/1] rs1774325
Variant score: 0.800
Transcripts:
HYDIN:ENST00000393567.2:c.10367+7A>G:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 16-71015290-C-G [0/1] rs2669067
Variant score: 0.800
Transcripts:
HYDIN:ENST00000393567.2:c.4510+4G>C:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 16-70891778-C-G [0/1] rs1774417
Variant score: 0.795
Transcripts:
HYDIN:ENST00000393567.2:c.12130-5G>C:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.0470%
MISSENSE_VARIANT SNV 16-71054178-T-C [0/1] rs6416709
Pathogenicity Data:
Best Score: 0.759
SIFT: 0.241 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
gnomAD_E_AMR: 0.0152%
gnomAD_E_NFE: 0.0036%
gnomAD_E_SAS: 0.0033%
MISSENSE_VARIANT SNV 16-70954945-T-A [0/1] rs1798532
Variant score: 0.682
Transcripts:
HYDIN:ENST00000393567.2:c.7334A>T:p.(Asn2445Ile)
Pathogenicity Data:
Best Score: 0.68200004
SIFT: 0.318 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70897039-C-G [0/1] rs1798325
Variant score: 0.641
Transcripts:
HYDIN:ENST00000393567.2:c.11518G>C:p.(Val3840Leu)
Pathogenicity Data:
Best Score: 0.64100003
SIFT: 0.359 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70896122-A-C [0/1] rs7192347
Variant score: 0.613
Transcripts:
HYDIN:ENST00000393567.2:c.11606T>G:p.(Met3869Arg)
Pathogenicity Data:
Best Score: 0.61399996
SIFT: 0.386 (T)
Frequency Data:
gnomAD_G_AFR: 0.0115%
MISSENSE_VARIANT SNV 16-70954691-T-C [0/1] rs1798528
Variant score: 0.567
Transcripts:
HYDIN:ENST00000393567.2:c.7588A>G:p.(Lys2530Glu)
Pathogenicity Data:
Best Score: 0.56700003
SIFT: 0.433 (T)
Frequency Data:
TOPMed: 0.0004%
MISSENSE_VARIANT SNV 16-70902568-C-T [0/1] rs1774504
Variant score: 0.528
Transcripts:
HYDIN:ENST00000393567.2:c.11215G>A:p.(Ala3739Thr)
Pathogenicity Data:
Best Score: 0.528
SIFT: 0.472 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70954513-T-C [0/1] rs1774395
Variant score: 0.510
Transcripts:
HYDIN:ENST00000393567.2:c.7766A>G:p.(Lys2589Arg)
Pathogenicity Data:
Best Score: 0.51
SIFT: 0.490 (T)
Frequency Data:
TOPMed: 0.0008%
MISSENSE_VARIANT SNV 16-70954571-C-T [0/1] rs8044001
Variant score: 0.464
Transcripts:
HYDIN:ENST00000393567.2:c.7708G>A:p.(Asp2570Asn)
Pathogenicity Data:
Best Score: 0.464
SIFT: 0.536 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70989299-C-T [0/1] rs1798337
Variant score: 0.312
Transcripts:
HYDIN:ENST00000393567.2:c.6295G>A:p.(Val2099Met)
Pathogenicity Data:
Best Score: 0.31199998
SIFT: 0.688 (T)
Frequency Data:
TOPMed: 0.0032%
MISSENSE_VARIANT SNV 16-70954606-C-T [0/1] rs8044142
Variant score: 0.182
Transcripts:
HYDIN:ENST00000393567.2:c.7673G>A:p.(Gly2558Glu)
Pathogenicity Data:
Best Score: 0.18199998
SIFT: 0.818 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70942688-A-C [0/1] rs1774449
Variant score: 0.143
Transcripts:
HYDIN:ENST00000393567.2:c.8081T>G:p.(Ile2694Ser)
Pathogenicity Data:
Best Score: 0.143
SIFT: 0.857 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70954774-A-G [0/1] rs1798529
Variant score: 0.105
Transcripts:
HYDIN:ENST00000393567.2:c.7505T>C:p.(Leu2502Ser)
Pathogenicity Data:
Best Score: 0.10500002
SIFT: 0.895 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70894024-C-T [0/1] rs11075798
Variant score: 0.103
Transcripts:
HYDIN:ENST00000393567.2:c.12076G>A:p.(Ala4026Thr)
Pathogenicity Data:
Best Score: 0.102999985
SIFT: 0.897 (T)
Frequency Data:
gnomAD_G_AFR: 0.0129%
gnomAD_G_NFE: 0.0068%
SYNONYMOUS_VARIANT SNV 16-70884534-T-A [0/1] rs1798315
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.12468A>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70896118-A-G [0/1] rs1774421
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.11610T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70908239-G-A [0/1] rs1774311
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.10917C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70908736-A-G [0/1] rs1354550
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.10644T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70913386-G-A [0/1] rs1774323
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.10371C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70934994-C-T [0/1] rs2502696
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.8961G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70954572-T-A [0/1] rs8045289
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.7707A>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70954809-C-A [0/1] rs1798530
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.7470G>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70986480-G-A [0/1] rs2458386
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.6375C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-71008169-T-C [0/1] rs1774293
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.4944A>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 16-70889147-A-G [0/1] rs2502698
Variant score: 0.100
Transcripts:
HYDIN:ENST00000393567.2:c.12327T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0094%
gnomAD_E_EAS: 0.0060%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0189%
gnomAD_E_SAS: 0.0033%
gnomAD_G_NFE: 0.0139%
SYNONYMOUS_VARIANT SNV 16-71094434-G-A [0/1] rs2271453
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_NFE: 0.0076%
gnomAD_E_OTH: 0.0591%
gnomAD_E_SAS: 0.0143%
gnomAD_G_NFE: 0.0070%
SYNONYMOUS_VARIANT SNV 16-71026098-C-T [0/1] rs704641
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
ExAC AFR: 0.1134%
ExAC EAS: 0.0234%
ExAC NFE: 0.0031%
gnomAD_E_AFR: 0.0683%
gnomAD_E_EAS: 0.0130%
gnomAD_E_FIN: 0.0049%
gnomAD_E_NFE: 0.0061%
gnomAD_G_AFR: 0.0475%
gnomAD_G_FIN: 0.0288%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 16-70902683-G-A [0/1] rs2502690
Variant score: 0.098
Transcripts:
HYDIN:ENST00000393567.2:c.11100C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.1179%
gnomAD_E_AMR: 0.0060%
gnomAD_G_AFR: 0.0803%
SYNONYMOUS_VARIANT SNV 16-71025245-C-T [0/1] rs1774516
Variant score: 0.098
Transcripts:
HYDIN:ENST00000393567.2:c.3840G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_FIN: 0.0046%
gnomAD_E_NFE: 0.0054%
gnomAD_G_AFR: 0.0508%
gnomAD_G_AMR: 0.1330%
gnomAD_G_EAS: 0.1439%
gnomAD_G_NFE: 0.0437%
SYNONYMOUS_VARIANT SNV 16-71163579-C-T [0/1] rs929311
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0186%
gnomAD_E_EAS: 0.0060%
gnomAD_E_FIN: 0.0092%
gnomAD_E_NFE: 0.0083%
gnomAD_E_OTH: 0.0191%
gnomAD_E_SAS: 0.0138%
gnomAD_G_AFR: 0.0991%
gnomAD_G_EAS: 0.1418%
gnomAD_G_NFE: 0.0508%
gnomAD_G_OTH: 0.3326%
MISSENSE_VARIANT SNV 16-71026076-C-G [0/1] rs1774513
Pathogenicity Data:
Best Score: 0.046000004
SIFT: 0.954 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70917931-C-G [0/1] rs1798440
Variant score: 0.000
Transcripts:
HYDIN:ENST00000393567.2:c.9871G>C:p.(Ala3291Pro)
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70975565-T-C [0/1] rs1815707
Variant score: 0.000
Transcripts:
HYDIN:ENST00000393567.2:c.6827A>G:p.(Gln2276Arg)
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 16-70975667-T-C [0/1] rs2258307
Variant score: 0.000
Transcripts:
HYDIN:ENST00000393567.2:c.6725A>G:p.(Gln2242Arg)
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
gnomAD_E_AFR: 0.2650%
gnomAD_E_AMR: 0.3918%
gnomAD_E_EAS: 0.7308%
gnomAD_E_FIN: 0.0046%
gnomAD_E_NFE: 0.1732%
gnomAD_E_OTH: 0.3832%
gnomAD_E_SAS: 0.2220%
gnomAD_G_AFR: 0.0494%
gnomAD_G_AMR: 0.1316%
gnomAD_G_FIN: 0.0307%
gnomAD_G_NFE: 0.0215%

Exomiser Score: 0.925

Phenotype Score: 0.637

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.637 to mouse mutant involving PKD1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003409, decreased width of hypertrophic chondrocyte zone
HP:0001363, Craniosynostosis - MP:0003420, delayed intramembranous bone ossification
HP:0011304, Broad thumb - MP:0003409, decreased width of hypertrophic chondrocyte zone
HP:0010055, Broad hallux - MP:0003409, decreased width of hypertrophic chondrocyte zone
Proximity score 0.508 in interactome to IFT88 and phenotypic similarity 0.814 to mouse mutant of IFT88.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0003840, abnormal coronal suture morphology
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005104, abnormal tarsal bone morphology
Known diseases:
OMIM:173900 Polycystic kidney disease 1 - autosomal dominant
ORPHA:730 Autosomal dominant polycystic kidney disease - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.925

Phenotype Score: 0.637

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-2156949-C-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.996 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.017 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.923

Phenotype Score: 0.638

Variant Score: 0.996

Phenotype matches:
Phenotypic similarity 0.638 to Erythrokeratodermia variabilis associated with GJB4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to GJB3 and phenotypic similarity 0.638 to Erythrokeratodermia variabilis associated with GJB3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Known diseases:
OMIM:617524 Erythrokeratodermia variabilis et progressiva 2 - autosomal dominant
ORPHA:317 Erythrokeratodermia variabilis - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.923

Phenotype Score: 0.638

Variant Score: 0.996

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.638 to ORPHA:317 Erythrokeratodermia variabilis
Phenotypic similarity 0.175 to OMIM:617524 Erythrokeratodermia variabilis et progressiva 2
Variants contributing to score:
MISSENSE_VARIANT SNV 1-35227528-C-T [0/1] rs758125233
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]
Variant score: 0.996 CONTRIBUTING VARIANT
Transcripts:
GJB4:ENST00000339480.1:c.673C>T:p.(Arg225Trp)
Pathogenicity Data:
Best Score: 0.997
Polyphen2: 0.394 (B)
SIFT: 0.003 (D)
Frequency Data:
TOPMed: 0.0004%
ExAC SAS: 0.0061%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.861

Phenotype Score: 0.570

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.570 to Kleefstra syndrome due to a point mutation associated with KMT2C.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001182, Tapered finger
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0001182, Tapered finger
Phenotypic similarity 0.268 to mouse mutant involving KMT2C.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001290, delayed eyelid opening
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.535 in interactome to KDM4B and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with KDM4B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Known diseases:
OMIM:617768 Kleefstra syndrome 2 - autosomal dominant
ORPHA:261652 Kleefstra syndrome due to a point mutation - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.861

Phenotype Score: 0.570

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.570 to ORPHA:261652 Kleefstra syndrome due to a point mutation
Phenotypic similarity 0.426 to OMIM:617768 Kleefstra syndrome 2
Variants contributing to score:
STOP_GAINED SNV 7-151927023-G-C [0/1] rs58528565
Exomiser ACMG: PATHOGENIC [PVS1, PM2]
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.210

Phenotype Score: 0.268

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
STOP_GAINED SNV 7-151927023-G-C [0/1] rs58528565
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 7-151935871-C-A [0/1] rs111493987
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 0.999989
Polyphen2: 0.996 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.006 (D)
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 7-151935799-A-G [0/1] rs199839047
Pathogenicity Data:
Best Score: 0.999337
Polyphen2: 0.796 (P)
Mutation Taster: 0.999 (P)
SIFT: 0.001 (D)
Frequency Data:
TOPMed: 0.0004%
MISSENSE_VARIANT SNV 7-151927067-T-C [0/1] rs60244562
Pathogenicity Data:
Best Score: 0.994
Polyphen2: 0.994 (D)
Mutation Taster: 0.986 (P)
SIFT: 0.023 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 7-151935866-G-A [0/1] rs112515611
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 0.977932
Polyphen2: 0.131 (B)
Mutation Taster: 0.978 (P)
SIFT: 0.031 (D)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 7-151935798-G-T [0/1] rs201452267
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.848

Phenotype Score: 0.737

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.709 to Short-rib thoracic dysplasia 9 with or without polydactyly associated with IFT140.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009803, Short phalanx of finger
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger
HP:0010055, Broad hallux - HP:0009803, Short phalanx of finger
Phenotypic similarity 0.737 to mouse mutant involving IFT140.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Proximity score 0.524 in interactome to IFT43 and phenotypic similarity 0.729 to Cranioectodermal dysplasia associated with IFT43.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0008388, Abnormal toenail morphology
Known diseases:
OMIM:266920 Short-rib thoracic dysplasia 9 with or without polydactyly - autosomal recessive
OMIM:617781 Retinitis pigmentosa 80 - autosomal recessive
ORPHA:474 Jeune syndrome - autosomal recessive
ORPHA:65 Leber congenital amaurosis - autosomal dominant/recessive
ORPHA:791 Retinitis pigmentosa - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.848

Phenotype Score: 0.737

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 16-1630850-C-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
IFT140:ENST00000426508.2:c.1434G>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.847

Phenotype Score: 0.737

Variant Score: 0.799

Phenotype matches:
Phenotypic similarity 0.737 to Intellectual disability-craniofacial dysmorphism-cryptorchidism syndrome associated with PACS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001238, Slender finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0001238, Slender finger
Known diseases:
OMIM:615009 Schuurs-Hoeijmakers syndrome - autosomal dominant
ORPHA:329224 Intellectual disability-craniofacial dysmorphism-cryptorchidism syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.847

Phenotype Score: 0.737

Variant Score: 0.799

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.737 to ORPHA:329224 Intellectual disability-craniofacial dysmorphism-cryptorchidism syndrome
Phenotypic similarity 0.352 to OMIM:615009 Schuurs-Hoeijmakers syndrome
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 11-65983585-C-T [0/1] rs79265330
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4]
Variant score: 0.799 CONTRIBUTING VARIANT
Transcripts:
PACS1:ENST00000320580.4:c.661-5C>T:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_EAS: 0.0116%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.841

Phenotype Score: 0.555

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.539 to Van Maldergem syndrome 1 associated with DCHS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0030084, Clinodactyly
HP:0001363, Craniosynostosis - HP:0010537, Wide cranial sutures
HP:0011304, Broad thumb - HP:0010554, Cutaneous finger syndactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Phenotypic similarity 0.555 to mouse mutant involving DCHS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0012279, wide sternum
HP:0001363, Craniosynostosis - MP:0008272, abnormal endochondral bone ossification
HP:0011304, Broad thumb - MP:0012279, wide sternum
HP:0010055, Broad hallux - MP:0012279, wide sternum
Proximity score 0.501 in interactome to FAT4 and phenotypic similarity 0.739 to Hennekam syndrome associated with FAT4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0006101, Finger syndactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0006101, Finger syndactyly
Proximity score 0.501 in interactome to FAT4 and phenotypic similarity 0.553 to mouse mutant of FAT4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0012279, wide sternum
HP:0001363, Craniosynostosis - MP:0008272, abnormal endochondral bone ossification
HP:0011304, Broad thumb - MP:0012279, wide sternum
HP:0010055, Broad hallux - MP:0012279, wide sternum
Known diseases:
OMIM:601390 Van Maldergem syndrome 1 - autosomal recessive
OMIM:607829 Mitral valve prolapse 2 - autosomal dominant
ORPHA:314679 Cerebrofacioarticular syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.841

Phenotype Score: 0.555

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-6644241-C-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
DCHS1:ENST00000299441.3:c.8666G>C:p.(Arg2889Pro)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.968 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.018 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.832

Phenotype Score: 0.555

Variant Score: 0.993

Phenotype matches:
Proximity score 0.555 in interactome to GATAD2B and phenotypic similarity 0.745 to Severe intellectual disability-poor language-strabismus-grimacing face-long fingers syndrome associated with GATAD2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010511, Long toe
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger
HP:0010055, Broad hallux - HP:0010511, Long toe
Proximity score 0.555 in interactome to GATAD2B and phenotypic similarity 0.252 to mouse mutant of GATAD2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.832

Phenotype Score: 0.555

Variant Score: 0.993

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-126678112-T-C [0/1] rs201769282
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.994
Polyphen2: 0.406 (B)
SIFT: 0.006 (D)
Frequency Data:
gnomAD_E_EAS: 0.0058%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.076

Phenotype Score: 0.555

Variant Score: 0.547

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-126678112-T-C [0/1] rs201769282
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.994
Polyphen2: 0.406 (B)
SIFT: 0.006 (D)
Frequency Data:
gnomAD_E_EAS: 0.0058%
SYNONYMOUS_VARIANT SNV 10-126678102-G-A [0/1] rs75408575
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.823

Phenotype Score: 0.712

Variant Score: 0.809

Phenotype matches:
Phenotypic similarity 0.712 to Trichothiodystrophy associated with RNF113A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Phenotypic similarity 0.262 to mouse mutant involving RNF113A.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to SNIP1 and phenotypic similarity 0.761 to Psychomotor retardation, epilepsy, and craniofacial dysmorphism associated with SNIP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001182, Tapered finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0001182, Tapered finger
Proximity score 0.500 in interactome to SNIP1 and phenotypic similarity 0.262 to mouse mutant of SNIP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0006241, abnormal placement of pupils
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:300953 Trichothiodystrophy 5, nonphotosensitive - X-linked dominant
ORPHA:33364 Trichothiodystrophy - X-linked dominant
Gene scores under compatible inheritance modes:

X_DOMINANT

Exomiser Score: 0.823

Phenotype Score: 0.712

Variant Score: 0.809

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.712 to ORPHA:33364 Trichothiodystrophy
Variants contributing to score:
MISSENSE_VARIANT SNV X-119005311-T-C [0/1] rs1393093562
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4, BP4]
Variant score: 0.809 CONTRIBUTING VARIANT
Transcripts:
RNF113A:ENST00000371442.2:c.266A>G:p.(Glu89Gly)
Pathogenicity Data:
Best Score: 0.809
Polyphen2: 0.002 (B)
SIFT: 0.191 (T)
Frequency Data:
TOPMed: 0.0008%

X_RECESSIVE

Exomiser Score: 0.037

Phenotype Score: 0.250

Variant Score: 0.809

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-119005311-T-C [0/1] rs1393093562
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.809 CONTRIBUTING VARIANT
Transcripts:
RNF113A:ENST00000371442.2:c.266A>G:p.(Glu89Gly)
Pathogenicity Data:
Best Score: 0.809
Polyphen2: 0.002 (B)
SIFT: 0.191 (T)
Frequency Data:
TOPMed: 0.0008%

TDG

Exomiser Score: 0.812

Phenotype Score: 0.536

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.384 to mouse mutant involving TDG.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006279, abnormal limb development
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0006279, abnormal limb development
HP:0010055, Broad hallux - MP:0006279, abnormal limb development
Proximity score 0.536 in interactome to MBD4 and phenotypic similarity 0.772 to mouse mutant of MBD4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004083, polysyndactyly
HP:0001363, Craniosynostosis - MP:0001286, abnormal eye development
HP:0011304, Broad thumb - MP:0005230, ectrodactyly
HP:0010055, Broad hallux - MP:0005230, ectrodactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.812

Phenotype Score: 0.536

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT INS 12-104378698-G-GAGGATGCAAAGAAGATGGCTGTTAAGGAA [0/1] rs764159587
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.806

Phenotype Score: 0.536

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT INS 12-104378698-G-GAGGATGCAAAGAAGATGGCTGTTAAGGAA [0/1] rs764159587
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_DONOR_VARIANT INS 12-104379508-T-TGGAGTTAAGAGGAGAATC [0/1] rs749286024
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0067%
gnomAD_E_AMR: 0.0032%
gnomAD_E_FIN: 0.0232%
gnomAD_E_NFE: 0.0224%
gnomAD_E_OTH: 0.0194%
gnomAD_E_SAS: 0.0645%
Other passed variants:
SYNONYMOUS_VARIANT SNV 12-104380766-C-T [0/1] rs142826846
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0799%
ExAC EAS: 0.1387%
gnomAD_E_EAS: 0.1276%
gnomAD_G_EAS: 0.3083%

Exomiser Score: 0.809

Phenotype Score: 0.534

Variant Score: 1.000

Phenotype matches:
Proximity score 0.534 in interactome to ALX4 and phenotypic similarity 0.839 to Enlarged parietal foramina associated with ALX4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0011304, Broad thumb
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0011304, Broad thumb
Proximity score 0.534 in interactome to ALX4 and phenotypic similarity 0.775 to mouse mutant of ALX4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0000109, abnormal parietal bone morphology
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Known diseases:
OMIM:617039 Patent ductus arteriosus 3 - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.809

Phenotype Score: 0.534

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-122495312-G-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
PRDM6:ENST00000407847.4:c.1133G>A:p.(Cys378Tyr)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.737 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.079 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.805

Phenotype Score: 0.533

Variant Score: 0.998

Phenotype matches:
Phenotypic similarity 0.334 to Autosomal dominant hypohidrotic ectodermal dysplasia associated with TRAF6.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001231, Abnormal fingernail morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001231, Abnormal fingernail morphology
HP:0010055, Broad hallux - HP:0001231, Abnormal fingernail morphology
Phenotypic similarity 0.533 to mouse mutant involving TRAF6.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000133, abnormal long bone metaphysis morphology
HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density
HP:0011304, Broad thumb - MP:0000133, abnormal long bone metaphysis morphology
HP:0010055, Broad hallux - MP:0000133, abnormal long bone metaphysis morphology
Proximity score 0.533 in interactome to DYNC2I2 and phenotypic similarity 0.662 to Jeune syndrome associated with DYNC2I2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.533 in interactome to DYNC2I2 and phenotypic similarity 0.699 to mouse mutant of DYNC2I2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0001297, microphthalmia
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Known diseases:
ORPHA:1810 Autosomal dominant hypohidrotic ectodermal dysplasia - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.805

Phenotype Score: 0.533

Variant Score: 0.998

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.334 to ORPHA:1810 Autosomal dominant hypohidrotic ectodermal dysplasia
Variants contributing to score:
MISSENSE_VARIANT SNV 11-36511736-T-C [0/1] rs1299539710
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999982
Polyphen2: 0.831 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0004%
gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.785

Phenotype Score: 0.520

Variant Score: 1.000

Phenotype matches:
Proximity score 0.520 in interactome to MAP3K20 and phenotypic similarity 0.382 to Split-foot malformation with mesoaxial polydactyly associated with MAP3K20.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0012725, Cutaneous syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0012725, Cutaneous syndactyly
HP:0010055, Broad hallux - HP:0012725, Cutaneous syndactyly
Proximity score 0.520 in interactome to MAP3K20 and phenotypic similarity 0.723 to mouse mutant of MAP3K20.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.785

Phenotype Score: 0.520

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-14551121-C-T [0/1] rs1347176681
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
PKN1:ENST00000342216.4:c.19C>T:p.(Pro7Ser)
PKN1:ENST00000242783.6:c.22-834C>T:p.(=)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.986 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.129 (T)
Frequency Data:
gnomAD_E_NFE: 0.0022%

Exomiser Score: 0.778

Phenotype Score: 0.629

Variant Score: 0.871

Phenotype matches:
Phenotypic similarity 0.629 to mouse mutant involving PRKRA.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to TNRC6B and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with TNRC6B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Known diseases:
OMIM:612067 Dystonia 16 - autosomal recessive
ORPHA:210571 Dystonia 16 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.778

Phenotype Score: 0.629

Variant Score: 0.871

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-179306420-A-G [0/1] rs201959988
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999994
Polyphen2: 0.936 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
gnomAD_E_EAS: 0.0058%
MISSENSE_VARIANT SNV 2-179309165-G-A [0/1] rs75862065
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3, BP6]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.993 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.008 (D)
Frequency Data:
gnomAD_E_AFR: 0.2121%
gnomAD_E_AMR: 1.0638%
gnomAD_E_EAS: 0.5170%
gnomAD_E_FIN: 0.3058%
gnomAD_E_NFE: 0.5882%
gnomAD_E_OTH: 0.6875%
gnomAD_E_SAS: 0.5048%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.301

Phenotype Score: 0.315

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-179306420-A-G [0/1] rs201959988
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999994
Polyphen2: 0.936 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.773

Phenotype Score: 0.513

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.340 to Immunodeficiency 10 associated with STIM1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002164, Nail dysplasia
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0002164, Nail dysplasia
HP:0010055, Broad hallux - HP:0002164, Nail dysplasia
Phenotypic similarity 0.320 to mouse mutant involving STIM1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.513 in interactome to ASPH and phenotypic similarity 0.737 to mouse mutant of ASPH.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
Known diseases:
OMIM:160565 Myopathy, tubular aggregate, 1 - autosomal dominant
OMIM:185070 Stormorken syndrome - autosomal dominant
OMIM:612783 Immunodeficiency 10 - autosomal recessive
ORPHA:2593 Tubular aggregate myopathy - autosomal dominant
ORPHA:3204 Stormorken-Sjaastad-Langslet syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.773

Phenotype Score: 0.513

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.158 to OMIM:160565 Myopathy, tubular aggregate, 1
Variants contributing to score:
MISSENSE_VARIANT SNV 11-4080605-G-A [0/1] rs752494097
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.843 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.764

Phenotype Score: 0.508

Variant Score: 1.000

Phenotype matches:
Proximity score 0.508 in interactome to APC2 and phenotypic similarity 0.717 to Sotos syndrome associated with APC2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0005617, Bilateral camptodactyly
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.764

Phenotype Score: 0.508

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-45214523-A-C [0/1] rs62075617
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.521 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.055 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.764

Phenotype Score: 0.508

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-45214523-A-C [0/1] rs62075617
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.521 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.055 (D)
Frequency Data:
No frequency data
FRAMESHIFT_VARIANT DEL 17-45214613-TA-T [0/1] rs1555785828
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
FRAMESHIFT_ELONGATION INS 17-45214617-G-GC [0/1] rs138264973
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214633-A-C [0/1] rs148087250
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.004 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214648-G-C [0/1] rs796969472
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.647 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214651-T-G [0/1] rs796265930
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.101 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.009 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214654-C-T [0/1] rs775321736
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.931 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214669-T-G [0/1] rs62075620
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.895 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214699-T-C [0/1] rs62075623
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.455 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.007 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45216169-T-G [0/1] rs77891297
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.992 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.005 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45216172-A-G [0/1] rs76836152
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.998 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45221298-A-G [0/1] rs80120716
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.003 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.127 (T)
Frequency Data:
No frequency data
FRAMESHIFT_ELONGATION INS 17-45232087-T-TAC [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
STOP_GAINED SNV 17-45232102-A-C [0/1] rs796572277
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234343-T-G [0/1] rs3208659
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.540 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.042 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV 17-45234360-A-C [0/1] rs62077264
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234663-A-C [0/1] rs370261409
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.002 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.261 (T)
Frequency Data:
No frequency data
STOP_GAINED SNV 17-45234721-T-A [0/1] rs199899451
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45249365-C-T [0/1] rs62077268
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.758 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.083 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45249391-T-G [0/1] rs62077270
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.942 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45232151-A-C [0/1] rs79452779
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.991 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45216132-T-G [0/1] rs62075657
Pathogenicity Data:
Best Score: 0.999998
Polyphen2: 0.995 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45232093-T-C [0/1] rs200061079
Pathogenicity Data:
Best Score: 0.999998
Mutation Taster: 1.000 (P)
SIFT: 0.084 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45232109-A-G [0/1] rs76383230
Pathogenicity Data:
Best Score: 0.999998
Polyphen2: 0.101 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.007 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234706-G-C [0/1] rs143453365
Pathogenicity Data:
Best Score: 0.999997
Polyphen2: 0.005 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.338 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234403-T-G [0/1] rs75184508
Pathogenicity Data:
Best Score: 0.999996
Polyphen2: 0.007 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.447 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234685-G-A [0/1] rs149474782
Pathogenicity Data:
Best Score: 0.999996
Polyphen2: 0.001 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.694 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214592-T-G [0/1] rs79285536
Pathogenicity Data:
Best Score: 0.999994
Polyphen2: 0.079 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.007 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234702-T-C [0/1] rs147617501
Pathogenicity Data:
Best Score: 0.99999
Polyphen2: 0.004 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.304 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234654-T-G [0/1] rs374614181
Pathogenicity Data:
Best Score: 0.999982
Polyphen2: 0.093 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.100 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45221273-A-C [0/1] rs1141701
Pathogenicity Data:
Best Score: 0.999962
Polyphen2: 0.548 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.050 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45214600-A-G [0/1] rs112627286
Pathogenicity Data:
Best Score: 0.99982
Polyphen2: 0.002 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.456 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45216162-A-C [0/1] rs111227623
Pathogenicity Data:
Best Score: 0.999577
Polyphen2: 0.082 (B)
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234720-T-C [0/1] rs202182614
Pathogenicity Data:
Best Score: 0.998578
Polyphen2: 0.006 (B)
Mutation Taster: 0.999 (P)
SIFT: 0.128 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234680-G-C [0/1] rs368304141
Pathogenicity Data:
Best Score: 0.997774
Polyphen2: 0.001 (B)
Mutation Taster: 0.998 (P)
SIFT: 0.139 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234298-G-C [0/1] rs62077263
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.667 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.065 (T)
Frequency Data:
gnomAD_E_FIN: 0.0091%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0185%
gnomAD_E_SAS: 0.0067%
MISSENSE_VARIANT SNV 17-45229253-T-G [0/1] rs200834582
Pathogenicity Data:
Best Score: 0.999994
Polyphen2: 0.341 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.012 (D)
Frequency Data:
gnomAD_E_OTH: 0.0190%
gnomAD_E_SAS: 0.0034%
MISSENSE_VARIANT SNV 17-45229254-T-G [0/1] rs201804958
Pathogenicity Data:
Best Score: 0.999974
Polyphen2: 0.158 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.017 (D)
Frequency Data:
gnomAD_E_OTH: 0.0190%
MISSENSE_VARIANT SNV 17-45232088-T-C [0/1] rs796316978
Pathogenicity Data:
Best Score: 0.996494
Polyphen2: 0.001 (B)
Mutation Taster: 0.996 (P)
SIFT: 0.271 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45219332-T-G [0/1] rs62077261
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.878 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.019 (D)
Frequency Data:
gnomAD_E_AFR: 0.0138%
gnomAD_E_AMR: 0.0553%
gnomAD_E_EAS: 0.0502%
gnomAD_E_FIN: 0.0185%
gnomAD_E_NFE: 0.0111%
gnomAD_E_OTH: 0.0386%
gnomAD_E_SAS: 0.0034%
MISSENSE_VARIANT SNV 17-45234678-G-C [0/1] rs376818791
Pathogenicity Data:
Best Score: 0.959
Polyphen2: 0.002 (B)
Mutation Taster: 0.832
SIFT: 0.041 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45221286-C-T [0/1] rs77440865
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.895 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
gnomAD_E_AFR: 0.0087%
gnomAD_E_AMR: 0.2800%
gnomAD_E_EAS: 0.0621%
gnomAD_E_FIN: 0.0330%
gnomAD_E_NFE: 0.0523%
gnomAD_E_OTH: 0.0248%
gnomAD_E_SAS: 0.2146%
gnomAD_G_FIN: 0.0911%
MISSENSE_VARIANT SNV 17-45234658-T-G [0/1] rs368750026
Pathogenicity Data:
Best Score: 0.954154
Polyphen2: 0.004 (B)
Mutation Taster: 0.954 (P)
SIFT: 0.056 (D)
Frequency Data:
ExAC FIN: 0.0151%
gnomAD_E_FIN: 0.0045%
MISSENSE_VARIANT SNV 17-45221318-A-C [0/1] rs77739281
Pathogenicity Data:
Best Score: 0.999906
Polyphen2: 0.011 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.077 (T)
Frequency Data:
gnomAD_E_AFR: 0.0181%
gnomAD_E_AMR: 0.4336%
gnomAD_E_EAS: 0.0681%
gnomAD_E_FIN: 0.0430%
gnomAD_E_NFE: 0.0791%
gnomAD_E_OTH: 0.2074%
gnomAD_E_SAS: 0.3257%
gnomAD_G_FIN: 0.0605%
MISSENSE_VARIANT SNV 17-45234430-A-G [0/1] rs78072949
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.010 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.099 (T)
Frequency Data:
gnomAD_E_AFR: 0.0469%
gnomAD_E_AMR: 0.4822%
gnomAD_E_EAS: 0.2092%
gnomAD_E_FIN: 0.1639%
gnomAD_E_NFE: 0.1398%
gnomAD_E_OTH: 0.2127%
gnomAD_E_SAS: 0.4125%
gnomAD_G_AFR: 0.0241%
gnomAD_G_FIN: 0.0314%
DISRUPTIVE_INFRAME_INSERTION INS 17-45221346-G-GCCC [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 17-45214510-C-G [0/1] rs112530322
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC NFE: 0.0017%
MISSENSE_VARIANT SNV 17-45234665-T-A [0/1] rs374472811
Pathogenicity Data:
Best Score: 0.66499996
Polyphen2: 0.001 (B)
SIFT: 0.335 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45234666-T-A [0/1] rs367644695
Pathogenicity Data:
Best Score: 0.458
SIFT: 0.542 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 17-45221317-T-C [0/1] rs79454290
Pathogenicity Data:
Best Score: 0.144
SIFT: 0.856 (T)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45214616-A-C [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45214673-T-C [0/1] rs62075621
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45216141-T-G [0/1] rs62075658
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45216231-T-C [0/1] rs76715333
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45232074-T-G [0/1] rs78019952
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45232080-A-C [0/1] rs796641903
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45232113-A-G [0/1] rs79479079
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45232119-A-G [0/1] rs76158881
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234404-T-G [0/1] rs74925848
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234416-A-G [0/1] rs74628496
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234434-A-G [0/1] rs75241171
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234632-A-G [0/1] rs75175938
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234689-A-G [0/1] rs140171160
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234709-A-G [0/1] rs142987740
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45234713-T-G [0/1] rs139751753
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45249408-A-G [0/1] rs62077272
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 17-45232068-A-G [0/1] rs74710570
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC NFE: 0.0016%
SYNONYMOUS_VARIANT SNV 17-45216210-A-G [0/1] rs62075659
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_SAS: 0.0033%
SYNONYMOUS_VARIANT SNV 17-45216168-T-C [0/1] rs146997390
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC SAS: 0.0061%
gnomAD_E_SAS: 0.0033%
SYNONYMOUS_VARIANT SNV 17-45249399-T-C [0/1] rs62077271
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC SAS: 0.0078%
gnomAD_E_NFE: 0.0010%
gnomAD_E_SAS: 0.0039%
SYNONYMOUS_VARIANT SNV 17-45219299-G-A [0/1] rs74929661
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0067%
gnomAD_E_AMR: 0.0093%
gnomAD_E_EAS: 0.0061%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0066%
SYNONYMOUS_VARIANT SNV 17-45232146-C-G [0/1] rs77277197
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AMR: 0.0139%
gnomAD_E_SAS: 0.0034%
SYNONYMOUS_VARIANT SNV 17-45214544-T-C [0/1] rs62075619
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_OTH: 0.0184%
SYNONYMOUS_VARIANT SNV 17-45249372-T-G [0/1] rs62077269
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0070%
gnomAD_E_AMR: 0.0033%
gnomAD_E_FIN: 0.0245%
gnomAD_E_NFE: 0.0173%
gnomAD_E_OTH: 0.0198%
gnomAD_E_SAS: 0.0036%
gnomAD_G_NFE: 0.0136%
SYNONYMOUS_VARIANT SNV 17-45229261-A-G [0/1] rs111414808
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0011%
ExAC NFE: 0.0045%
ExAC SAS: 0.0061%
gnomAD_E_NFE: 0.0027%
gnomAD_E_OTH: 0.0379%
gnomAD_E_SAS: 0.0171%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 17-45216216-A-G [0/1] rs62077260
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0031%
gnomAD_G_EAS: 0.0617%
SYNONYMOUS_VARIANT SNV 17-45214582-A-G [0/1] rs75731161
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0091%
ExAC EAS: 0.1736%
ExAC OTH: 0.1104%
gnomAD_E_EAS: 0.1451%
gnomAD_E_NFE: 0.0009%
gnomAD_G_EAS: 0.0617%
SYNONYMOUS_VARIANT SNV 17-45221303-G-A [0/1] rs76836956
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
gnomAD_E_AFR: 0.0088%
gnomAD_E_AMR: 0.2838%
gnomAD_E_EAS: 0.0362%
gnomAD_E_FIN: 0.0236%
gnomAD_E_NFE: 0.0570%
gnomAD_E_SAS: 0.2353%
gnomAD_G_AFR: 0.0115%
gnomAD_G_FIN: 0.0918%
SYNONYMOUS_VARIANT SNV 17-45214643-A-C [0/1] rs138020641
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.3692%
gnomAD_E_AMR: 0.9489%
gnomAD_E_EAS: 0.3497%
gnomAD_E_FIN: 0.6602%
gnomAD_E_NFE: 0.3351%
gnomAD_E_OTH: 0.5086%
gnomAD_E_SAS: 0.7459%
gnomAD_G_AFR: 0.0118%
gnomAD_G_NFE: 0.0143%

Exomiser Score: 0.763

Phenotype Score: 0.517

Variant Score: 0.989

Phenotype matches:
Proximity score 0.517 in interactome to HS2ST1 and phenotypic similarity 0.703 to Neurofacioskeletal syndrome with or without renal agenesis associated with HS2ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0011927, Short digit
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger
HP:0010055, Broad hallux - HP:0010186, Broad distal phalanx of the toes
Proximity score 0.517 in interactome to HS2ST1 and phenotypic similarity 0.698 to mouse mutant of HS2ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.763

Phenotype Score: 0.517

Variant Score: 0.989

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 13-96743358-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.989 CONTRIBUTING VARIANT
Transcripts:
HS6ST3:ENST00000376705.2:c.242G>T:p.(Gly81Val)
Pathogenicity Data:
Best Score: 0.989
Polyphen2: 0.017 (B)
SIFT: 0.011 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.052

Phenotype Score: 0.517

Variant Score: 0.545

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 13-96743358-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.989 CONTRIBUTING VARIANT
Transcripts:
HS6ST3:ENST00000376705.2:c.242G>T:p.(Gly81Val)
Pathogenicity Data:
Best Score: 0.989
Polyphen2: 0.017 (B)
SIFT: 0.011 (D)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 13-96743359-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
HS6ST3:ENST00000376705.2:c.243A>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.762

Phenotype Score: 0.507

Variant Score: 1.000

Phenotype matches:
Proximity score 0.507 in interactome to PLOD2 and phenotypic similarity 0.617 to Bruck syndrome 2 associated with PLOD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002980, Femoral bowing
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0002980, Femoral bowing
HP:0010055, Broad hallux - HP:0002980, Femoral bowing
Proximity score 0.507 in interactome to PLOD2 and phenotypic similarity 0.265 to mouse mutant of PLOD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005544, corneal deposits
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.507 in interactome to PLOD2 and phenotypic similarity 0.433 to fish mutant of PLOD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0006781, bone mineralization increased process quality, abnormal
HP:0011304, Broad thumb - ZP:0020434, rib curved, abnormal
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.762

Phenotype Score: 0.507

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-123892186-T-C [0/1] rs61955127
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.014 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.762

Phenotype Score: 0.507

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-123892186-T-C [0/1] rs61955127
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.014 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 12-123889492-A-C [0/1] rs61955124
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999998
Polyphen2: 0.030 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.016 (D)
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 12-123892095-T-C [0/1] rs61955126
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.007 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.352 (T)
Frequency Data:
ExAC NFE: 0.0015%
SPLICE_ACCEPTOR_VARIANT SNV 12-123893416-A-G [0/1] rs142906941
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0952%
gnomAD_G_AFR: 0.0459%
gnomAD_G_NFE: 0.0268%
gnomAD_G_OTH: 0.1020%
SYNONYMOUS_VARIANT SNV 12-123892235-G-A [0/1] rs61955128
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.5192%
TOPMed: 0.0291%
gnomAD_E_AFR: 0.0070%
gnomAD_E_AMR: 0.1789%
gnomAD_E_NFE: 0.0037%
gnomAD_G_AFR: 0.0229%
gnomAD_G_AMR: 0.2387%

Exomiser Score: 0.761

Phenotype Score: 0.508

Variant Score: 0.998

Phenotype matches:
Phenotypic similarity 0.327 to mouse mutant involving PER2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0020039, increased bone ossification
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.508 in interactome to NONO and phenotypic similarity 0.699 to Intellectual developmental disorder, X-linked syndromic 34 associated with NONO.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001822, Hallux valgus
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0001822, Hallux valgus
HP:0010055, Broad hallux - HP:0001822, Hallux valgus
Known diseases:
OMIM:604348 ?Advanced sleep phase syndrome, familial, 1 (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.761

Phenotype Score: 0.508

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-239170917-T-C [0/1] rs781531937
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.998143
Polyphen2: 0.074 (B)
Mutation Taster: 0.998 (P)
SIFT: 0.387 (T)
Frequency Data:
TOPMed: 0.0015%

Exomiser Score: 0.759

Phenotype Score: 0.505

Variant Score: 1.000

Phenotype matches:
Proximity score 0.505 in interactome to APBB1IP and phenotypic similarity 0.755 to mouse mutant of APBB1IP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.759

Phenotype Score: 0.505

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-62939564-A-G [0/1] rs1283559514
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
TLN2:ENST00000306829.6:c.55A>G:p.(Met19Val)
TLN2:ENST00000561311.1:c.55A>G:p.(Met19Val)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.968 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.006 (D)
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.175 to Familial isolated dilated cardiomyopathy associated with TNNI3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0000982, Palmoplantar keratoderma
HP:0010055, Broad hallux - HP:0000982, Palmoplantar keratoderma
Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification
HP:0011304, Broad thumb - MP:0004351, short humerus
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
Known diseases:
OMIM:115210 Cardiomyopathy, familial restrictive, 1 - autosomal dominant
OMIM:611880 ?Cardiomyopathy, dilated, 2A (unconfirmed)
OMIM:613286 Cardiomyopathy, dilated, 1FF - unknown
OMIM:613690 Cardiomyopathy, hypertrophic, 7 - autosomal dominant
ORPHA:154 Familial isolated dilated cardiomyopathy - autosomal recessive
ORPHA:154 Familial isolated dilated cardiomyopathy - autosomal dominant/recessive
ORPHA:75249 Familial isolated restrictive cardiomyopathy - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.175 to ORPHA:154 Familial isolated dilated cardiomyopathy
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 19-55665480-T-TAG [0/1]
Exomiser ACMG: PATHOGENIC [PVS1, PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.306 to mouse mutant involving FOXD4L5.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to TFAP2A and phenotypic similarity 0.595 to Branchiooculofacial syndrome associated with TFAP2A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
Proximity score 0.504 in interactome to TFAP2A and phenotypic similarity 0.737 to mouse mutant of TFAP2A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Proximity score 0.504 in interactome to TFAP2A and phenotypic similarity 0.330 to fish mutant of TFAP2A.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0001979, ethmoid cartilage split, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.757

Phenotype Score: 0.504

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 9-70177470-C-T [0/1] rs1392611807
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
FOXD4L5:ENST00000377420.1:c.514G>A:p.(Glu172Lys)
Pathogenicity Data:
Best Score: 0.999993
Polyphen2: 0.955 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.015 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.757

Phenotype Score: 0.516

Variant Score: 0.986

Phenotype matches:
Proximity score 0.516 in interactome to CHST11 and phenotypic similarity 0.832 to ?Osteochondrodysplasia, brachydactyly, and overlapping malformed digits associated with CHST11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009778, Short thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.516 in interactome to CHST11 and phenotypic similarity 0.716 to mouse mutant of CHST11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0000440, domed cranium
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005109, abnormal talus morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.757

Phenotype Score: 0.516

Variant Score: 0.986

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-19356195-C-T [0/1] rs542871862
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.989374
Polyphen2: 0.889 (P)
Mutation Taster: 0.989 (P)
SIFT: 0.108 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0008%
ExAC AFR: 0.0192%
ExAC EAS: 0.0231%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0065%

Exomiser Score: 0.756

Phenotype Score: 0.504

Variant Score: 1.000

Phenotype matches:
Proximity score 0.504 in interactome to UBE4B and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with UBE4B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Known diseases:
OMIM:109150 Machado-Joseph disease - autosomal dominant
Gene scores under compatible inheritance modes:

Exomiser Score: 0.756

Phenotype Score: 0.505

Variant Score: 0.998

Phenotype matches:
Phenotypic similarity 0.530 to Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies associated with DHX37.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001792, Small nail
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0001792, Small nail
HP:0010055, Broad hallux - HP:0001792, Small nail
Proximity score 0.505 in interactome to DMP1 and phenotypic similarity 0.697 to Autosomal recessive hypophosphatemic rickets associated with DMP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002970, Genu varum
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0002982, Tibial bowing
HP:0010055, Broad hallux - HP:0002970, Genu varum
Proximity score 0.505 in interactome to DMP1 and phenotypic similarity 0.590 to mouse mutant of DMP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000133, abnormal long bone metaphysis morphology
HP:0001363, Craniosynostosis - MP:0000060, delayed bone ossification
HP:0011304, Broad thumb - MP:0000133, abnormal long bone metaphysis morphology
HP:0010055, Broad hallux - MP:0000133, abnormal long bone metaphysis morphology
Known diseases:
OMIM:273250 46, XY sex reversal 11 - autosomal dominant
OMIM:618731 Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies - autosomal recessive
ORPHA:242 46,XY complete gonadal dysgenesis - autosomal dominant/recessive
ORPHA:251510 46,XY partial gonadal dysgenesis - autosomal dominant/recessive
ORPHA:983 Testicular regression syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.756

Phenotype Score: 0.505

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-125438533-C-T [0/1] rs1273451895
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.430 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.020 (D)
Frequency Data:
TOPMed: 0.0008%
gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.755

Phenotype Score: 0.503

Variant Score: 1.000

Phenotype matches:
Proximity score 0.503 in interactome to PRICKLE1 and phenotypic similarity 0.870 to mouse mutant of PRICKLE1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0030049, prominent forehead
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.755

Phenotype Score: 0.503

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-48691428-C-G [0/1] rs1217703911
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.943 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.045 (D)
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.755

Phenotype Score: 0.506

Variant Score: 0.996

Phenotype matches:
Phenotypic similarity 0.498 to mouse mutant involving GGT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006396, decreased long bone epiphyseal plate size
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0003109, short femur
HP:0010055, Broad hallux - MP:0003109, short femur
Proximity score 0.506 in interactome to PCYT1A and phenotypic similarity 0.624 to Spondylometaphyseal dysplasia with cone-rod dystrophy associated with PCYT1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0010049, Short metacarpal
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Known diseases:
OMIM:231950 ?Glutathioninuria (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.755

Phenotype Score: 0.506

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 22-25023441-C-T [0/1] rs200419006
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.716 (P)
Mutation Taster: 0.945 (P)
SIFT: 0.007 (D)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_EAS: 0.0058%
gnomAD_E_SAS: 0.0065%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
Other passed variants:
MISSENSE_VARIANT SNV 22-25023492-G-A [0/1] rs71318991
Pathogenicity Data:
Best Score: 0.798
Polyphen2: 0.069 (B)
SIFT: 0.202 (T)
Frequency Data:
1000Genomes: 0.5990%
TOPMed: 0.8210%
ESP AA: 0.2729%
ESP EA: 1.4109%
ESP All: 1.0251%
gnomAD_E_AFR: 0.2311%
gnomAD_E_AMR: 0.4946%
gnomAD_E_EAS: 0.0464%
gnomAD_E_FIN: 0.5790%
gnomAD_E_NFE: 1.2071%
gnomAD_E_OTH: 0.8775%
gnomAD_E_SAS: 1.4254%
gnomAD_G_AFR: 0.3216%
gnomAD_G_AMR: 0.9592%
gnomAD_G_FIN: 0.6300%
gnomAD_G_NFE: 1.3012%
gnomAD_G_OTH: 0.8180%
SYNONYMOUS_VARIANT SNV 22-25024136-A-G [0/1] rs558411910
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0072%
gnomAD_E_NFE: 0.0063%
gnomAD_G_AFR: 0.0115%
gnomAD_G_NFE: 0.0134%
gnomAD_G_OTH: 0.1020%
SYNONYMOUS_VARIANT SNV 22-25023903-C-T [0/1] rs1041998
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0200%
ESP AA: 0.0227%
ESP EA: 0.1395%
ESP All: 0.1000%
ExAC AFR: 0.0485%
ExAC AMR: 0.1037%
ExAC FIN: 0.1058%
ExAC NFE: 0.3389%
ExAC SAS: 0.1211%
gnomAD_E_AMR: 0.0209%
gnomAD_E_FIN: 0.0494%
gnomAD_E_NFE: 0.0741%
gnomAD_E_SAS: 0.0163%
gnomAD_G_NFE: 0.0402%
gnomAD_G_OTH: 0.1022%
SYNONYMOUS_VARIANT SNV 22-25024076-G-A [0/1] rs369713123
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0299%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0106%
ExAC AMR: 0.0087%
ExAC EAS: 0.7548%
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0119%
gnomAD_E_EAS: 0.6785%
gnomAD_E_NFE: 0.0009%
gnomAD_G_AFR: 0.0115%
gnomAD_G_EAS: 0.6180%

Exomiser Score: 0.754

Phenotype Score: 0.503

Variant Score: 1.000

Phenotype matches:
Proximity score 0.503 in interactome to ARL3 and phenotypic similarity 0.613 to Joubert syndrome associated with ARL3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.503 in interactome to ARL3 and phenotypic similarity 0.265 to mouse mutant of ARL3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0008518, retinal outer nuclear layer degeneration
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.754

Phenotype Score: 0.503

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT INS 13-21734127-C-CACTTTTTTCCAACTGCTGGATGATGGGGCTGGGAGTGGCAAAAACATTATCATTGAGCCTGGATTCTG [0/1] rs770546849
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.509

Phenotype Score: 0.503

Variant Score: 0.882

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT INS 13-21734127-C-CACTTTTTTCCAACTGCTGGATGATGGGGCTGGGAGTGGCAAAAACATTATCATTGAGCCTGGATTCTG [0/1] rs770546849
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT INS 13-21732267-A-ATGCTGTTCTTTGTAGATGGAATTTTCAAACCAGGAGTACAGAATGTAGGTACCAAAGGAGAG [0/1] rs748913598
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0118%
gnomAD_E_FIN: 0.0322%
gnomAD_E_NFE: 0.0367%
gnomAD_E_OTH: 0.0186%
gnomAD_E_SAS: 0.0066%
gnomAD_G_EAS: 0.2528%
gnomAD_G_FIN: 0.2900%
gnomAD_G_NFE: 0.0472%
gnomAD_G_OTH: 0.2070%

Exomiser Score: 0.753

Phenotype Score: 0.506

Variant Score: 0.996

Phenotype matches:
Phenotypic similarity 0.274 to Neuronopathy, distal hereditary motor, type IX associated with WARS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb -
HP:0010055, Broad hallux - HP:0001761, Pes cavus
Phenotypic similarity 0.299 to mouse mutant involving WARS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.506 in interactome to TARS1 and phenotypic similarity 0.712 to Trichothiodystrophy associated with TARS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Known diseases:
OMIM:617721 Neuronopathy, distal hereditary motor, type IX - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.753

Phenotype Score: 0.506

Variant Score: 0.996

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.274 to OMIM:617721 Neuronopathy, distal hereditary motor, type IX
Variants contributing to score:
MISSENSE_VARIANT SNV 14-100801285-C-T [0/1] rs751453486
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.999993
Polyphen2: 0.048 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.015 (D)
Frequency Data:
TOPMed: 0.0019%
UK10K: 0.0132%
ExAC FIN: 0.0302%
ExAC NFE: 0.0030%
gnomAD_E_EAS: 0.0058%
gnomAD_E_FIN: 0.0224%
gnomAD_E_NFE: 0.0037%
gnomAD_E_OTH: 0.0183%

Exomiser Score: 0.752

Phenotype Score: 0.502

Variant Score: 1.000

Phenotype matches:
Proximity score 0.502 in interactome to PRKCZ and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with PRKCZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.502 in interactome to PRKCZ and phenotypic similarity 0.276 to mouse mutant of PRKCZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.752

Phenotype Score: 0.502

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-165381543-C-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.827 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.003 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.751

Phenotype Score: 0.516

Variant Score: 0.983

Phenotype matches:
Proximity score 0.516 in interactome to SPRY4 and phenotypic similarity 0.295 to Kallmann syndrome associated with SPRY4.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb -
HP:0010055, Broad hallux - HP:0001761, Pes cavus
Proximity score 0.516 in interactome to SPRY4 and phenotypic similarity 0.911 to mouse mutant of SPRY4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.751

Phenotype Score: 0.516

Variant Score: 0.983

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-70965039-C-T [0/1] rs370761961
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.992
Polyphen2: 0.707 (P)
SIFT: 0.008 (D)
Frequency Data:
TOPMed: 0.0034%
ExAC AFR: 0.0104%
ExAC EAS: 0.0235%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0174%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0366%
gnomAD_G_AFR: 0.0115%
gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.611

Phenotype Score: 0.516

Variant Score: 0.912

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-70965039-C-T [0/1] rs370761961
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.992
Polyphen2: 0.707 (P)
SIFT: 0.008 (D)
Frequency Data:
TOPMed: 0.0034%
ExAC AFR: 0.0104%
ExAC EAS: 0.0235%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0174%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0366%
gnomAD_G_AFR: 0.0115%
gnomAD_G_EAS: 0.0617%
MISSENSE_VARIANT SNV 12-70932745-G-A [0/1] rs138916804
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.260 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.070 (T)
Frequency Data:
1000Genomes: 0.0998%
TOPMed: 0.0249%
ExAC EAS: 0.7773%
ExAC NFE: 0.0048%
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.6796%
gnomAD_E_NFE: 0.0018%
gnomAD_G_AFR: 0.0115%
gnomAD_G_EAS: 0.6173%
gnomAD_G_OTH: 0.1018%

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:
Proximity score 0.501 in interactome to PIBF1 and phenotypic similarity 0.613 to Joubert syndrome associated with PIBF1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.501 in interactome to PIBF1 and phenotypic similarity 0.278 to mouse mutant of PIBF1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_VARIANT DEL 19-9012897-AG-A [0/1] rs1269236781
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
MUC16:ENST00000397910.4:c.38546del:p.(Ser12849Leufs*61)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.638

Phenotype Score: 0.501

Variant Score: 0.941

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_VARIANT DEL 19-9012897-AG-A [0/1] rs1269236781
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
MUC16:ENST00000397910.4:c.38546del:p.(Ser12849Leufs*61)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-9000169-C-T [0/1] rs1419006271
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.947
SIFT: 0.053 (D)
Frequency Data:
gnomAD_G_AFR: 0.2033%
gnomAD_G_AMR: 0.1462%
gnomAD_G_EAS: 0.4058%
gnomAD_G_FIN: 0.0353%
gnomAD_G_NFE: 0.0369%
Other passed variants:
MISSENSE_VARIANT SNV 19-9015374-C-T [0/1] rs762855876
Variant score: 0.699
Transcripts:
MUC16:ENST00000397910.4:c.38214G>A:p.(Met12738Ile)
Pathogenicity Data:
Best Score: 0.849
SIFT: 0.151 (T)
Frequency Data:
gnomAD_G_AFR: 0.5814%
gnomAD_G_AMR: 0.3268%
gnomAD_G_EAS: 0.1471%
gnomAD_G_FIN: 0.8368%
gnomAD_G_NFE: 0.2994%
gnomAD_G_OTH: 0.2370%
MISSENSE_VARIANT SNV 19-9000187-C-T [0/1] rs994308141
Pathogenicity Data:
Best Score: 0.30900002
SIFT: 0.691 (T)
Frequency Data:
gnomAD_G_AFR: 0.3492%
gnomAD_G_AMR: 0.3106%
gnomAD_G_EAS: 0.4401%
gnomAD_G_FIN: 0.1130%
gnomAD_G_NFE: 0.0908%
gnomAD_G_OTH: 0.1214%
SYNONYMOUS_VARIANT SNV 19-9000170-A-G [0/1] rs1160287047
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.2472%
gnomAD_G_AMR: 0.1458%
gnomAD_G_EAS: 0.4052%
gnomAD_G_FIN: 0.0355%
gnomAD_G_NFE: 0.0516%
SYNONYMOUS_VARIANT SNV 19-9000185-A-G [0/1] rs1467863711
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.3268%
gnomAD_G_AMR: 0.3021%
gnomAD_G_EAS: 0.4244%
gnomAD_G_FIN: 0.0738%
gnomAD_G_NFE: 0.0748%
gnomAD_G_OTH: 0.1214%
SYNONYMOUS_VARIANT SNV 19-9000194-G-A [0/1] rs1295951744
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.5561%
gnomAD_G_AMR: 0.3268%
gnomAD_G_EAS: 0.3559%
gnomAD_G_FIN: 0.2268%
gnomAD_G_NFE: 0.0764%
gnomAD_G_OTH: 0.1256%

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:
Proximity score 0.501 in interactome to ATF4 and phenotypic similarity 0.648 to mouse mutant of ATF4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005298, abnormal clavicle morphology
HP:0001363, Craniosynostosis - MP:0030388, large fontanelles
HP:0011304, Broad thumb - MP:0005298, abnormal clavicle morphology
HP:0010055, Broad hallux - MP:0005298, abnormal clavicle morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.751

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-64275858-C-T [0/1] rs922516659
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999989
Polyphen2: 0.536 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.003 (D)
Frequency Data:
TOPMed: 0.0019%
gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 0.999

Phenotype matches:
Proximity score 0.501 in interactome to PRKCZ and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with PRKCZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.501 in interactome to PRKCZ and phenotypic similarity 0.276 to mouse mutant of PRKCZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-73566284-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.99909
Polyphen2: 0.212 (B)
Mutation Taster: 0.999 (P)
SIFT: 0.082 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:
Proximity score 0.501 in interactome to TRIO and phenotypic similarity 0.681 to Intellectual developmental disorder, autosomal dominant 44, with microcephaly associated with TRIO.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-25492246-C-G [0/1] rs1803287195
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
CARMIL1:ENST00000329474.6:c.1214C>G:p.(Ser405Cys)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.944 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.280 to mouse mutant involving PAK1IP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000455, abnormal maxilla morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to PLCB3 and phenotypic similarity 0.614 to Spondylometaphyseal dysplasia with corneal dystrophy associated with PLCB3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.501 in interactome to PLCB3 and phenotypic similarity 0.332 to fish mutant of PLCB3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0005101, palatoquadrate cartilage curved lateral, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-10704998-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
PAK1IP1:ENST00000379568.3:c.661G>T:p.(Ala221Ser)
Pathogenicity Data:
Best Score: 0.999998
Polyphen2: 0.464 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.020 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.387 to mouse mutant involving ST18.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003345, decreased rib number
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0003345, decreased rib number
HP:0010055, Broad hallux - MP:0003345, decreased rib number
Proximity score 0.500 in interactome to SOX14 and phenotypic similarity 0.755 to mouse mutant of SOX14.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-53025894-G-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ST18:ENST00000276480.7:c.3008C>T:p.(Pro1003Leu)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.998 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

Phenotype matches:
Proximity score 0.501 in interactome to SCARF2 and phenotypic similarity 0.704 to Van den Ende-Gupta syndrome associated with SCARF2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0006236, Slender metacarpals
HP:0010055, Broad hallux - HP:0001847, Long hallux
Proximity score 0.501 in interactome to SCARF2 and phenotypic similarity 0.487 to mouse mutant of SCARF2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004357, long tibia
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0004357, long tibia
HP:0010055, Broad hallux - MP:0004357, long tibia
Known diseases:
OMIM:617027 Hyperaldosteronism, familial, type IV - autosomal dominant
ORPHA:64280 Childhood absence epilepsy - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.750

Phenotype Score: 0.501

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-1268220-G-A [0/1] rs1244044913
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999947
Polyphen2: 0.991 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
TOPMed: 0.0008%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.250

Variant Score: 0.514

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-1268220-G-A [0/1] rs1244044913
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999947
Polyphen2: 0.991 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
TOPMed: 0.0008%
SYNONYMOUS_VARIANT SNV 16-1270256-C-T [0/1] rs57670193
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.4593%
TOPMed: 0.0816%
ExAC AMR: 0.0093%
ExAC EAS: 1.8416%
ExAC OTH: 0.1458%
ExAC SAS: 0.0072%
gnomAD_E_AMR: 0.0063%
gnomAD_E_EAS: 1.7876%
gnomAD_E_OTH: 0.0205%
gnomAD_E_SAS: 0.0104%
gnomAD_G_EAS: 1.8496%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to NEK1 and phenotypic similarity 0.813 to Orofaciodigital syndrome type 2 associated with NEK1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0006101, Finger syndactyly
HP:0001363, Craniosynostosis - HP:0410033, Unilateral alveolar cleft of maxilla
HP:0011304, Broad thumb - HP:0010068, Broad first metatarsal
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.500 in interactome to NEK1 and phenotypic similarity 0.541 to mouse mutant of NEK1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology
HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology
HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology
HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-44684481-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.333 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.038 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to NHS and phenotypic similarity 0.623 to Nance-Horan syndrome associated with NHS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001500, Broad finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001500, Broad finger
HP:0010055, Broad hallux - HP:0001500, Broad finger
Proximity score 0.500 in interactome to NHS and phenotypic similarity 0.346 to mouse mutant of NHS.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-927016-C-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.011 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.129 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

Phenotype matches:
Proximity score 0.501 in interactome to B3GAT3 and phenotypic similarity 0.761 to Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects associated with B3GAT3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001822, Hallux valgus
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001222, Spatulate thumbs
HP:0010055, Broad hallux - HP:0001822, Hallux valgus
Proximity score 0.501 in interactome to B3GAT3 and phenotypic similarity 0.407 to fish mutant of B3GAT3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0001216, head cuboid, abnormal
HP:0011304, Broad thumb - ZP:0000875, cleithrum malformed, abnormal
HP:0010055, Broad hallux -
Known diseases:
OMIM:138500 Hyperglycinuria - autosomal dominant
OMIM:242600 Iminoglycinuria, digenic - autosomal recessive
ORPHA:42062 Iminoglycinuria - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-45817401-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999254
Polyphen2: 0.974 (D)
Mutation Taster: 0.999 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.046

Phenotype Score: 0.501

Variant Score: 0.549

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-45817401-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999254
Polyphen2: 0.974 (D)
Mutation Taster: 0.999 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-45817268-G-A [0/1] rs146942696
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0042%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0194%
ExAC NFE: 0.0015%
ExAC OTH: 0.1111%
gnomAD_E_AFR: 0.0065%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0183%
gnomAD_G_AFR: 0.0115%
gnomAD_G_OTH: 0.1018%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to COLGALT1 and phenotypic similarity 0.670 to mouse mutant of COLGALT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000554, abnormal carpal bone morphology
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb - MP:0000554, abnormal carpal bone morphology
HP:0010055, Broad hallux - MP:0000554, abnormal carpal bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-53150581-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ERO1A:ENST00000395686.3:c.159T>G:p.(Ile53Met)
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.977 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.245 to mouse mutant involving LEPROT.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0010123, increased bone mineral content
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to RDH10 and phenotypic similarity 0.880 to mouse mutant of RDH10.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0001286, abnormal eye development
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-65886412-C-G [0/1] rs1056216892
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.982 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.118 (T)
Frequency Data:
No frequency data

MAL

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.247 to mouse mutant involving MAL.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001330, abnormal optic nerve morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to ALX3 and phenotypic similarity 0.685 to Frontonasal dysplasia 1 associated with ALX3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0009099, Median cleft palate
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.500 in interactome to ALX3 and phenotypic similarity 0.270 to mouse mutant of ALX3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0009264, failure of eyelid fusion
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-95691550-G-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.090 (B)
Mutation Taster: 0.822
SIFT: 0.000 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to RASA2 and phenotypic similarity 0.642 to Noonan syndrome associated with RASA2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 7-144059763-A-ATGGAGGCTGAGGAGGCCCAGCG [0/1] rs766185415
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ARHGEF5:ENST00000056217.5:c.7_28dup:p.(Ala10Glyfs*2)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to LEMD3 and phenotypic similarity 0.709 to Buschke-Ollendorff syndrome associated with LEMD3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010554, Cutaneous finger syndactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0010554, Cutaneous finger syndactyly
HP:0010055, Broad hallux - HP:0010554, Cutaneous finger syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-58220823-C-T [0/1] rs111346934
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.316 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.233 (T)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-58220823-C-T [0/1] rs111346934
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.316 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.233 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 12-58220841-C-T [0/1] rs74343811
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.792 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.063 (T)
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 12-58220844-C-T [0/1] rs75591888
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.000 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.585 (T)
Frequency Data:
ExAC SAS: 0.0061%
gnomAD_E_SAS: 0.0032%
MISSENSE_VARIANT SNV 12-58220816-A-G [0/1] rs76940645
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.766 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
TOPMed: 0.0011%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0065%
gnomAD_E_SAS: 0.0032%
SYNONYMOUS_VARIANT SNV 12-58220809-G-C [0/1] rs78691025
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

Phenotype matches:
Phenotypic similarity 0.253 to mouse mutant involving PMEL.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0010192, abnormal retinal melanin granule morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.665 to Okur-Chung neurodevelopmental syndrome associated with CSNK2A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0030084, Clinodactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.535 to mouse mutant of CSNK2A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology
HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape
HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology
HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.501

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-56351044-G-T [0/1] rs1289606418
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.895 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.712 to Trichothiodystrophy associated with RNF113A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.262 to mouse mutant of RNF113A.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-95542416-A-G [0/1] rs142133592
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
TEKT4:ENST00000295201.4:c.1210A>G:p.(Ile404Val)
TEKT4:ENST00000568768.1:n.644-3122T>C:
Pathogenicity Data:
Best Score: 0.999993
Polyphen2: 0.770 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.014 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.356

Phenotype Score: 0.500

Variant Score: 0.817

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-95542416-A-G [0/1] rs142133592
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
TEKT4:ENST00000295201.4:c.1210A>G:p.(Ile404Val)
TEKT4:ENST00000568768.1:n.644-3122T>C:
Pathogenicity Data:
Best Score: 0.999993
Polyphen2: 0.770 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.014 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 2-95542419-G-A [0/1] rs75603622
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.633 CONTRIBUTING VARIANT
Transcripts:
TEKT4:ENST00000295201.4:c.1213G>A:p.(Ala405Thr)
TEKT4:ENST00000568768.1:n.644-3125C>T:
Pathogenicity Data:
Best Score: 0.899
Polyphen2: 0.013 (B)
SIFT: 0.101 (T)
Frequency Data:
1000Genomes: 1.1580%
TOPMed: 1.1580%
gnomAD_E_AFR: 0.0133%
gnomAD_E_EAS: 0.0180%
gnomAD_E_FIN: 0.0943%
gnomAD_E_NFE: 0.0036%
gnomAD_E_SAS: 0.0066%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to PRKAR1A and phenotypic similarity 0.684 to Acrodysostosis 1, with or without hormone resistance associated with PRKAR1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0004490, Calvarial hyperostosis
HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger
HP:0010055, Broad hallux - HP:0001847, Long hallux
Proximity score 0.500 in interactome to PRKAR1A and phenotypic similarity 0.852 to mouse mutant of PRKAR1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0003419, delayed endochondral bone ossification
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Known diseases:
OMIM:149700 ?Lacrimal duct defect (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-117156459-C-T [0/1] rs61786651
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.006 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 1-117156584-T-C [0/1] rs143106517
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.999978
Polyphen2: 0.485 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.137 (T)
Frequency Data:
gnomAD_E_NFE: 0.0009%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-117156459-C-T [0/1] rs61786651
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.006 (D)
Frequency Data:
No frequency data
Other passed variants:
STOP_GAINED SNV 1-117156585-G-A [0/1] rs139013364
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0009%
MISSENSE_VARIANT SNV 1-117146504-G-A [0/1] rs61786577
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.007 (D)
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_NFE: 0.0018%
MISSENSE_VARIANT SNV 1-117158909-C-T [0/1] rs201676764
Pathogenicity Data:
Best Score: 0.999686
Polyphen2: 0.060 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.831 (T)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_AMR: 0.0030%
gnomAD_E_SAS: 0.0033%
MISSENSE_VARIANT SNV 1-117142700-C-A [0/1] rs75947003
Pathogenicity Data:
Best Score: 0.999878
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.230 (T)
Frequency Data:
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0030%
gnomAD_E_NFE: 0.0036%
STOP_GAINED SNV 1-117142868-C-T [0/1] rs61730489
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0016%
gnomAD_E_NFE: 0.0009%
gnomAD_G_AFR: 0.0114%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 1-117146563-G-A [0/1] rs61786578
Pathogenicity Data:
Best Score: 0.997634
Polyphen2: 0.293 (B)
Mutation Taster: 0.998 (P)
SIFT: 0.051 (D)
Frequency Data:
TOPMed: 0.0045%
gnomAD_E_NFE: 0.0045%
gnomAD_E_SAS: 0.0032%
MISSENSE_VARIANT SNV 1-117146592-C-G [0/1] rs532709767
Pathogenicity Data:
Best Score: 0.995157
Polyphen2: 0.014 (B)
Mutation Taster: 0.995 (P)
SIFT: 0.307 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 1-117146585-G-A [0/1] rs968366784
Pathogenicity Data:
Best Score: 0.99601
Polyphen2: 0.790 (P)
Mutation Taster: 0.996 (P)
SIFT: 0.050 (D)
Frequency Data:
TOPMed: 0.0015%
gnomAD_E_SAS: 0.0065%
MISSENSE_VARIANT SNV 1-117158972-A-G [0/1] rs3965246
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.035 (B)
SIFT: 0.005 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 1-117150736-C-G [0/1] rs61786589
Pathogenicity Data:
Best Score: 0.984
Polyphen2: 0.024 (B)
SIFT: 0.016 (D)
Frequency Data:
gnomAD_E_AMR: 0.0030%
gnomAD_E_SAS: 0.0032%
MISSENSE_VARIANT SNV 1-117146629-T-C [0/1] rs1553213423
Pathogenicity Data:
Best Score: 0.973426
Polyphen2: 0.403 (B)
Mutation Taster: 0.973 (P)
SIFT: 0.124 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 1-117142736-A-G [0/1] rs75067537
Pathogenicity Data:
Best Score: 0.999675
Polyphen2: 0.164 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
1000Genomes: 0.1997%
TOPMed: 0.1997%
ExAC AFR: 0.0971%
ExAC AMR: 0.0699%
ExAC EAS: 0.0701%
ExAC FIN: 0.0156%
ExAC NFE: 0.0347%
ExAC OTH: 0.3348%
ExAC SAS: 0.0489%
gnomAD_E_AFR: 0.0393%
gnomAD_E_AMR: 0.1074%
gnomAD_E_EAS: 0.0466%
gnomAD_E_NFE: 0.0243%
gnomAD_E_OTH: 0.0913%
gnomAD_E_SAS: 0.0261%
gnomAD_G_AFR: 0.1048%
gnomAD_G_AMR: 0.1205%
gnomAD_G_EAS: 0.0623%
MISSENSE_VARIANT SNV 1-117142641-G-A [0/1] rs76417519
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.003 (D)
Frequency Data:
gnomAD_E_AFR: 0.1326%
gnomAD_E_AMR: 0.1387%
gnomAD_E_EAS: 0.1428%
gnomAD_E_FIN: 0.5665%
gnomAD_E_NFE: 0.3553%
gnomAD_E_OTH: 0.1934%
gnomAD_E_SAS: 0.1694%
gnomAD_G_AFR: 0.0235%
gnomAD_G_AMR: 0.2488%
gnomAD_G_FIN: 0.3088%
gnomAD_G_NFE: 0.1333%
MISSENSE_VARIANT SNV 1-117158898-C-T [0/1] rs186152746
Pathogenicity Data:
Best Score: 0.78499997
Polyphen2: 0.001 (B)
SIFT: 0.215 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 1-117156600-T-C [0/1] rs547741844
Pathogenicity Data:
Best Score: 0.728636
Polyphen2: 0.004 (B)
Mutation Taster: 0.729
Frequency Data:
TOPMed: 0.0023%
gnomAD_E_AFR: 0.0065%
gnomAD_E_NFE: 0.0018%
MISSENSE_VARIANT SNV 1-117142613-C-T [0/1] rs76151115
Pathogenicity Data:
Best Score: 0.905
Polyphen2: 0.476 (P)
Mutation Taster: 0.840
SIFT: 0.095 (T)
Frequency Data:
gnomAD_E_AFR: 0.3207%
gnomAD_E_AMR: 0.1427%
gnomAD_E_EAS: 0.4202%
gnomAD_E_FIN: 1.0340%
gnomAD_E_NFE: 0.3358%
gnomAD_E_OTH: 0.1567%
gnomAD_E_SAS: 0.0703%
gnomAD_G_AFR: 0.1404%
gnomAD_G_AMR: 0.3713%
gnomAD_G_EAS: 0.1918%
gnomAD_G_FIN: 0.2158%
gnomAD_G_NFE: 0.2035%
MISSENSE_VARIANT SNV 1-117142869-A-G [0/1] rs78806598
Pathogenicity Data:
Best Score: 0.15100002
Polyphen2: 0.006 (B)
SIFT: 0.849 (T)
Frequency Data:
TOPMed: 0.0068%
ESP EA: 0.0116%
ESP All: 0.0077%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0162%
gnomAD_G_AFR: 0.0115%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 1-117150928-C-T [0/1] rs150982249
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 1-117150933-G-A [0/1] rs115837117
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 1-117146571-A-G [0/1] rs61786579
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_NFE: 0.0009%
SYNONYMOUS_VARIANT SNV 1-117159024-C-T [0/1] rs201692914
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0019%
gnomAD_E_AMR: 0.0030%
gnomAD_E_SAS: 0.0037%
SYNONYMOUS_VARIANT SNV 1-117158934-C-T [0/1] rs200177381
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ExAC AMR: 0.0089%
gnomAD_E_AFR: 0.0069%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0009%
SYNONYMOUS_VARIANT SNV 1-117156418-G-A [0/1] rs111880595
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0034%
ExAC AFR: 0.0105%
ExAC AMR: 0.0087%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0068%
gnomAD_E_AMR: 0.0060%
gnomAD_E_NFE: 0.0018%
SYNONYMOUS_VARIANT SNV 1-117156490-T-C [0/1] rs61786652
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0196%
UK10K: 0.0132%
gnomAD_E_NFE: 0.0269%
gnomAD_G_AFR: 0.0458%
gnomAD_G_NFE: 0.0533%
SYNONYMOUS_VARIANT SNV 1-117142855-C-T [0/1] rs61786568
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0159%
ESP AA: 0.1135%
ESP All: 0.0384%
ExAC AFR: 0.1785%
ExAC AMR: 0.0087%
ExAC EAS: 0.0232%
ExAC NFE: 0.0121%
ExAC SAS: 0.0304%
gnomAD_E_AFR: 0.0655%
gnomAD_E_AMR: 0.0089%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0072%
gnomAD_E_SAS: 0.0097%
gnomAD_G_AFR: 0.0344%

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to MMP2 and phenotypic similarity 0.638 to Multicentric osteolysis-nodulosis-arthropathy spectrum associated with MMP2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001230, Broad metacarpals
HP:0001363, Craniosynostosis - HP:0005441, Sclerotic cranial sutures
HP:0011304, Broad thumb - HP:0001230, Broad metacarpals
HP:0010055, Broad hallux - HP:0006234, Osteolysis involving tarsal bones
Proximity score 0.500 in interactome to MMP2 and phenotypic similarity 0.707 to mouse mutant of MMP2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004686, decreased length of long bones
HP:0001363, Craniosynostosis - MP:0003840, abnormal coronal suture morphology
HP:0011304, Broad thumb - MP:0004686, decreased length of long bones
HP:0010055, Broad hallux - MP:0004686, decreased length of long bones
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.749

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-36904401-C-T [0/1] rs756663980
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.855 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to USP7 and phenotypic similarity 0.721 to Hao-Fountain syndrome associated with USP7.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001822, Hallux valgus
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001822, Hallux valgus
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-119037548-C-T [0/1] rs765490964
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.034 (B)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC NFE: 0.0024%
gnomAD_E_NFE: 0.0025%

X_DOMINANT

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-119037548-C-T [0/1] rs765490964
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.034 (B)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC NFE: 0.0024%
gnomAD_E_NFE: 0.0025%

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to PALS1 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with PALS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.500 in interactome to PALS1 and phenotypic similarity 0.331 to fish mutant of PALS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0001253, head surface feature shape, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.748

Phenotype Score: 0.500

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-132915100-G-A [0/1] rs759083298
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
TCERG1L:ENST00000368642.4:c.1357C>T:p.(Arg453Cys)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.998 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.026 (D)
Frequency Data:
TOPMed: 0.0034%

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches:
Phenotypic similarity 0.331 to mouse mutant involving ADAL.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to ADA2 and phenotypic similarity 0.670 to Blackfan-Diamond anemia associated with ADA2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001199, Triphalangeal thumb
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-43641162-G-A [0/1] rs775451578
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.998 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC AFR: 0.0097%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0030%
gnomAD_E_SAS: 0.0032%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-43641162-G-A [0/1] rs775451578
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.998 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC AFR: 0.0097%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0030%
gnomAD_E_SAS: 0.0032%
SPLICE_DONOR_VARIANT DEL 15-43643240-GTA-G [0/1] rs1312152135
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_EAS: 0.0098%

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches:
Phenotypic similarity 0.359 to Monilethrix associated with KRT83.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001597, Abnormality of the nail
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001597, Abnormality of the nail
HP:0010055, Broad hallux - HP:0001597, Abnormality of the nail
Proximity score 0.500 in interactome to TGFBR1 and phenotypic similarity 0.749 to Loeys-Dietz syndrome 1 associated with TGFBR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0001166, Arachnodactyly
Proximity score 0.500 in interactome to TGFBR1 and phenotypic similarity 0.952 to mouse mutant of TGFBR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:158000 Monilethrix - autosomal dominant
OMIM:617756 Erythrokeratodermia variabilis et progressiva 5 - autosomal recessive
ORPHA:316 Progressive symmetric erythrokeratodermia - autosomal recessive
ORPHA:573 Monilethrix - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.359 to ORPHA:573 Monilethrix
Phenotypic similarity 0.349 to OMIM:158000 Monilethrix
Variants contributing to score:
MISSENSE_VARIANT SNV 12-52708591-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.999 CONTRIBUTING VARIANT
Transcripts:
KRT83:ENST00000293670.3:c.1306T>C:p.(Ser436Pro)
Pathogenicity Data:
Best Score: 0.999
Polyphen2: 0.999 (D)
Mutation Taster: 0.562
SIFT: 0.003 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

Phenotype matches:
Proximity score 0.500 in interactome to PRKRA and phenotypic similarity 0.629 to mouse mutant of PRKRA.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.500

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-76062366-A-C [0/1] rs1381841956
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.999 CONTRIBUTING VARIANT
Transcripts:
THAP12:ENST00000260045.3:c.1828T>G:p.(Ser610Ala)
Pathogenicity Data:
Best Score: 0.998991
Polyphen2: 0.004 (B)
Mutation Taster: 0.999 (P)
SIFT: 0.539 (T)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_NFE: 0.0010%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.745

Phenotype Score: 0.500

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-76062366-A-C [0/1] rs1381841956
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.999 CONTRIBUTING VARIANT
Transcripts:
THAP12:ENST00000260045.3:c.1828T>G:p.(Ser610Ala)
Pathogenicity Data:
Best Score: 0.998991
Polyphen2: 0.004 (B)
Mutation Taster: 0.999 (P)
SIFT: 0.539 (T)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_NFE: 0.0010%
MISSENSE_VARIANT SNV 11-76062520-T-A [0/1] rs1157005460
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.996 CONTRIBUTING VARIANT
Transcripts:
THAP12:ENST00000260045.3:c.1674A>T:p.(Arg558Ser)
Pathogenicity Data:
Best Score: 0.996463
Polyphen2: 0.295 (B)
Mutation Taster: 0.996 (P)
SIFT: 0.017 (D)
Frequency Data:
gnomAD_E_AMR: 0.0038%

Exomiser Score: 0.747

Phenotype Score: 0.502

Variant Score: 0.997

Phenotype matches:
Phenotypic similarity 0.317 to mouse mutant involving ARHGAP25.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.621 to Mental retardation, X-linked syndromic 16 associated with FGD1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.272 to mouse mutant of FGD1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001297, microphthalmia
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.747

Phenotype Score: 0.502

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-69049787-G-T [0/1] rs145839401
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.999709
Polyphen2: 0.541 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
ExAC EAS: 0.0232%
gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:
Proximity score 0.501 in interactome to YY1 and phenotypic similarity 0.751 to Gabriele-de Vries syndrome associated with YY1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001822, Hallux valgus
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0006094, Finger joint hypermobility
HP:0010055, Broad hallux - HP:0001822, Hallux valgus
Known diseases:
OMIM:110800 Adult i phenotype without cataract - autosomal dominant
OMIM:116700 Cataract 13 with adult i phenotype - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-10529910-C-T [0/1] rs757161386
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.463 (P)
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0008%
ExAC SAS: 0.0121%
gnomAD_E_SAS: 0.0195%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:
Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003109, short femur
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0003109, short femur
HP:0010055, Broad hallux - MP:0003109, short femur
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-19735202-G-A [0/1] rs767222783
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999621
Polyphen2: 0.899 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.177 (T)
Frequency Data:
TOPMed: 0.0008%
ExAC NFE: 0.0060%
gnomAD_E_NFE: 0.0054%
gnomAD_E_OTH: 0.0182%
gnomAD_G_NFE: 0.0067%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.044

Phenotype Score: 0.501

Variant Score: 0.544

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-19735202-G-A [0/1] rs767222783
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999621
Polyphen2: 0.899 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.177 (T)
Frequency Data:
TOPMed: 0.0008%
ExAC NFE: 0.0060%
gnomAD_E_NFE: 0.0054%
gnomAD_E_OTH: 0.0182%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 19-19737422-C-T [0/1] rs202194790
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0189%
ExAC AMR: 0.0087%
ExAC EAS: 0.5389%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.4948%
gnomAD_G_EAS: 0.3083%

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:
Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003109, short femur
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0003109, short femur
HP:0010055, Broad hallux - MP:0003109, short femur
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-85279584-T-G [0/1] rs545074182
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999853
Polyphen2: 0.368 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.140 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0200%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.746

Phenotype Score: 0.500

Variant Score: 0.998

Phenotype matches:
Phenotypic similarity 0.296 to mouse mutant involving SCAMP2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001304, cataract
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to ANKH and phenotypic similarity 0.389 to Craniometaphyseal dysplasia associated with ANKH.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004975, Erlenmeyer flask deformity of the femurs
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0004975, Erlenmeyer flask deformity of the femurs
HP:0010055, Broad hallux - HP:0004975, Erlenmeyer flask deformity of the femurs
Proximity score 0.500 in interactome to ANKH and phenotypic similarity 0.698 to mouse mutant of ANKH.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0002932, abnormal joint morphology
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.746

Phenotype Score: 0.500

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-75143750-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.998 CONTRIBUTING VARIANT
Transcripts:
SCAMP2:ENST00000268099.9:c.416C>G:p.(Thr139Arg)
Pathogenicity Data:
Best Score: 0.998
Polyphen2: 0.251 (B)
SIFT: 0.002 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.745

Phenotype Score: 0.498

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.498 to mouse mutant involving GGT3P.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006396, decreased long bone epiphyseal plate size
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0003109, short femur
HP:0010055, Broad hallux - MP:0003109, short femur
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.745

Phenotype Score: 0.498

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT DEL 22-18769100-AC-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
GGT3P:ENST00000412448.1:n.1185+1del:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.745

Phenotype Score: 0.498

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT DEL 22-18769100-AC-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
GGT3P:ENST00000412448.1:n.1185+1del:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_DONOR_VARIANT SNV 22-18769650-A-G [0/1] rs62229901
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
GGT3P:ENST00000412448.1:n.1027+2T>C:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SPLICE_REGION_VARIANT SNV 22-18767057-A-G [0/1] rs62229896
Variant score: 0.800
Transcripts:
GGT3P:ENST00000412448.1:n.1186-5T>C:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 22-18767059-T-C [0/1] rs62229897
Variant score: 0.800
Transcripts:
GGT3P:ENST00000412448.1:n.1186-7A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 22-18769103-A-G [0/1] rs201251610
Variant score: 0.800
Transcripts:
GGT3P:ENST00000412448.1:n.1184T>C:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.745

Phenotype Score: 0.501

Variant Score: 0.997

Phenotype matches:
Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.656 to Noonan syndrome 1 associated with PTPN11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.540 to mouse mutant of PTPN11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0012514, pectus excavatum
HP:0001363, Craniosynostosis - MP:0010031, abnormal cranium size
HP:0011304, Broad thumb - MP:0012514, pectus excavatum
HP:0010055, Broad hallux - MP:0012514, pectus excavatum
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.745

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55284943-C-A [0/1] rs200854975
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.999
Polyphen2: 0.710 (P)
SIFT: 0.001 (D)
Frequency Data:
ExAC AFR: 0.0098%
ExAC NFE: 0.0016%
gnomAD_E_AFR: 0.0066%
gnomAD_E_NFE: 0.0028%
gnomAD_G_AFR: 0.0131%
gnomAD_G_NFE: 0.0077%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.744

Phenotype Score: 0.501

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55284943-C-A [0/1] rs200854975
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.999
Polyphen2: 0.710 (P)
SIFT: 0.001 (D)
Frequency Data:
ExAC AFR: 0.0098%
ExAC NFE: 0.0016%
gnomAD_E_AFR: 0.0066%
gnomAD_E_NFE: 0.0028%
gnomAD_G_AFR: 0.0131%
gnomAD_G_NFE: 0.0077%
MISSENSE_VARIANT SNV 19-55284944-A-T [0/1] rs150190837
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.998
Polyphen2: 0.147 (B)
SIFT: 0.002 (D)
Frequency Data:
ExAC AFR: 0.0098%
ExAC NFE: 0.0016%
gnomAD_E_AFR: 0.0066%
gnomAD_E_NFE: 0.0028%
gnomAD_G_AFR: 0.0131%
gnomAD_G_NFE: 0.0077%
Other passed variants:
MISSENSE_VARIANT SNV 19-55284986-C-A [0/1] rs687485
Pathogenicity Data:
Best Score: 0.921
Polyphen2: 0.841 (P)
SIFT: 0.079 (T)
Frequency Data:
ExAC AFR: 0.0392%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0466%
gnomAD_E_NFE: 0.0018%
MISSENSE_VARIANT SNV 19-55286796-G-A [0/1] rs147072532
Pathogenicity Data:
Best Score: 0.878
Polyphen2: 0.014 (B)
SIFT: 0.122 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
ExAC SAS: 0.0073%
MISSENSE_VARIANT SNV 19-55286809-G-A [0/1] rs2916003
Pathogenicity Data:
Best Score: 0.949
Polyphen2: 0.369 (B)
SIFT: 0.051 (D)
Frequency Data:
1000Genomes: 0.4992%
TOPMed: 0.4992%
gnomAD_E_AFR: 0.0793%
gnomAD_E_AMR: 0.0032%
gnomAD_G_AFR: 0.0141%
MISSENSE_VARIANT SNV 19-55290108-A-G [0/1] rs75232650
Pathogenicity Data:
Best Score: 0.865
Polyphen2: 0.010 (B)
SIFT: 0.135 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0200%
gnomAD_E_AMR: 0.0064%
gnomAD_E_EAS: 0.0710%
gnomAD_E_FIN: 0.0048%
gnomAD_E_NFE: 0.0030%
gnomAD_E_SAS: 0.0120%
gnomAD_G_EAS: 0.1928%
MISSENSE_VARIANT SNV 19-55286769-C-A [0/1] rs111799279
Pathogenicity Data:
Best Score: 0.86300004
Polyphen2: 0.002 (B)
SIFT: 0.137 (T)
Frequency Data:
ESP AA: 0.0239%
ESP All: 0.0081%
gnomAD_E_AMR: 0.0257%
gnomAD_E_EAS: 0.0059%
gnomAD_E_NFE: 0.0049%
gnomAD_E_OTH: 0.0206%
gnomAD_E_SAS: 0.0159%
gnomAD_G_AFR: 0.0142%
gnomAD_G_AMR: 0.2653%
MISSENSE_VARIANT SNV 19-55286781-G-A [0/1] rs62121640
Pathogenicity Data:
Best Score: 0.601
Polyphen2: 0.274 (B)
SIFT: 0.399 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
ESP EA: 0.0241%
ESP All: 0.0159%
gnomAD_E_AFR: 0.0074%
gnomAD_E_AMR: 0.0064%
gnomAD_E_NFE: 0.0010%
gnomAD_E_SAS: 0.0279%
gnomAD_G_AFR: 0.0141%
MISSENSE_VARIANT SNV 19-55285045-G-T [0/1] rs687885
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0532%
gnomAD_E_AMR: 0.0031%
gnomAD_E_NFE: 0.0075%
gnomAD_E_SAS: 0.0067%
gnomAD_G_AFR: 0.0749%
gnomAD_G_FIN: 0.0597%
gnomAD_G_NFE: 0.0219%
MISSENSE_VARIANT SNV 19-55286854-A-G [0/1] rs666590
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0799%
gnomAD_E_AFR: 0.0707%
gnomAD_E_AMR: 0.0127%
gnomAD_E_NFE: 0.0047%
gnomAD_G_AFR: 0.1781%
gnomAD_G_NFE: 0.0226%
MISSENSE_VARIANT SNV 19-55284976-A-G [0/1] rs79002558
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0799%
ExAC AFR: 0.1371%
ExAC AMR: 0.0355%
ExAC EAS: 0.1868%
ExAC FIN: 0.0312%
ExAC NFE: 0.1022%
ExAC OTH: 0.1147%
gnomAD_E_AFR: 0.0998%
gnomAD_E_AMR: 0.0370%
gnomAD_E_EAS: 0.1348%
gnomAD_E_FIN: 0.0092%
gnomAD_E_NFE: 0.1480%
gnomAD_E_OTH: 0.0566%
gnomAD_G_AFR: 0.0249%
gnomAD_G_EAS: 0.1913%
gnomAD_G_NFE: 0.1622%
FRAMESHIFT_ELONGATION INS 19-55286775-G-GCA [0/1] rs537689412
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 1.1725%
gnomAD_E_AMR: 0.6766%
gnomAD_E_EAS: 0.6586%
gnomAD_E_FIN: 1.7201%
gnomAD_E_NFE: 0.1655%
gnomAD_E_OTH: 0.3689%
gnomAD_E_SAS: 0.2002%
gnomAD_G_AFR: 0.1202%
gnomAD_G_AMR: 0.2778%
gnomAD_G_EAS: 0.2019%
gnomAD_G_FIN: 0.0323%
gnomAD_G_NFE: 0.1043%
gnomAD_G_OTH: 0.1190%
FRAMESHIFT_TRUNCATION DEL 19-55286772-AAG-A [0/1] rs781738613
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 1.1449%
gnomAD_E_AMR: 0.6713%
gnomAD_E_EAS: 0.6555%
gnomAD_E_FIN: 1.7296%
gnomAD_E_NFE: 0.1753%
gnomAD_E_OTH: 0.4076%
gnomAD_E_SAS: 0.1871%
gnomAD_G_AFR: 0.1155%
gnomAD_G_AMR: 0.1362%
gnomAD_G_EAS: 0.1948%
gnomAD_G_FIN: 0.0319%
gnomAD_G_NFE: 0.0868%
gnomAD_G_OTH: 0.1157%
MISSENSE_VARIANT SNV 19-55286665-T-A [0/1] rs199644153
Pathogenicity Data:
Best Score: 0.39999998
Polyphen2: 0.001 (B)
SIFT: 0.600 (T)
Frequency Data:
gnomAD_E_AFR: 0.0234%
gnomAD_E_AMR: 0.0472%
gnomAD_E_EAS: 0.0305%
gnomAD_E_FIN: 0.9915%
gnomAD_E_NFE: 0.0275%
gnomAD_E_OTH: 0.1511%
gnomAD_E_SAS: 0.0124%
gnomAD_G_AFR: 0.0315%
gnomAD_G_EAS: 0.0684%
gnomAD_G_FIN: 0.0339%
gnomAD_G_NFE: 0.0269%
SYNONYMOUS_VARIANT SNV 19-55284939-A-G [0/1] rs201793527
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0465%
gnomAD_E_AMR: 0.0062%
gnomAD_E_FIN: 0.0046%
gnomAD_E_NFE: 0.0037%
gnomAD_E_SAS: 0.0034%
gnomAD_G_AFR: 0.0133%
gnomAD_G_NFE: 0.0078%
SYNONYMOUS_VARIANT SNV 19-55286822-C-T [0/1] rs28465191
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC EAS: 0.0118%
ExAC NFE: 0.0016%
ExAC SAS: 0.0206%
gnomAD_E_EAS: 0.0062%
gnomAD_E_NFE: 0.0011%
gnomAD_E_SAS: 0.0588%
SYNONYMOUS_VARIANT SNV 19-55284987-G-A [0/1] rs74415453
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
ExAC AFR: 0.0293%
ExAC AMR: 0.0178%
ExAC EAS: 0.0233%
ExAC NFE: 0.0046%
ExAC SAS: 0.0939%
gnomAD_E_AFR: 0.0199%
gnomAD_E_AMR: 0.0092%
gnomAD_E_EAS: 0.0117%
gnomAD_E_NFE: 0.0065%
gnomAD_E_SAS: 0.0907%
gnomAD_G_AFR: 0.0617%
gnomAD_G_NFE: 0.0219%
MISSENSE_VARIANT SNV 19-55285082-T-C [0/1] rs80323556
Pathogenicity Data:
Best Score: 0.001
Polyphen2: 0.001 (B)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
gnomAD_E_AFR: 0.0202%
gnomAD_E_AMR: 0.0159%
gnomAD_G_AFR: 0.0399%

Exomiser Score: 0.745

Phenotype Score: 0.505

Variant Score: 0.991

Phenotype matches:
Proximity score 0.505 in interactome to COL10A1 and phenotypic similarity 0.658 to Metaphyseal chondrodysplasia, Schmid type associated with COL10A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0005819, Short middle phalanx of finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009844, Broad middle phalanx of finger
HP:0010055, Broad hallux - HP:0009844, Broad middle phalanx of finger
Proximity score 0.505 in interactome to COL10A1 and phenotypic similarity 0.579 to mouse mutant of COL10A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology
HP:0001363, Craniosynostosis - MP:0008272, abnormal endochondral bone ossification
HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology
HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.745

Phenotype Score: 0.505

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-139825250-G-A [0/1] rs143147850
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.999879
Polyphen2: 0.990 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
TOPMed: 0.0096%
ESP AA: 0.0454%
ESP All: 0.0154%
ExAC AFR: 0.0192%
ExAC AMR: 0.0086%
ExAC EAS: 0.0231%
ExAC NFE: 0.0030%
ExAC SAS: 0.0182%
gnomAD_E_AFR: 0.0131%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0290%
gnomAD_E_NFE: 0.0027%
gnomAD_E_SAS: 0.0097%
gnomAD_G_EAS: 0.0617%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.744

Phenotype Score: 0.502

Variant Score: 0.996

Phenotype matches:
Proximity score 0.502 in interactome to TAF6 and phenotypic similarity 0.812 to Alazami-Yuan syndrome associated with TAF6.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0010055, Broad hallux
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.502 in interactome to TAF6 and phenotypic similarity 0.257 to mouse mutant of TAF6.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0011965, decreased total retina thickness
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.502

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-105255228-G-A [0/1] rs531335953
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.998368
Polyphen2: 0.594 (P)
Mutation Taster: 0.998 (P)
SIFT: 0.005 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0064%
ExAC SAS: 0.0132%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0098%
gnomAD_E_FIN: 0.0133%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0088%

GIP

Exomiser Score: 0.744

Phenotype Score: 0.503

Variant Score: 0.994

Phenotype matches:
Proximity score 0.503 in interactome to PTH1R and phenotypic similarity 0.688 to Eiken syndrome associated with PTH1R.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009371, Type A1 brachydactyly
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0001783, Broad metatarsal
HP:0010055, Broad hallux - HP:0001847, Long hallux
Proximity score 0.503 in interactome to PTH1R and phenotypic similarity 0.589 to mouse mutant of PTH1R.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003662, abnormal long bone epiphyseal plate proliferative zone
HP:0001363, Craniosynostosis - MP:0000440, domed cranium
HP:0011304, Broad thumb - MP:0003662, abnormal long bone epiphyseal plate proliferative zone
HP:0010055, Broad hallux - MP:0003662, abnormal long bone epiphyseal plate proliferative zone
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.503

Variant Score: 0.994

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-47041748-A-G [0/1] rs551204127
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Variant score: 0.994 CONTRIBUTING VARIANT
Transcripts:
GIP:ENST00000357424.2:c.181T>C:p.(Tyr61His)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 0.978 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0023%
ExAC EAS: 0.0347%
gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.744

Phenotype Score: 0.500

Variant Score: 0.997

Phenotype matches:
Proximity score 0.500 in interactome to FGFRL1 and phenotypic similarity 0.778 to mouse mutant of FGFRL1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology
HP:0001363, Craniosynostosis - MP:0010743, delayed cranial suture closure
HP:0011304, Broad thumb - MP:0012514, pectus excavatum
HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology
Proximity score 0.500 in interactome to FGFRL1 and phenotypic similarity 0.313 to fish mutant of FGFRL1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0005133, palatoquadrate cartilage shape, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.500

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-45811650-C-T [0/1] rs201222735
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.987 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0011%
ExAC EAS: 0.0232%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.744

Phenotype Score: 0.504

Variant Score: 0.992

Phenotype matches:
Proximity score 0.504 in interactome to RRAS2 and phenotypic similarity 0.642 to Noonan syndrome associated with RRAS2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.504 in interactome to RRAS2 and phenotypic similarity 0.309 to mouse mutant of RRAS2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001326, retinal degeneration
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.744

Phenotype Score: 0.504

Variant Score: 0.992

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-49242252-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.992 CONTRIBUTING VARIANT
Transcripts:
RASIP1:ENST00000222145.4:c.788T>G:p.(Leu263Arg)
Pathogenicity Data:
Best Score: 0.992
Polyphen2: 0.638 (P)
Mutation Taster: 0.953 (P)
SIFT: 0.008 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.743

Phenotype Score: 0.500

Variant Score: 0.996

Phenotype matches:
Proximity score 0.500 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.500 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification
HP:0011304, Broad thumb - MP:0004351, short humerus
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.743

Phenotype Score: 0.500

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
STOP_GAINED SNV 1-151143037-G-A [0/1] rs762963849
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.996 CONTRIBUTING VARIANT
Transcripts:
TMOD4:ENST00000416280.2:c.766C>T:p.(Arg256*)
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0030%
UK10K: 0.0264%
ExAC AFR: 0.0096%
ExAC NFE: 0.0015%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0030%
gnomAD_E_NFE: 0.0027%
gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.742

Phenotype Score: 0.541

Variant Score: 0.950

Phenotype matches:
Phenotypic similarity 0.541 to X-linked non-syndromic intellectual disability associated with FRMPD4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Phenotypic similarity 0.399 to mouse mutant involving FRMPD4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002764, short tibia
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002764, short tibia
HP:0010055, Broad hallux - MP:0002764, short tibia
Known diseases:
OMIM:300983 Intellectual developmental disorder, X-linked 104 - X-linked recessive
ORPHA:777 X-linked non-syndromic intellectual disability - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.742

Phenotype Score: 0.541

Variant Score: 0.950

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to ORPHA:777 X-linked non-syndromic intellectual disability
Variants contributing to score:
MISSENSE_VARIANT SNV X-12734214-C-T [0/1] rs200271818
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.950 CONTRIBUTING VARIANT
Transcripts:
FRMPD4:ENST00000380682.1:c.1636C>T:p.(Leu546Phe)
Pathogenicity Data:
Best Score: 0.964
Polyphen2: 0.075 (B)
SIFT: 0.036 (D)
Frequency Data:
1000Genomes: 0.0795%
TOPMed: 0.0060%
ExAC EAS: 0.0611%
gnomAD_E_EAS: 0.0806%
gnomAD_G_EAS: 0.1041%

Exomiser Score: 0.741

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:
Proximity score 0.500 in interactome to AHSG and phenotypic similarity 0.645 to Alopecia-intellectual disability syndrome associated with AHSG.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to AHSG and phenotypic similarity 0.399 to mouse mutant of AHSG.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002764, short tibia
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002764, short tibia
HP:0010055, Broad hallux - MP:0002764, short tibia
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.741

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-100676720-G-T [1/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.995 CONTRIBUTING VARIANT
Transcripts:
MUC17:ENST00000306151.4:c.2023G>T:p.(Gly675Cys)
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.129 (B)
SIFT: 0.005 (D)
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.712

Phenotype Score: 0.500

Variant Score: 0.979

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-100684422-T-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.979 CONTRIBUTING VARIANT
Transcripts:
MUC17:ENST00000306151.4:c.9725T>C:p.(Leu3242Pro)
Pathogenicity Data:
Best Score: 0.979
Polyphen2: 0.979 (D)
SIFT: 0.098 (T)
Frequency Data:
No frequency data
Other passed variants:
SYNONYMOUS_VARIANT SNV 7-100676713-T-C [0/1] rs140333451
Variant score: 0.100
Transcripts:
MUC17:ENST00000306151.4:c.2016T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0129%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0288%
ExAC AMR: 0.0259%
gnomAD_E_AFR: 0.0261%
gnomAD_E_AMR: 0.0179%
gnomAD_G_AFR: 0.0230%

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:
Proximity score 0.500 in interactome to TFPI and phenotypic similarity 0.614 to mouse mutant of TFPI.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000585, kinked tail
HP:0001363, Craniosynostosis - MP:0000084, abnormal fontanelle morphology
HP:0011304, Broad thumb - MP:0000585, kinked tail
HP:0010055, Broad hallux - MP:0000585, kinked tail
Known diseases:
OMIM:612926 Hemolytic uremic syndrome, atypical, susceptibility to, 6 (susceptibility)
OMIM:614486 Thrombophilia due to thrombomodulin defect - unknown
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 20-23028910-G-A [0/1] rs1984633904
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.995 CONTRIBUTING VARIANT
Transcripts:
THBD:ENST00000377103.2:c.1232C>T:p.(Thr411Ile)
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.592 (P)
SIFT: 0.005 (D)
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:
Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.703 to Neurofacioskeletal syndrome with or without renal agenesis associated with HS2ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0011927, Short digit
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger
HP:0010055, Broad hallux - HP:0010186, Broad distal phalanx of the toes
Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.698 to mouse mutant of HS2ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-53155439-G-A [0/1] rs765793724
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.711 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.021 (D)
Frequency Data:
TOPMed: 0.0019%
ExAC EAS: 0.0233%
ExAC SAS: 0.0063%
gnomAD_E_EAS: 0.0359%
gnomAD_E_SAS: 0.0034%

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

Phenotype matches:
Proximity score 0.500 in interactome to SEC24C and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with SEC24C.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.500

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.995 CONTRIBUTING VARIANT
Transcripts:
KIR3DL1:ENST00000402254.2:c.1089G>C:p.(Trp363Cys)
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.995 (D)
SIFT: 0.011 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.738

Phenotype Score: 0.500

Variant Score: 0.994

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.995 CONTRIBUTING VARIANT
Transcripts:
KIR3DL1:ENST00000402254.2:c.1089G>C:p.(Trp363Cys)
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.995 (D)
SIFT: 0.011 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377325-C-T [0/1] rs1338748485
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.993 CONTRIBUTING VARIANT
Transcripts:
KIR3DL1:ENST00000402254.2:c.1066C>T:p.(Leu356Phe)
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.993 (D)
SIFT: 0.630 (T)
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 19-55377343-C-T [0/1] rs138402445
Variant score: 0.982
Transcripts:
KIR3DL1:ENST00000402254.2:c.1084C>T:p.(Arg362Cys)
Pathogenicity Data:
Best Score: 0.982
Polyphen2: 0.724 (P)
SIFT: 0.018 (D)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0027%
MISSENSE_VARIANT SNV 19-55377302-T-C [0/1] rs1224475740
Variant score: 0.966
Transcripts:
KIR3DL1:ENST00000402254.2:c.1043T>C:p.(Val348Ala)
Pathogenicity Data:
Best Score: 0.966
Polyphen2: 0.966 (D)
SIFT: 0.105 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377265-T-C [0/1] rs796466301
Variant score: 0.866
Transcripts:
KIR3DL1:ENST00000402254.2:c.1006T>C:p.(Cys336Arg)
Pathogenicity Data:
Best Score: 0.866
SIFT: 0.134 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377280-G-A [0/1] rs796782943
Variant score: 0.848
Transcripts:
KIR3DL1:ENST00000402254.2:c.1021G>A:p.(Val341Ile)
Pathogenicity Data:
Best Score: 0.848
Polyphen2: 0.010 (B)
SIFT: 0.152 (T)
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 19-55377255-T-C [0/1] rs371490654
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 19-55377884-C-T [0/1] rs920394404
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377875-C-G [0/1] rs973541788
Variant score: 0.600
Transcripts:
KIR3DL1:ENST00000402254.2:c.1156C>G:p.(Gln386Glu)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377319-C-A [0/1] rs1296399738
Variant score: 0.491
Transcripts:
KIR3DL1:ENST00000402254.2:c.1060C>A:p.(Leu354Ile)
Pathogenicity Data:
Best Score: 0.491
Polyphen2: 0.009 (B)
SIFT: 0.509 (T)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 19-55377279-T-C [0/1] rs779666933
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 19-55377303-C-T [0/1] rs1359951579
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 19-55377853-G-C [0/1] rs540202245
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 19-55377871-T-C [0/1] rs941565211
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377340-T-C [0/1] rs2915987
Variant score: 0.004
Transcripts:
KIR3DL1:ENST00000402254.2:c.1081T>C:p.(Tyr361His)
Pathogenicity Data:
Best Score: 0.004
Polyphen2: 0.004 (B)
Frequency Data:
gnomAD_E_AMR: 0.0060%
MISSENSE_VARIANT SNV 19-55377307-T-A [0/1] rs2915986
Variant score: 0.001
Transcripts:
KIR3DL1:ENST00000402254.2:c.1048T>A:p.(Phe350Ile)
Pathogenicity Data:
Best Score: 0.001
Polyphen2: 0.001 (B)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0009%

PKM

Exomiser Score: 0.740

Phenotype Score: 0.503

Variant Score: 0.992

Phenotype matches:
Proximity score 0.503 in interactome to CANT1 and phenotypic similarity 0.638 to Desbuquois dysplasia 1 associated with CANT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009611, Bifid distal phalanx of the thumb
HP:0010055, Broad hallux - HP:0010097, Partial duplication of the distal phalanx of the hallux
Proximity score 0.503 in interactome to CANT1 and phenotypic similarity 0.315 to mouse mutant of CANT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002111, abnormal tail morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002111, abnormal tail morphology
HP:0010055, Broad hallux - MP:0002111, abnormal tail morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.740

Phenotype Score: 0.503

Variant Score: 0.992

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-72495523-G-A [0/1] rs199599246
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.013 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.081 (T)
Frequency Data:
TOPMed: 0.0072%
ExAC EAS: 0.0579%
ExAC NFE: 0.0015%
ExAC SAS: 0.0061%
gnomAD_E_EAS: 0.0406%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0032%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.739

Phenotype Score: 0.503

Variant Score: 0.991

Phenotype matches:
Proximity score 0.503 in interactome to LMBR1 and phenotypic similarity 0.714 to Triphalangeal thumb, type I associated with LMBR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001830, Postaxial foot polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0005866, Opposable triphalangeal thumb
HP:0010055, Broad hallux - HP:0001841, Preaxial foot polydactyly
Proximity score 0.503 in interactome to LMBR1 and phenotypic similarity 0.806 to mouse mutant of LMBR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis - MP:0000554, abnormal carpal bone morphology
HP:0011304, Broad thumb - MP:0002543, brachyphalangia
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.739

Phenotype Score: 0.503

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-111963935-T-C [0/1] rs758370402
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.356 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.132 (T)
Frequency Data:
TOPMed: 0.0015%
ExAC EAS: 0.0347%
gnomAD_E_EAS: 0.0524%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.738

Phenotype Score: 0.506

Variant Score: 0.987

Phenotype matches:
Proximity score 0.506 in interactome to ASAP1 and phenotypic similarity 0.712 to mouse mutant of ASAP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0003420, delayed intramembranous bone ossification
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.738

Phenotype Score: 0.506

Variant Score: 0.987

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-27309003-C-T [0/1] rs774185140
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.988593
Polyphen2: 0.329 (B)
Mutation Taster: 0.989 (P)
SIFT: 0.125 (T)
Frequency Data:
TOPMed: 0.0023%
ExAC EAS: 0.0116%
ExAC NFE: 0.0030%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.737

Phenotype Score: 0.500

Variant Score: 0.993

Phenotype matches:
Proximity score 0.500 in interactome to RAC3 and phenotypic similarity 0.624 to Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies associated with RAC3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0030084, Clinodactyly
HP:0001363, Craniosynostosis - HP:0011320, Unilambdoid synostosis
HP:0011304, Broad thumb - HP:0030084, Clinodactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.737

Phenotype Score: 0.500

Variant Score: 0.993

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-74657488-G-A [0/1] rs759179515
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.946 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.012 (D)
Frequency Data:
TOPMed: 0.0026%
ExAC EAS: 0.0116%
ExAC SAS: 0.0303%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0520%

Exomiser Score: 0.736

Phenotype Score: 0.501

Variant Score: 0.991

Phenotype matches:
Phenotypic similarity 0.305 to zebrafish mutant involving DDX18.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0000407, head decreased width, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to BMS1 and phenotypic similarity 0.602 to Aplasia cutis congenita associated with BMS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.501 in interactome to BMS1 and phenotypic similarity 0.299 to mouse mutant of BMS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.736

Phenotype Score: 0.501

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-118579477-C-T [0/1] rs1296368068
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.991 CONTRIBUTING VARIANT
Transcripts:
DDX18:ENST00000263239.2:c.791C>T:p.(Ala264Val)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.345 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.044

Phenotype Score: 0.501

Variant Score: 0.545

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-118579477-C-T [0/1] rs1296368068
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.991 CONTRIBUTING VARIANT
Transcripts:
DDX18:ENST00000263239.2:c.791C>T:p.(Ala264Val)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.345 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
gnomAD_G_EAS: 0.0617%
SYNONYMOUS_VARIANT SNV 2-118587005-G-C [0/1] rs751071991
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
DDX18:ENST00000263239.2:c.1833G>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0231%
ExAC NFE: 0.0030%
gnomAD_E_EAS: 0.0175%
gnomAD_E_NFE: 0.0018%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.735

Phenotype Score: 0.500

Variant Score: 0.992

Phenotype matches:
Phenotypic similarity 0.318 to mouse mutant involving BAZ2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to BPTF and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with BPTF.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.500 in interactome to BPTF and phenotypic similarity 0.330 to mouse mutant of BPTF.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.735

Phenotype Score: 0.500

Variant Score: 0.992

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-160285729-C-T [0/1] rs991973729
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.993144
Polyphen2: 0.306 (B)
Mutation Taster: 0.993 (P)
SIFT: 0.028 (D)
Frequency Data:
TOPMed: 0.0096%
gnomAD_E_EAS: 0.0061%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.734

Phenotype Score: 0.500

Variant Score: 0.991

Phenotype matches:
Proximity score 0.500 in interactome to TRIP13 and phenotypic similarity 0.446 to Mosaic variegated aneuploidy syndrome associated with TRIP13.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
Proximity score 0.500 in interactome to TRIP13 and phenotypic similarity 0.695 to mouse mutant of TRIP13.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.734

Phenotype Score: 0.500

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-20846959-G-A [0/1] rs778578770
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.397 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.011 (D)
Frequency Data:
TOPMed: 0.0011%
ExAC EAS: 0.0347%
ExAC NFE: 0.0015%
ExAC SAS: 0.0121%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0027%
gnomAD_E_SAS: 0.0097%
gnomAD_G_EAS: 0.0617%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.732

Phenotype Score: 0.500

Variant Score: 0.990

Phenotype matches:
Proximity score 0.500 in interactome to AMMECR1 and phenotypic similarity 0.667 to Midface hypoplasia, hearing impairment, elliptocytosis, and nephrocalcinosis associated with AMMECR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.732

Phenotype Score: 0.500

Variant Score: 0.990

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-118196364-C-T [0/1] rs577563045
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.990 CONTRIBUTING VARIANT
Transcripts:
PNLIPRP3:ENST00000369230.3:c.191C>T:p.(Pro64Leu)
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.128 (B)
SIFT: 0.007 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0015%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0237%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.198

Phenotype Score: 0.500

Variant Score: 0.728

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-118196364-C-T [0/1] rs577563045
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.990 CONTRIBUTING VARIANT
Transcripts:
PNLIPRP3:ENST00000369230.3:c.191C>T:p.(Pro64Leu)
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.128 (B)
SIFT: 0.007 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0015%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0237%
MISSENSE_VARIANT SNV 10-118228755-G-C [0/1] rs143512460
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.466 CONTRIBUTING VARIANT
Transcripts:
PNLIPRP3:ENST00000369230.3:c.986G>C:p.(Arg329Thr)
Pathogenicity Data:
Best Score: 0.923
Polyphen2: 0.063 (B)
SIFT: 0.077 (T)
Frequency Data:
1000Genomes: 0.2596%
TOPMed: 0.0612%
UK10K: 0.0264%
ESP AA: 0.0227%
ESP EA: 0.0814%
ESP All: 0.0615%
ExAC AFR: 0.0097%
ExAC EAS: 1.5390%
ExAC FIN: 0.0455%
ExAC NFE: 0.0330%
ExAC OTH: 0.3319%
ExAC SAS: 0.0667%
gnomAD_E_EAS: 1.2411%
gnomAD_E_FIN: 0.0314%
gnomAD_E_NFE: 0.0314%
gnomAD_E_OTH: 0.1835%
gnomAD_E_SAS: 0.0661%
gnomAD_G_EAS: 0.9259%
gnomAD_G_NFE: 0.0267%
gnomAD_G_OTH: 0.2037%

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

Phenotype matches:
Proximity score 0.500 in interactome to CPLANE2 and phenotypic similarity 0.744 to mouse mutant of CPLANE2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0002639, micrognathia
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-39583424-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.989303
Polyphen2: 0.002 (B)
Mutation Taster: 0.989 (P)
SIFT: 0.318 (T)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.530

Phenotype Score: 0.500

Variant Score: 0.894

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-39583424-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.989303
Polyphen2: 0.002 (B)
Mutation Taster: 0.989 (P)
SIFT: 0.318 (T)
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT DEL 2-39564661-AT-A [0/1] rs768190902
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

Phenotype matches:
Phenotypic similarity 0.286 to mouse mutant involving NEMP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to LEMD2 and phenotypic similarity 0.629 to Marbach-Rustad progeroid syndrome associated with LEMD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0031846, Femur fracture
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0031846, Femur fracture
HP:0010055, Broad hallux - HP:0031846, Femur fracture
Proximity score 0.500 in interactome to LEMD2 and phenotypic similarity 0.257 to mouse mutant of LEMD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0006069, abnormal retinal neuronal layer morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.731

Phenotype Score: 0.500

Variant Score: 0.989

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-57454690-C-T [0/1] rs201453766
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.021 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0068%
ExAC EAS: 0.0695%
gnomAD_E_EAS: 0.0754%
gnomAD_G_EAS: 0.0618%

Exomiser Score: 0.727

Phenotype Score: 0.501

Variant Score: 0.987

Phenotype matches:
Proximity score 0.501 in interactome to ANXA1 and phenotypic similarity 0.631 to mouse mutant of ANXA1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.727

Phenotype Score: 0.501

Variant Score: 0.987

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 12-11244067-A-ATT [0/1] rs760672236
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.987 CONTRIBUTING VARIANT
Transcripts:
TAS2R43:ENST00000531678.1:c.761_762insAA:p.(Ser254Argfs*27)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0375%
gnomAD_E_AMR: 0.0512%
gnomAD_E_FIN: 0.0900%
gnomAD_E_NFE: 0.0908%

Exomiser Score: 0.726

Phenotype Score: 0.500

Variant Score: 0.987

Phenotype matches:
Proximity score 0.500 in interactome to CITED2 and phenotypic similarity 0.703 to Tetralogy of Fallot associated with CITED2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to CITED2 and phenotypic similarity 0.320 to mouse mutant of CITED2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000074, abnormal neurocranium morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.726

Phenotype Score: 0.500

Variant Score: 0.987

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-461507-G-A [0/1] rs202106031
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
TOPMed: 0.0104%
ExAC AFR: 0.0097%
ExAC AMR: 0.0260%
ExAC EAS: 0.0811%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0476%
gnomAD_E_EAS: 0.0928%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0366%

Exomiser Score: 0.725

Phenotype Score: 0.500

Variant Score: 0.986

Phenotype matches:
Proximity score 0.500 in interactome to HERC1 and phenotypic similarity 0.604 to Megalencephaly-severe kyphoscoliosis-overgrowth syndrome associated with HERC1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly
HP:0001363, Craniosynostosis - HP:0011330, Metopic synostosis
HP:0011304, Broad thumb - HP:0001166, Arachnodactyly
HP:0010055, Broad hallux - HP:0001166, Arachnodactyly
Proximity score 0.500 in interactome to HERC1 and phenotypic similarity 0.332 to mouse mutant of HERC1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.725

Phenotype Score: 0.500

Variant Score: 0.986

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 22-37708154-G-A [0/1] rs749693397
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.986 CONTRIBUTING VARIANT
Transcripts:
CYTH4:ENST00000248901.6:c.1051G>A:p.(Glu351Lys)
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.067 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.367 (T)
Frequency Data:
TOPMed: 0.0370%
gnomAD_E_AMR: 0.0983%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.721

Phenotype Score: 0.500

Variant Score: 0.984

Phenotype matches:
Proximity score 0.500 in interactome to ARVCF and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with ARVCF.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.500 in interactome to ARVCF and phenotypic similarity 0.299 to mouse mutant of ARVCF.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.721

Phenotype Score: 0.500

Variant Score: 0.984

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-52733209-A-G [0/1] rs202074278
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999929
Polyphen2: 0.591 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.019 (D)
Frequency Data:
gnomAD_E_AFR: 0.0066%
gnomAD_G_OTH: 0.1068%
MISSENSE_VARIANT SNV 8-52733214-A-C [0/1] rs200377849
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999961
Polyphen2: 0.880 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.477 (T)
Frequency Data:
ExAC AFR: 0.0201%
ExAC AMR: 0.0086%
ExAC NFE: 0.0015%
ExAC OTH: 0.1104%
ExAC SAS: 0.0121%
Other passed variants:
MISSENSE_VARIANT SNV 8-52733054-C-T [0/1] rs116852339
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.910 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.051 (D)
Frequency Data:
gnomAD_E_AFR: 0.0173%
gnomAD_E_AMR: 0.0596%
gnomAD_E_EAS: 0.0615%
gnomAD_E_FIN: 0.0624%
gnomAD_E_NFE: 0.0925%
gnomAD_E_OTH: 0.0225%
gnomAD_E_SAS: 0.0267%
gnomAD_G_AFR: 0.1270%
gnomAD_G_AMR: 0.7782%
gnomAD_G_EAS: 0.7075%
gnomAD_G_FIN: 0.1679%
gnomAD_G_NFE: 0.1013%
gnomAD_G_OTH: 0.1420%

Exomiser Score: 0.716

Phenotype Score: 0.500

Variant Score: 0.981

Phenotype matches:
Proximity score 0.500 in interactome to TOMM6 and phenotypic similarity 0.755 to mouse mutant of TOMM6.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.716

Phenotype Score: 0.500

Variant Score: 0.981

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-1718302-G-A [0/1] rs758932131
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.992
Polyphen2: 0.992 (D)
SIFT: 0.346 (T)
Frequency Data:
TOPMed: 0.0053%
ExAC NFE: 0.0137%
gnomAD_E_EAS: 0.0762%
gnomAD_E_FIN: 0.0060%
gnomAD_E_NFE: 0.0043%

X_DOMINANT

Exomiser Score: 0.716

Phenotype Score: 0.500

Variant Score: 0.981

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-1718302-G-A [0/1] rs758932131
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.992
Polyphen2: 0.992 (D)
SIFT: 0.346 (T)
Frequency Data:
TOPMed: 0.0053%
ExAC NFE: 0.0137%
gnomAD_E_EAS: 0.0762%
gnomAD_E_FIN: 0.0060%
gnomAD_E_NFE: 0.0043%

Exomiser Score: 0.715

Phenotype Score: 0.500

Variant Score: 0.981

Phenotype matches:
Phenotypic similarity 0.487 to Multiple pterygium syndrome, lethal type associated with CHRND.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009381, Short finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009381, Short finger
HP:0010055, Broad hallux - HP:0009381, Short finger
Phenotypic similarity 0.272 to mouse mutant involving CHRND.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001297, microphthalmia
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to LAMA5 and phenotypic similarity 0.739 to mouse mutant of LAMA5.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases:
OMIM:253290 Multiple pterygium syndrome, lethal type - autosomal recessive
OMIM:616321 ?Myasthenic syndrome, congenital, 3A, slow-channel (unconfirmed)
OMIM:616322 Myasthenic syndrome, congenital, 3B, fast-channel - autosomal recessive
OMIM:616323 ?Myasthenic syndrome, congenital, 3C, associated with acetylcholine receptor deficiency (unconfirmed)
ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal dominant
ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive
ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive
ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal dominant
ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive
ORPHA:98913 Postsynaptic congenital myasthenic syndromes - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.715

Phenotype Score: 0.500

Variant Score: 0.981

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.170 to ORPHA:98913 Postsynaptic congenital myasthenic syndromes
Variants contributing to score:
MISSENSE_VARIANT SNV 2-233399991-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.981024
Polyphen2: 0.380 (B)
Mutation Taster: 0.981 (P)
SIFT: 0.044 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.714

Phenotype Score: 0.503

Variant Score: 0.977

Phenotype matches:
Proximity score 0.503 in interactome to CTCF and phenotypic similarity 0.750 to CTCF-related neurodevelopmental disorder associated with CTCF.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0010059, Broad hallux phalanx
HP:0010055, Broad hallux - HP:0010059, Broad hallux phalanx
Proximity score 0.503 in interactome to CTCF and phenotypic similarity 0.335 to fish mutant of CTCF.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0002314, head shape, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.714

Phenotype Score: 0.503

Variant Score: 0.977

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-1858453-G-A [0/1] rs201187761
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.002 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.174 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0088%
ESP AA: 0.0228%
ESP All: 0.0077%
ExAC AFR: 0.0112%
ExAC EAS: 0.0846%
ExAC NFE: 0.0017%
gnomAD_E_EAS: 0.1085%
gnomAD_E_NFE: 0.0011%
gnomAD_G_AFR: 0.0115%
MISSENSE_VARIANT SNV 11-1858638-C-T [0/1] rs201288743
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.986
Polyphen2: 0.001 (B)
SIFT: 0.014 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0080%
ExAC EAS: 0.0835%
gnomAD_E_EAS: 0.1169%
gnomAD_G_AFR: 0.0115%
Other passed variants:
MISSENSE_VARIANT SNV 11-1856670-G-A [0/1] rs3741238
Pathogenicity Data:
Best Score: 0.952
Polyphen2: 0.357 (B)
SIFT: 0.048 (D)
Frequency Data:
1000Genomes: 0.2196%
TOPMed: 0.0265%
ExAC EAS: 0.7884%
ExAC OTH: 0.1289%
ExAC SAS: 0.0132%
gnomAD_E_EAS: 0.7221%
gnomAD_E_OTH: 0.0376%
gnomAD_E_SAS: 0.0066%
gnomAD_G_EAS: 0.4932%

Exomiser Score: 0.713

Phenotype Score: 0.500

Variant Score: 0.980

Phenotype matches:
Proximity score 0.500 in interactome to CPLX1 and phenotypic similarity 0.628 to Wolf-Hirschhorn syndrome associated with CPLX1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly
HP:0010055, Broad hallux - HP:0010109, Short hallux
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.713

Phenotype Score: 0.500

Variant Score: 0.980

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-37961641-C-T [0/1] rs763867304
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.993676
Polyphen2: 0.003 (B)
Mutation Taster: 0.994 (P)
SIFT: 0.018 (D)
Frequency Data:
TOPMed: 0.0019%
ExAC EAS: 0.0302%
gnomAD_E_EAS: 0.0467%
gnomAD_G_EAS: 0.0986%

X_DOMINANT

Exomiser Score: 0.713

Phenotype Score: 0.500

Variant Score: 0.980

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-37961641-C-T [0/1] rs763867304
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.993676
Polyphen2: 0.003 (B)
Mutation Taster: 0.994 (P)
SIFT: 0.018 (D)
Frequency Data:
TOPMed: 0.0019%
ExAC EAS: 0.0302%
gnomAD_E_EAS: 0.0467%
gnomAD_G_EAS: 0.0986%

Exomiser Score: 0.706

Phenotype Score: 0.769

Variant Score: 0.672

Phenotype matches:
Phenotypic similarity 0.769 to mouse mutant involving FBXW12.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0005270, abnormal zygomatic bone morphology
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.706

Phenotype Score: 0.769

Variant Score: 0.672

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-48423515-A-G [0/1] rs199820482
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.678
Polyphen2: 0.030 (B)
SIFT: 0.322 (T)
Frequency Data:
TOPMed: 0.0019%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.706

Phenotype Score: 0.487

Variant Score: 0.991

Phenotype matches:
Phenotypic similarity 0.487 to mouse mutant involving HHIPL1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004357, long tibia
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0004357, long tibia
HP:0010055, Broad hallux - MP:0004357, long tibia
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.706

Phenotype Score: 0.487

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-100125925-C-G [0/1] rs1455851664
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999671
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0008%
gnomAD_G_EAS: 0.0618%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.033

Phenotype Score: 0.487

Variant Score: 0.529

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-100125925-C-G [0/1] rs1455851664
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999671
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0008%
gnomAD_G_EAS: 0.0618%
SYNONYMOUS_VARIANT SNV 14-100126622-T-C [0/1] rs75448994
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.067 CONTRIBUTING VARIANT
Transcripts:
HHIPL1:ENST00000330710.5:c.1381T>C:p.(=)
HHIPL1:ENST00000357223.2:c.1381T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.2196%
TOPMed: 0.0412%
ExAC EAS: 0.9718%
ExAC OTH: 0.1111%
ExAC SAS: 0.0061%
gnomAD_E_EAS: 0.8699%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0182%
gnomAD_E_SAS: 0.0032%
gnomAD_G_EAS: 1.2346%

Exomiser Score: 0.699

Phenotype Score: 0.503

Variant Score: 0.969

Phenotype matches:
Phenotypic similarity 0.320 to mouse mutant involving AKAP13.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.503 in interactome to ARHGAP31 and phenotypic similarity 0.698 to Adams-Oliver syndrome 1 associated with ARHGAP31.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.699

Phenotype Score: 0.503

Variant Score: 0.969

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-86261321-C-T [0/1] rs148718462
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.972
Polyphen2: 0.897 (P)
SIFT: 0.028 (D)
Frequency Data:
TOPMed: 0.0045%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0096%
gnomAD_E_AFR: 0.0065%
gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.684

Phenotype Score: 0.500

Variant Score: 0.965

Phenotype matches:
Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.684

Phenotype Score: 0.500

Variant Score: 0.965

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-6816225-G-A [0/1] rs778988808
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.965 CONTRIBUTING VARIANT
Transcripts:
OR6A2:ENST00000332601.3:c.715C>T:p.(Arg239Cys)
Pathogenicity Data:
Best Score: 0.967
Polyphen2: 0.051 (B)
SIFT: 0.033 (D)
Frequency Data:
TOPMed: 0.0042%
UK10K: 0.0132%
ExAC AFR: 0.0096%
ExAC AMR: 0.0087%
ExAC NFE: 0.0015%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0131%
gnomAD_E_AMR: 0.0030%
gnomAD_E_FIN: 0.0090%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0065%
gnomAD_G_AFR: 0.0115%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.676

Phenotype Score: 0.500

Variant Score: 0.961

Phenotype matches:
Proximity score 0.500 in interactome to MYOZ1 and phenotypic similarity 0.737 to mouse mutant of MYOZ1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000565, oligodactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000565, oligodactyly
HP:0010055, Broad hallux - MP:0000565, oligodactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.676

Phenotype Score: 0.500

Variant Score: 0.961

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-4411265-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.961
Polyphen2: 0.004 (B)
SIFT: 0.039 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.665

Phenotype Score: 0.500

Variant Score: 0.955

Phenotype matches:
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput
HP:0011304, Broad thumb - HP:0010557, Overlapping fingers
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.665

Phenotype Score: 0.500

Variant Score: 0.955

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-141803139-T-C [0/1] rs763414236
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.957
Polyphen2: 0.082 (B)
SIFT: 0.043 (D)
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0128%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.661

Phenotype Score: 0.500

Variant Score: 0.954

Phenotype matches:
Proximity score 0.500 in interactome to ACTG1 and phenotypic similarity 0.706 to Baraitser-Winter cerebrofrontofacial syndrome associated with ACTG1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009942, Duplication of thumb phalanx
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0009942, Duplication of thumb phalanx
HP:0010055, Broad hallux - HP:0009942, Duplication of thumb phalanx
Proximity score 0.500 in interactome to ACTG1 and phenotypic similarity 0.215 to mouse mutant of ACTG1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004521, abnormal cochlear hair cell stereociliary bundle morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.661

Phenotype Score: 0.500

Variant Score: 0.954

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-201195057-A-G [0/1] rs542708405
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Variant score: 0.979 CONTRIBUTING VARIANT
Transcripts:
IGFN1:ENST00000335211.4:c.10592A>G:p.(His3531Arg)
IGFN1:ENST00000295591.8:c.*49A>G:p.(=)
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.011 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0091%
ExAC AMR: 0.0879%
gnomAD_E_AMR: 0.1443%
gnomAD_E_OTH: 0.0580%
gnomAD_G_AMR: 0.1193%
MISSENSE_VARIANT SNV 1-201181220-C-T [0/1] rs370325809
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.982
SIFT: 0.018 (D)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0518%
ESP AA: 0.0723%
ESP All: 0.0219%
ExAC AFR: 0.1105%
gnomAD_E_AFR: 0.0684%
gnomAD_E_AMR: 0.0126%
gnomAD_E_EAS: 0.3389%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0269%
gnomAD_E_SAS: 0.0044%
gnomAD_G_AFR: 0.0923%
gnomAD_G_EAS: 0.1235%

Exomiser Score: 0.649

Phenotype Score: 0.500

Variant Score: 0.948

Phenotype matches:
Proximity score 0.500 in interactome to SIK3 and phenotypic similarity 0.670 to ?Spondyloepimetaphyseal dysplasia, Krakow type associated with SIK3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002691, Platybasia
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Proximity score 0.500 in interactome to SIK3 and phenotypic similarity 0.812 to mouse mutant of SIK3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0011504, abnormal limb long bone morphology
HP:0001363, Craniosynostosis - MP:0010743, delayed cranial suture closure
HP:0011304, Broad thumb - MP:0011504, abnormal limb long bone morphology
HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.649

Phenotype Score: 0.500

Variant Score: 0.948

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-20430717-A-T [0/1] rs771212949
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.956
Polyphen2: 0.684 (P)
SIFT: 0.044 (D)
Frequency Data:
TOPMed: 0.0072%
ExAC EAS: 0.0232%
ExAC NFE: 0.0030%
ExAC SAS: 0.0121%
gnomAD_E_EAS: 0.0406%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0182%
gnomAD_E_SAS: 0.0195%
gnomAD_G_EAS: 0.0617%
gnomAD_G_NFE: 0.0400%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.595

Phenotype Score: 0.500

Variant Score: 0.923

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-20430717-A-T [0/1] rs771212949
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.956
Polyphen2: 0.684 (P)
SIFT: 0.044 (D)
Frequency Data:
TOPMed: 0.0072%
ExAC EAS: 0.0232%
ExAC NFE: 0.0030%
ExAC SAS: 0.0121%
gnomAD_E_EAS: 0.0406%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0182%
gnomAD_E_SAS: 0.0195%
gnomAD_G_EAS: 0.0617%
gnomAD_G_NFE: 0.0400%
MISSENSE_VARIANT SNV 16-20435371-G-C [0/1] rs190666032
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Variant score: 0.898 CONTRIBUTING VARIANT
Transcripts:
ACSM5:ENST00000331849.4:c.901G>C:p.(Asp301His)
Pathogenicity Data:
Best Score: 0.998
Polyphen2: 0.972 (D)
Mutation Taster: 0.960 (P)
SIFT: 0.002 (D)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0350%
ExAC EAS: 0.3934%
gnomAD_E_EAS: 0.4177%
gnomAD_G_EAS: 0.5556%

Exomiser Score: 0.647

Phenotype Score: 0.527

Variant Score: 0.917

Phenotype matches:
Phenotypic similarity 0.449 to ?Immunodeficiency 59 and hypoglycemia associated with HYOU1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001238, Slender finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001238, Slender finger
HP:0010055, Broad hallux - HP:0001238, Slender finger
Proximity score 0.527 in interactome to SIL1 and phenotypic similarity 0.631 to Marinesco-Sjögren syndrome associated with SIL1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0010508, Metatarsus valgus
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Known diseases:
OMIM:233600 ?Immunodeficiency 59 and hypoglycemia (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.647

Phenotype Score: 0.527

Variant Score: 0.917

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.449 to OMIM:233600 ?Immunodeficiency 59 and hypoglycemia
Variants contributing to score:
MISSENSE_VARIANT SNV 11-118919033-C-T [0/1] rs144328288
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.99958
Polyphen2: 0.975 (D)
Mutation Taster: 1.000 (P)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0083%
ExAC AMR: 0.0519%
ExAC EAS: 0.0928%
ExAC FIN: 0.0454%
ExAC NFE: 0.0045%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0238%
gnomAD_E_EAS: 0.0986%
gnomAD_E_FIN: 0.0202%
gnomAD_E_NFE: 0.0027%
gnomAD_G_EAS: 0.1233%
gnomAD_G_FIN: 0.0286%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 11-118924855-G-C [0/1] rs144079825
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3, BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.998 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.189 (T)
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0193%
ExAC EAS: 0.4397%
ExAC SAS: 0.0372%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.4290%
gnomAD_E_SAS: 0.0325%
gnomAD_G_EAS: 0.7417%

Exomiser Score: 0.644

Phenotype Score: 0.500

Variant Score: 0.945

Phenotype matches:
Proximity score 0.500 in interactome to CPLX1 and phenotypic similarity 0.628 to Wolf-Hirschhorn syndrome associated with CPLX1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly
HP:0010055, Broad hallux - HP:0010109, Short hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.644

Phenotype Score: 0.500

Variant Score: 0.945

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-56386195-G-A [0/1] rs765836371
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.958
Polyphen2: 0.002 (B)
SIFT: 0.042 (D)
Frequency Data:
TOPMed: 0.0064%
ExAC EAS: 0.0833%
gnomAD_E_EAS: 0.0937%
gnomAD_E_SAS: 0.0033%

Exomiser Score: 0.631

Phenotype Score: 0.508

Variant Score: 0.930

Phenotype matches:
Phenotypic similarity 0.265 to mouse mutant involving PER1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005605, increased bone mass
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.508 in interactome to NONO and phenotypic similarity 0.699 to Intellectual developmental disorder, X-linked syndromic 34 associated with NONO.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001822, Hallux valgus
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0001822, Hallux valgus
HP:0010055, Broad hallux - HP:0001822, Hallux valgus
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.631

Phenotype Score: 0.508

Variant Score: 0.930

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-8046972-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.93
Polyphen2: 0.007 (B)
SIFT: 0.070 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.623

Phenotype Score: 0.510

Variant Score: 0.925

Phenotype matches:
Phenotypic similarity 0.670 to Blackfan-Diamond anemia associated with GATA1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001199, Triphalangeal thumb
Phenotypic similarity 0.344 to mouse mutant involving GATA1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0020039, increased bone ossification
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.510 in interactome to ZFPM2 and phenotypic similarity 0.703 to Tetralogy of Fallot associated with ZFPM2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Known diseases:
OMIM:190685 Leukemia, megakaryoblastic, with or without Down syndrome, somatic - unknown
OMIM:300367 Thrombocytopenia, X-linked, with or without dyserythropoietic anemia - X-linked recessive
OMIM:300835 Anemia, X-linked, with/without neutropenia and/or platelet abnormalities - X-linked recessive
OMIM:314050 Thrombocytopenia with beta-thalassemia, X-linked - X-linked recessive
ORPHA:124 Blackfan-Diamond anemia - autosomal dominant
ORPHA:231393 Beta-thalassemia-X-linked thrombocytopenia syndrome - X-linked recessive
ORPHA:67044 Thrombocytopenia with congenital dyserythropoietic anemia - X-linked recessive
ORPHA:79277 Congenital erythropoietic porphyria - autosomal recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.623

Phenotype Score: 0.510

Variant Score: 0.925

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-48650368-G-T [0/1] rs782208453
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 0.935
Polyphen2: 0.026 (B)
SIFT: 0.065 (T)
Frequency Data:
1000Genomes: 0.0265%
TOPMed: 0.0120%
ExAC EAS: 0.0754%
gnomAD_E_EAS: 0.0777%

X_DOMINANT

Exomiser Score: 0.105

Phenotype Score: 0.255

Variant Score: 0.925

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-48650368-G-T [0/1] rs782208453
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 0.935
Polyphen2: 0.026 (B)
SIFT: 0.065 (T)
Frequency Data:
1000Genomes: 0.0265%
TOPMed: 0.0120%
ExAC EAS: 0.0754%
gnomAD_E_EAS: 0.0777%

Exomiser Score: 0.622

Phenotype Score: 0.500

Variant Score: 0.935

Phenotype matches:
Proximity score 0.500 in interactome to UBE4B and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with UBE4B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Known diseases:
OMIM:164400 Spinocerebellar ataxia 1 - autosomal dominant
ORPHA:98755 Spinocerebellar ataxia type 1 - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.622

Phenotype Score: 0.500

Variant Score: 0.935

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-16327915-A-C [-/1] rs11969612
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
ClinVar: UNCERTAIN_SIGNIFICANCE (no assertion criteria provided)
Pathogenicity Data:
Best Score: 0.935
Polyphen2: 0.227 (B)
SIFT: 0.065 (T)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.076

Phenotype Score: 0.250

Variant Score: 0.893

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-16327915-A-C [-/1] rs11969612
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
ClinVar: UNCERTAIN_SIGNIFICANCE (no assertion criteria provided)
Pathogenicity Data:
Best Score: 0.935
Polyphen2: 0.227 (B)
SIFT: 0.065 (T)
Frequency Data:
No frequency data
DISRUPTIVE_INFRAME_DELETION DEL 6-16327915-ATGC-A [-/1] rs193922926
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.615

Phenotype Score: 0.502

Variant Score: 0.929

Phenotype matches:
Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.662 to Adams-Oliver syndrome associated with RBPJ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0010760, Absent toe
Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.245 to mouse mutant of RBPJ.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0010124, decreased bone mineral content
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.615

Phenotype Score: 0.502

Variant Score: 0.929

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 4-140640752-T-C [0/1] rs534986978
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Variant score: 0.943 CONTRIBUTING VARIANT
Transcripts:
MAML3:ENST00000509479.2:c.3142A>G:p.(Met1048Val)
Pathogenicity Data:
Best Score: 0.992
Mutation Taster: 0.968 (P)
SIFT: 0.008 (D)
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0129%
ExAC EAS: 0.2514%
ExAC NFE: 0.0031%
ExAC SAS: 0.0441%
gnomAD_E_EAS: 0.2507%
gnomAD_E_NFE: 0.0027%
gnomAD_E_SAS: 0.0294%
gnomAD_G_EAS: 0.3090%
MISSENSE_VARIANT SNV 4-140811238-G-A [0/1] rs565189281
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.932
Polyphen2: 0.022 (B)
SIFT: 0.068 (T)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0026%
ExAC AFR: 0.0116%
ExAC EAS: 0.0302%
gnomAD_E_AFR: 0.0067%
gnomAD_E_EAS: 0.0237%
gnomAD_E_SAS: 0.0033%
gnomAD_G_EAS: 0.1233%

Exomiser Score: 0.614

Phenotype Score: 0.506

Variant Score: 0.925

Phenotype matches:
Proximity score 0.506 in interactome to SIAH1 and phenotypic similarity 0.858 to Buratti-Harel syndrome associated with SIAH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.614

Phenotype Score: 0.506

Variant Score: 0.925

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-57327738-C-T [0/1] rs56332142
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.93
Polyphen2: 0.428 (B)
SIFT: 0.070 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0087%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC AFR: 0.0098%
ExAC EAS: 0.0116%
ExAC NFE: 0.0060%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0060%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0108%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.612

Phenotype Score: 0.501

Variant Score: 0.930

Phenotype matches:
Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.656 to Noonan syndrome 1 associated with PTPN11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.501 in interactome to PTPN11 and phenotypic similarity 0.540 to mouse mutant of PTPN11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0012514, pectus excavatum
HP:0001363, Craniosynostosis - MP:0010031, abnormal cranium size
HP:0011304, Broad thumb - MP:0012514, pectus excavatum
HP:0010055, Broad hallux - MP:0012514, pectus excavatum
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.612

Phenotype Score: 0.501

Variant Score: 0.930

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55258792-C-T [0/1] rs72487164
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.93
Polyphen2: 0.001 (B)
SIFT: 0.070 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.606

Phenotype Score: 0.500

Variant Score: 0.928

Phenotype matches:
Proximity score 0.500 in interactome to RFWD3 and phenotypic similarity 0.676 to Fanconi anemia associated with RFWD3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.606

Phenotype Score: 0.500

Variant Score: 0.928

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-44120286-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.928 CONTRIBUTING VARIANT
Transcripts:
WDR76:ENST00000263795.6:c.184G>C:p.(Asp62His)
WDR76:ENST00000381246.2:c.-9G>C:p.(=)
Pathogenicity Data:
Best Score: 0.928
Polyphen2: 0.343 (B)
SIFT: 0.072 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.597

Phenotype Score: 0.500

Variant Score: 0.924

Phenotype matches:
Proximity score 0.500 in interactome to RSPO2 and phenotypic similarity 0.468 to ?Humerofemoral hypoplasia with radiotibial ray deficiency associated with RSPO2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0003865, Bowed humerus
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009777, Absent thumb
HP:0010055, Broad hallux - HP:0009777, Absent thumb
Proximity score 0.500 in interactome to RSPO2 and phenotypic similarity 0.727 to mouse mutant of RSPO2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Proximity score 0.500 in interactome to RSPO2 and phenotypic similarity 0.233 to fish mutant of RSPO2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - ZP:0012192, rib hypoplastic, abnormal
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.597

Phenotype Score: 0.500

Variant Score: 0.924

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-161221503-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.924 CONTRIBUTING VARIANT
Transcripts:
OTOL1:ENST00000327928.4:c.1207A>C:p.(Ile403Leu)
Pathogenicity Data:
Best Score: 0.924
Polyphen2: 0.621 (P)
SIFT: 0.076 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.589

Phenotype Score: 0.500

Variant Score: 0.920

Phenotype matches:
Proximity score 0.500 in interactome to B3GLCT and phenotypic similarity 0.709 to Peters-plus syndrome associated with B3GLCT.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0009623, Proximal placement of thumb
HP:0010055, Broad hallux - HP:0001831, Short toe
Proximity score 0.500 in interactome to B3GLCT and phenotypic similarity 0.841 to mouse mutant of B3GLCT.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Known diseases:
OMIM:219050 Cryptorchidism - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.589

Phenotype Score: 0.500

Variant Score: 0.920

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-17932135-C-T [0/1] rs762412864
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.923
Polyphen2: 0.002 (B)
SIFT: 0.077 (T)
Frequency Data:
TOPMed: 0.0072%
gnomAD_E_AFR: 0.0158%
gnomAD_E_EAS: 0.0100%
gnomAD_E_SAS: 0.0044%
gnomAD_G_AFR: 0.0229%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.569

Phenotype Score: 0.500

Variant Score: 0.911

Phenotype matches:
Phenotypic similarity 0.486 to mouse mutant involving GLG1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006396, decreased long bone epiphyseal plate size
HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure
HP:0011304, Broad thumb - MP:0006396, decreased long bone epiphyseal plate size
HP:0010055, Broad hallux - MP:0006396, decreased long bone epiphyseal plate size
Proximity score 0.500 in interactome to PIBF1 and phenotypic similarity 0.613 to Joubert syndrome associated with PIBF1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.500 in interactome to PIBF1 and phenotypic similarity 0.278 to mouse mutant of PIBF1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.569

Phenotype Score: 0.500

Variant Score: 0.911

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-74640853-A-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.911
Polyphen2: 0.009 (B)
SIFT: 0.089 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.566

Phenotype Score: 0.500

Variant Score: 0.910

Phenotype matches:
Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.566

Phenotype Score: 0.500

Variant Score: 0.910

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-20502149-T-C [0/1] rs201040612
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.910 CONTRIBUTING VARIANT
Transcripts:
OR4K13:ENST00000315693.2:c.769A>G:p.(Ile257Val)
Pathogenicity Data:
Best Score: 0.916
Polyphen2: 0.458 (P)
SIFT: 0.084 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0104%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC EAS: 0.0463%
ExAC NFE: 0.0120%
ExAC SAS: 0.0182%
gnomAD_E_EAS: 0.0348%
gnomAD_E_NFE: 0.0072%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0163%
gnomAD_G_NFE: 0.0200%

Exomiser Score: 0.545

Phenotype Score: 0.500

Variant Score: 0.900

Phenotype matches:
Phenotypic similarity 0.397 to mouse mutant involving REXO1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology
HP:0001363, Craniosynostosis - MP:0001293, anophthalmia
HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology
HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology
Proximity score 0.500 in interactome to RAI1 and phenotypic similarity 0.701 to Smith-Magenis syndrome associated with RAI1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.500 in interactome to RAI1 and phenotypic similarity 0.699 to mouse mutant of RAI1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000413, polyphalangy
HP:0001363, Craniosynostosis - MP:0002260, abnormal thyroid cartilage morphology
HP:0011304, Broad thumb - MP:0000413, polyphalangy
HP:0010055, Broad hallux - MP:0000413, polyphalangy
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.545

Phenotype Score: 0.500

Variant Score: 0.900

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-1825935-T-C [0/1] rs756775102
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.900 CONTRIBUTING VARIANT
Transcripts:
REXO1:ENST00000170168.4:c.1919A>G:p.(Lys640Arg)
Pathogenicity Data:
Best Score: 0.908
Polyphen2: 0.031 (B)
Mutation Taster: 0.592
SIFT: 0.092 (T)
Frequency Data:
TOPMed: 0.0019%
ExAC EAS: 0.0463%
ExAC NFE: 0.0015%
gnomAD_E_EAS: 0.0406%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0065%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.535

Phenotype Score: 0.500

Variant Score: 0.896

Phenotype matches:
Proximity score 0.500 in interactome to HSPG2 and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with HSPG2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.500 in interactome to HSPG2 and phenotypic similarity 0.701 to mouse mutant of HSPG2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate
HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures
HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate
HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.535

Phenotype Score: 0.500

Variant Score: 0.896

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-180477292-G-A [0/1] rs769879741
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.899
Polyphen2: 0.770 (P)
SIFT: 0.101 (T)
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0116%

Exomiser Score: 0.521

Phenotype Score: 0.537

Variant Score: 0.849

Phenotype matches:
Phenotypic similarity 0.537 to X-linked intellectual disability, Siderius type associated with PHF8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001177, Preaxial hand polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001177, Preaxial hand polydactyly
HP:0010055, Broad hallux - HP:0001177, Preaxial hand polydactyly
Phenotypic similarity 0.307 to mouse mutant involving PHF8.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:300263 Intellectual developmental disorder, X-linked, syndromic, Siderius type - X-linked recessive
ORPHA:85287 X-linked intellectual disability, Siderius type - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.521

Phenotype Score: 0.537

Variant Score: 0.849

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.537 to ORPHA:85287 X-linked intellectual disability, Siderius type
Phenotypic similarity 0.530 to OMIM:300263 Intellectual developmental disorder, X-linked, syndromic, Siderius type
Variants contributing to score:
INFRAME_DELETION DEL X-54011404-TCTC-T [0/1] rs782435731
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0039%
gnomAD_E_FIN: 0.0064%
gnomAD_E_NFE: 0.0090%

X_DOMINANT

Exomiser Score: 0.020

Phenotype Score: 0.153

Variant Score: 0.849

No phenotype matches to diseases with this MOI.
Variants contributing to score:
INFRAME_DELETION DEL X-54011404-TCTC-T [0/1] rs782435731
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0039%
gnomAD_E_FIN: 0.0064%
gnomAD_E_NFE: 0.0090%

Exomiser Score: 0.521

Phenotype Score: 0.500

Variant Score: 0.890

Phenotype matches:
Phenotypic similarity 0.295 to Kallmann syndrome associated with ANOS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb -
HP:0010055, Broad hallux - HP:0001761, Pes cavus
Proximity score 0.500 in interactome to IDUA and phenotypic similarity 0.477 to Hurler syndrome associated with IDUA.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0100490, Camptodactyly of finger
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0100490, Camptodactyly of finger
Proximity score 0.500 in interactome to IDUA and phenotypic similarity 0.724 to mouse mutant of IDUA.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0000441, increased cranium width
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases:
OMIM:308700 Hypogonadotropic hypogonadism 1 with or without anosmia (Kallmann syndrome 1) - X-linked recessive
ORPHA:478 Kallmann syndrome - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.521

Phenotype Score: 0.500

Variant Score: 0.890

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.295 to ORPHA:478 Kallmann syndrome
Phenotypic similarity 0.274 to OMIM:308700 Hypogonadotropic hypogonadism 1 with or without anosmia (Kallmann syndrome 1)
Variants contributing to score:
MISSENSE_VARIANT SNV X-8504922-G-A [0/1] rs765611622
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.890 CONTRIBUTING VARIANT
Transcripts:
ANOS1:ENST00000262648.3:c.1511C>T:p.(Pro504Leu)
Pathogenicity Data:
Best Score: 0.93299997
Polyphen2: 0.005 (B)
SIFT: 0.067 (T)
Frequency Data:
1000Genomes: 0.0530%
TOPMed: 0.0140%
ExAC AMR: 0.0114%
ExAC EAS: 0.2718%
ExAC NFE: 0.0023%
ExAC SAS: 0.0459%
gnomAD_E_AMR: 0.0188%
gnomAD_E_EAS: 0.2339%
gnomAD_E_NFE: 0.0025%
gnomAD_E_SAS: 0.0476%
gnomAD_G_EAS: 0.2935%

Exomiser Score: 0.513

Phenotype Score: 0.500

Variant Score: 0.887

Phenotype matches:
Proximity score 0.500 in interactome to TONSL and phenotypic similarity 0.610 to SPONASTRIME dysplasia associated with TONSL.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0010234, Ivory epiphyses of the phalanges of the hand
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to TONSL and phenotypic similarity 0.244 to mouse mutant of TONSL.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to TONSL and phenotypic similarity 0.415 to fish mutant of TONSL.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0010247, ossification increased occurrence, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.513

Phenotype Score: 0.500

Variant Score: 0.887

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-124358981-C-T [0/1] rs1212047865
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.886801
Polyphen2: 0.001 (B)
Mutation Taster: 0.887
Frequency Data:
TOPMed: 0.0004%

TTN

Exomiser Score: 0.512

Phenotype Score: 0.434

Variant Score: 0.961

Phenotype matches:
Phenotypic similarity 0.434 to Autosomal recessive centronuclear myopathy associated with TTN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0100807, Long fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0100807, Long fingers
HP:0010055, Broad hallux - HP:0100807, Long fingers
Phenotypic similarity 0.332 to mouse mutant involving TTN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0010225, abnormal quadriceps morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0010225, abnormal quadriceps morphology
HP:0010055, Broad hallux - MP:0010225, abnormal quadriceps morphology
Known diseases:
OMIM:600334 Tibial muscular dystrophy, tardive - autosomal dominant
OMIM:603689 Myopathy, myofibrillar, 9, with early respiratory failure - autosomal dominant
OMIM:604145 Cardiomyopathy, dilated, 1G - autosomal dominant
OMIM:608807 Muscular dystrophy, limb-girdle, autosomal recessive 10 - autosomal recessive
OMIM:611705 Salih myopathy - autosomal recessive
OMIM:613765 Cardiomyopathy, familial hypertrophic, 9 - autosomal dominant
ORPHA:154 Familial isolated dilated cardiomyopathy - autosomal dominant
ORPHA:169186 Autosomal recessive centronuclear myopathy - autosomal recessive
ORPHA:178464 Hereditary myopathy with early respiratory failure - autosomal dominant
ORPHA:324604 Classic multiminicore myopathy - unknown
ORPHA:609 Tibial muscular dystrophy - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.512

Phenotype Score: 0.434

Variant Score: 0.961

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.434 to ORPHA:169186 Autosomal recessive centronuclear myopathy
Variants contributing to score:
MISSENSE_VARIANT SNV 2-179399634-C-T [0/1] rs72629782
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0091%
UK10K: 0.0132%
ExAC AFR: 0.0103%
ExAC EAS: 0.1759%
ExAC FIN: 0.0606%
ExAC NFE: 0.0075%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0066%
gnomAD_E_EAS: 0.1916%
gnomAD_E_FIN: 0.0767%
gnomAD_E_NFE: 0.0072%
gnomAD_E_SAS: 0.0033%
gnomAD_G_AFR: 0.0114%
gnomAD_G_EAS: 0.1870%
gnomAD_G_FIN: 0.0859%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 2-179640551-T-C [0/1] rs180672509
Exomiser ACMG: LIKELY_BENIGN [BP4, BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 0.979328
Polyphen2: 0.741 (P)
Mutation Taster: 0.979 (P)
SIFT: 0.176 (T)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0053%
ExAC EAS: 0.1850%
gnomAD_E_EAS: 0.1913%
gnomAD_G_EAS: 0.1856%
Other passed variants:
MISSENSE_VARIANT SNV 2-179583077-A-C [0/1] rs764248656
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
Best Score: 0.999995
Polyphen2: 0.287 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.934 (T)
Frequency Data:
TOPMed: 0.0129%
ExAC EAS: 0.1857%
gnomAD_E_EAS: 0.1914%
gnomAD_E_SAS: 0.0033%
gnomAD_G_EAS: 0.3141%
MISSENSE_VARIANT SNV 2-179650715-C-T [0/1] rs144639994
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
Best Score: 0.10699999
Polyphen2: 0.001 (B)
SIFT: 0.893 (T)
Frequency Data:
1000Genomes: 0.1198%
TOPMed: 0.0279%
ExAC EAS: 0.3722%
ExAC NFE: 0.0045%
ExAC SAS: 0.0545%
gnomAD_E_EAS: 0.3951%
gnomAD_E_FIN: 0.0045%
gnomAD_E_NFE: 0.0072%
gnomAD_E_OTH: 0.0182%
gnomAD_E_SAS: 0.0520%
gnomAD_G_EAS: 0.3086%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.512

Phenotype Score: 0.517

Variant Score: 0.867

Phenotype matches:
Proximity score 0.517 in interactome to CHST11 and phenotypic similarity 0.832 to ?Osteochondrodysplasia, brachydactyly, and overlapping malformed digits associated with CHST11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009778, Short thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.517 in interactome to CHST11 and phenotypic similarity 0.716 to mouse mutant of CHST11.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0000440, domed cranium
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005109, abnormal talus morphology
Known diseases:
OMIM:143200 Wagner syndrome 1 - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.512

Phenotype Score: 0.517

Variant Score: 0.867

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-82815395-C-T [0/1] rs775405712
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.875
Polyphen2: 0.028 (B)
SIFT: 0.125 (T)
Frequency Data:
TOPMed: 0.0011%
ExAC EAS: 0.0231%
ExAC NFE: 0.0015%
gnomAD_E_EAS: 0.0174%
gnomAD_E_NFE: 0.0009%
gnomAD_G_EAS: 0.0617%

AR

Exomiser Score: 0.482

Phenotype Score: 0.520

Variant Score: 0.850

Phenotype matches:
Proximity score 0.520 in interactome to ZMIZ1 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with ZMIZ1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Known diseases:
OMIM:176807 Prostate cancer, susceptibility to (susceptibility)
OMIM:300068 Androgen insensitivity - X-linked recessive
OMIM:300633 Hypospadias 1, X-linked - X-linked recessive
OMIM:312300 Androgen insensitivity, partial, with or without breast cancer - X-linked recessive
OMIM:313200 Spinal and bulbar muscular atrophy of Kennedy - X-linked recessive
ORPHA:481 Kennedy disease - X-linked recessive
ORPHA:90797 Partial androgen insensitivity syndrome - X-linked recessive
ORPHA:95706 Non-syndromic posterior hypospadias - X-linked recessive
ORPHA:99429 Complete androgen insensitivity syndrome - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.482

Phenotype Score: 0.520

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS X-66765158-T-TGCAGCAGCAGCAGCAGCA [0/1] rs3032358
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

X_DOMINANT

Exomiser Score: 0.059

Phenotype Score: 0.260

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS X-66765158-T-TGCAGCAGCAGCAGCAGCA [0/1] rs3032358
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.462

Phenotype Score: 0.513

Variant Score: 0.850

Phenotype matches:
Phenotypic similarity 0.513 to Congenital hypotonia, epilepsy, developmental delay, and digital anomalies associated with ATN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0010557, Overlapping fingers
HP:0010055, Broad hallux - HP:0001845, Overlapping toe
Phenotypic similarity 0.297 to mouse mutant involving ATN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.502 in interactome to RERE and phenotypic similarity 0.667 to 1p36 deletion syndrome associated with RERE.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.502 in interactome to RERE and phenotypic similarity 0.280 to mouse mutant of RERE.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003425, abnormal optic vesicle formation
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.502 in interactome to RERE and phenotypic similarity 0.285 to fish mutant of RERE.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0001963, Meckel's cartilage sloped downward, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:125370 Dentatorubral-pallidoluysian atrophy - autosomal dominant
OMIM:618494 Congenital hypotonia, epilepsy, developmental delay, and digital anomalies - autosomal dominant
ORPHA:101 Dentatorubral pallidoluysian atrophy - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.462

Phenotype Score: 0.513

Variant Score: 0.850

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.513 to OMIM:618494 Congenital hypotonia, epilepsy, developmental delay, and digital anomalies
Variants contributing to score:
DISRUPTIVE_INFRAME_DELETION DEL 12-7045891-ACAGCAGCAGCAGCAG-A [-/1] rs60216939
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: LIKELY_BENIGN (no assertion criteria provided)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.054

Phenotype Score: 0.251

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_DELETION DEL 12-7045891-ACAGCAGCAG-A [-/1] rs60216939
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
DISRUPTIVE_INFRAME_DELETION DEL 12-7045891-ACAGCAGCAGCAGCAG-A [-/1] rs60216939
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: LIKELY_BENIGN (no assertion criteria provided)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.443

Phenotype Score: 0.772

Variant Score: 0.548

Phenotype matches:
Phenotypic similarity 0.772 to Weill-Marchesani syndrome 1, recessive associated with ADAMTS10.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002682, Broad skull
HP:0011304, Broad thumb - HP:0009768, Broad phalanges of the hand
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Phenotypic similarity 0.512 to mouse mutant involving ADAMTS10.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003055, abnormal long bone epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0014176, abnormal cilary zonule morphology
HP:0011304, Broad thumb - MP:0003055, abnormal long bone epiphyseal plate morphology
HP:0010055, Broad hallux - MP:0003055, abnormal long bone epiphyseal plate morphology
Proximity score 0.506 in interactome to FBN1 and phenotypic similarity 0.750 to Weill-Marchesani syndrome 2, dominant associated with FBN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002682, Broad skull
HP:0011304, Broad thumb - HP:0009768, Broad phalanges of the hand
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.506 in interactome to FBN1 and phenotypic similarity 0.683 to mouse mutant of FBN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004634, short metacarpal bones
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002543, brachyphalangia
HP:0010055, Broad hallux - MP:0004634, short metacarpal bones
Known diseases:
OMIM:277600 Weill-Marchesani syndrome 1, recessive - autosomal recessive
ORPHA:3449 Weill-Marchesani syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.443

Phenotype Score: 0.772

Variant Score: 0.548

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.772 to OMIM:277600 Weill-Marchesani syndrome 1, recessive
Phenotypic similarity 0.691 to ORPHA:3449 Weill-Marchesani syndrome
Variants contributing to score:
MISSENSE_VARIANT SNV 19-8666020-G-A [0/1] rs572980571
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP4]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.328 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0011%
ExAC EAS: 0.0118%
ExAC SAS: 0.0122%
gnomAD_E_AFR: 0.0068%
gnomAD_E_EAS: 0.0349%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0065%
SYNONYMOUS_VARIANT SNV 19-8651770-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.185

Phenotype Score: 0.256

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-8666020-G-A [0/1] rs572980571
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.328 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0011%
ExAC EAS: 0.0118%
ExAC SAS: 0.0122%
gnomAD_E_AFR: 0.0068%
gnomAD_E_EAS: 0.0349%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0065%

Exomiser Score: 0.432

Phenotype Score: 0.500

Variant Score: 0.851

Phenotype matches:
Proximity score 0.500 in interactome to MAP3K20 and phenotypic similarity 0.382 to Split-foot malformation with mesoaxial polydactyly associated with MAP3K20.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0012725, Cutaneous syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0012725, Cutaneous syndactyly
HP:0010055, Broad hallux - HP:0012725, Cutaneous syndactyly
Proximity score 0.500 in interactome to MAP3K20 and phenotypic similarity 0.723 to mouse mutant of MAP3K20.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.432

Phenotype Score: 0.500

Variant Score: 0.851

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-27684067-C-G [0/1] rs1222017421
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.851
Polyphen2: 0.020 (B)
SIFT: 0.149 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.431

Phenotype Score: 0.501

Variant Score: 0.850

Phenotype matches:
Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.665 to Okur-Chung neurodevelopmental syndrome associated with CSNK2A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0030084, Clinodactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.535 to mouse mutant of CSNK2A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology
HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape
HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology
HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.431

Phenotype Score: 0.501

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 16-30670916-G-GCCGAGA [0/1] rs2052428844
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.850 CONTRIBUTING VARIANT
Transcripts:
FBRS:ENST00000356166.6:c.87_92dup:p.(Asp30_Arg31dup)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

DMD

Exomiser Score: 0.408

Phenotype Score: 0.541

Variant Score: 0.794

Phenotype matches:
Phenotypic similarity 0.541 to X-linked non-syndromic intellectual disability associated with DMD.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Phenotypic similarity 0.306 to mouse mutant involving DMD.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0010227, decreased quadriceps weight
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0010227, decreased quadriceps weight
HP:0010055, Broad hallux - MP:0010227, decreased quadriceps weight
Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification
HP:0011304, Broad thumb - MP:0004351, short humerus
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
Known diseases:
OMIM:300376 Becker muscular dystrophy - X-linked recessive
OMIM:302045 Cardiomyopathy, dilated, 3B - X-linked
OMIM:310200 Duchenne muscular dystrophy - X-linked recessive
ORPHA:154 Familial isolated dilated cardiomyopathy - X-linked
ORPHA:777 X-linked non-syndromic intellectual disability - X-linked recessive
ORPHA:98895 Becker muscular dystrophy - X-linked recessive
ORPHA:98896 Duchenne muscular dystrophy - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.408

Phenotype Score: 0.541

Variant Score: 0.794

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to ORPHA:777 X-linked non-syndromic intellectual disability
Phenotypic similarity 0.274 to ORPHA:98895 Becker muscular dystrophy
Phenotypic similarity 0.175 to ORPHA:154 Familial isolated dilated cardiomyopathy
Variants contributing to score:
MISSENSE_VARIANT SNV X-32563348-G-C [0/1] rs202008454
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
Best Score: 0.955
Polyphen2: 0.551 (P)
SIFT: 0.045 (D)
Frequency Data:
1000Genomes: 0.0530%
TOPMed: 0.0366%
ExAC EAS: 0.7258%
ExAC OTH: 0.1590%
ExAC SAS: 0.0299%
gnomAD_E_EAS: 0.8089%
gnomAD_E_OTH: 0.0248%
gnomAD_E_SAS: 0.0418%
gnomAD_G_EAS: 0.6849%

Exomiser Score: 0.375

Phenotype Score: 0.347

Variant Score: 0.998

Phenotype matches:
Phenotypic similarity 0.347 to mouse mutant involving NOS2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.375

Phenotype Score: 0.347

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT SNV 17-26087772-T-G [0/1] rs1337800290
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.998 CONTRIBUTING VARIANT
Transcripts:
NOS2:ENST00000313735.6:c.2889-2A>C:p.?
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
gnomAD_G_NFE: 0.0134%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.258

Phenotype Score: 0.347

Variant Score: 0.939

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT SNV 17-26087772-T-G [0/1] rs1337800290
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.998 CONTRIBUTING VARIANT
Transcripts:
NOS2:ENST00000313735.6:c.2889-2A>C:p.?
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
gnomAD_G_NFE: 0.0134%
MISSENSE_VARIANT SNV 17-26087768-G-A [0/1] rs1258316978
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.879 CONTRIBUTING VARIANT
Transcripts:
NOS2:ENST00000313735.6:c.2891C>T:p.(Ala964Val)
Pathogenicity Data:
Best Score: 0.88
Polyphen2: 0.006 (B)
Mutation Taster: 0.587
SIFT: 0.120 (T)
Frequency Data:
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.372

Phenotype Score: 0.506

Variant Score: 0.817

Phenotype matches:
Proximity score 0.506 in interactome to SH3PXD2B and phenotypic similarity 0.653 to Frank-Ter Haar syndrome associated with SH3PXD2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.506 in interactome to SH3PXD2B and phenotypic similarity 0.694 to mouse mutant of SH3PXD2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0030853, abnormal iliac crest morphology
HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology
HP:0011304, Broad thumb - MP:0000159, abnormal xiphoid process morphology
HP:0010055, Broad hallux - MP:0030853, abnormal iliac crest morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.372

Phenotype Score: 0.506

Variant Score: 0.817

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-40558517-G-T [0/1] rs781727329
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.827
Polyphen2: 0.002 (B)
SIFT: 0.173 (T)
Frequency Data:
TOPMed: 0.0023%
ExAC EAS: 0.0841%
gnomAD_E_EAS: 0.0584%

Exomiser Score: 0.364

Phenotype Score: 0.518

Variant Score: 0.800

Phenotype matches:
Proximity score 0.518 in interactome to NABP2 and phenotypic similarity 0.692 to mouse mutant of NABP2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000565, oligodactyly
HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology
HP:0011304, Broad thumb - MP:0000565, oligodactyly
HP:0010055, Broad hallux - MP:0000565, oligodactyly
Known diseases:
ORPHA:520 Acute promyelocytic leukemia (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.364

Phenotype Score: 0.518

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 2-192543129-CT-C [0/1] rs781513296
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
NABP1:ENST00000409510.1:c.-150+8del:p.(=)
NABP1:ENST00000410026.2:c.-150+163del:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

RGR

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.303 to mouse mutant involving RGR.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005253, abnormal eye physiology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.511 in interactome to RDH10 and phenotypic similarity 0.880 to mouse mutant of RDH10.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0001286, abnormal eye development
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
Known diseases:
OMIM:613769 Retinitis pigmentosa 44 - autosomal dominant/recessive
ORPHA:791 Retinitis pigmentosa - autosomal dominant/recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 10-86012608-T-G [0/1] rs1213129665
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
RGR:ENST00000358110.5:c.359-5T>G:p.?
RGR:ENST00000359452.4:c.371-5T>G:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

Phenotype matches:
Proximity score 0.511 in interactome to EVX2 and phenotypic similarity 0.952 to mouse mutant of EVX2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002543, brachyphalangia
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Known diseases:
OMIM:201400 Adrenocorticotropic hormone deficiency - autosomal recessive
ORPHA:199296 Congenital isolated ACTH deficiency - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.348

Phenotype Score: 0.511

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 1-168262522-A-AGTGTGTGT [1/1] rs57039241
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
TBX19:ENST00000367821.3:c.603+6_603+7insGTGTGTGT:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.332

Phenotype Score: 0.512

Variant Score: 0.791

Phenotype matches:
Proximity score 0.512 in interactome to ZC3H8 and phenotypic similarity 0.755 to mouse mutant of ZC3H8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.332

Phenotype Score: 0.512

Variant Score: 0.791

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV X-100093220-C-G [0/1] rs200116124
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.791 CONTRIBUTING VARIANT
Transcripts:
CSTF2:ENST00000372972.2:c.1612-8C>G:p.?
CSTF2:ENST00000415585.2:c.1672-8C>G:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0530%
TOPMed: 0.0042%
ExAC EAS: 0.0754%
gnomAD_E_EAS: 0.0762%

X_DOMINANT

Exomiser Score: 0.332

Phenotype Score: 0.512

Variant Score: 0.791

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV X-100093220-C-G [0/1] rs200116124
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.791 CONTRIBUTING VARIANT
Transcripts:
CSTF2:ENST00000372972.2:c.1612-8C>G:p.?
CSTF2:ENST00000415585.2:c.1672-8C>G:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0530%
TOPMed: 0.0042%
ExAC EAS: 0.0754%
gnomAD_E_EAS: 0.0762%

Exomiser Score: 0.331

Phenotype Score: 0.512

Variant Score: 0.791

Phenotype matches:
Proximity score 0.512 in interactome to DISP1 and phenotypic similarity 0.681 to Holoprosencephaly associated with DISP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0005469, Flat occiput
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.512 in interactome to DISP1 and phenotypic similarity 0.568 to mouse mutant of DISP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000550, abnormal forelimb morphology
HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape
HP:0011304, Broad thumb - MP:0000550, abnormal forelimb morphology
HP:0010055, Broad hallux - MP:0000550, abnormal forelimb morphology
Proximity score 0.512 in interactome to DISP1 and phenotypic similarity 0.308 to fish mutant of DISP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0005403, joint mandibular arch skeleton malformed, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.331

Phenotype Score: 0.512

Variant Score: 0.791

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-99769449-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.791 CONTRIBUTING VARIANT
Transcripts:
GPC2:ENST00000292377.2:c.1123G>A:p.(Glu375Lys)
Pathogenicity Data:
Best Score: 0.791
Polyphen2: 0.264 (B)
SIFT: 0.209 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.331

Phenotype Score: 0.504

Variant Score: 0.800

Phenotype matches:
Proximity score 0.504 in interactome to EFNB1 and phenotypic similarity 0.807 to Craniofrontonasal dysplasia associated with EFNB1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0004440, Coronal craniosynostosis
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.504 in interactome to EFNB1 and phenotypic similarity 0.765 to mouse mutant of EFNB1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0004378, frontal bone foramen
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.331

Phenotype Score: 0.504

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 7-142560576-G-GA [0/1] rs1346772225
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
EPHB6:ENST00000392957.2:c.-104dup:p.(=)
EPHB6:ENST00000442129.1:c.-100dup:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.331

Phenotype Score: 0.505

Variant Score: 0.799

Phenotype matches:
Proximity score 0.505 in interactome to ADK and phenotypic similarity 0.393 to Hypermethioninemia due to adenosine kinase deficiency associated with ADK.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001786, Narrow foot
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0001786, Narrow foot
HP:0010055, Broad hallux - HP:0001786, Narrow foot
Proximity score 0.505 in interactome to ADK and phenotypic similarity 0.755 to mouse mutant of ADK.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases:
OMIM:619150 Intellectual developmental disorder with paroxysmal dyskinesia or seizures - autosomal recessive
ORPHA:31709 Infantile convulsions and choreoathetosis - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.331

Phenotype Score: 0.505

Variant Score: 0.799

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 11-72292403-G-A [0/1] rs200284582
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC NFE: 0.0016%
gnomAD_E_AMR: 0.0030%
gnomAD_E_NFE: 0.0046%

Exomiser Score: 0.330

Phenotype Score: 0.503

Variant Score: 0.800

Phenotype matches:
Proximity score 0.503 in interactome to PDE6D and phenotypic similarity 0.703 to Orofaciodigital syndrome type 6 associated with PDE6D.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.503 in interactome to PDE6D and phenotypic similarity 0.343 to mouse mutant of PDE6D.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004022, abnormal cone electrophysiology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:606703 Dyskinesia, familial, with facial myokymia - autosomal dominant
ORPHA:1429 Benign hereditary chorea - autosomal dominant
ORPHA:324588 Familial dyskinesia and facial myokymia - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.330

Phenotype Score: 0.503

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 3-123038669-G-A [0/1] rs1941120792
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.329

Phenotype Score: 0.340

Variant Score: 0.984

Phenotype matches:
Phenotypic similarity 0.340 to mouse mutant involving RP1L1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004022, abnormal cone electrophysiology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:613587 Occult macular dystrophy - autosomal dominant
OMIM:618826 Retinitis pigmentosa 88 - autosomal recessive
ORPHA:791 Retinitis pigmentosa - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.329

Phenotype Score: 0.340

Variant Score: 0.984

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-10480644-C-G [0/1] rs777820137
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.984 CONTRIBUTING VARIANT
Transcripts:
RP1L1:ENST00000382483.3:c.68G>C:p.(Arg23Pro)
Pathogenicity Data:
Best Score: 0.994
SIFT: 0.006 (D)
Frequency Data:
gnomAD_E_AFR: 0.0696%
gnomAD_E_FIN: 0.0515%
gnomAD_E_NFE: 0.0700%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.227

Phenotype Score: 0.340

Variant Score: 0.929

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 8-10480644-C-G [0/1] rs777820137
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.984 CONTRIBUTING VARIANT
Transcripts:
RP1L1:ENST00000382483.3:c.68G>C:p.(Arg23Pro)
Pathogenicity Data:
Best Score: 0.994
SIFT: 0.006 (D)
Frequency Data:
gnomAD_E_AFR: 0.0696%
gnomAD_E_FIN: 0.0515%
gnomAD_E_NFE: 0.0700%
MISSENSE_VARIANT SNV 8-10467637-T-C [0/1] rs4240659
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Variant score: 0.873 CONTRIBUTING VARIANT
Transcripts:
RP1L1:ENST00000382483.3:c.3971A>G:p.(Glu1324Gly)
Pathogenicity Data:
Best Score: 0.873
SIFT: 0.127 (T)
Frequency Data:
No frequency data
Other passed variants:
DISRUPTIVE_INFRAME_INSERTION INS 8-10467589-T-TCCTCTAACTGCACCCTCTCTTCTTGCAGCCCTTCTATTACTTTAGTCC [-/1] rs1585963467
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

CGN

Exomiser Score: 0.328

Phenotype Score: 0.503

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.307 to mouse mutant involving CGN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002111, abnormal tail morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002111, abnormal tail morphology
HP:0010055, Broad hallux - MP:0002111, abnormal tail morphology
Proximity score 0.503 in interactome to TGFBR1 and phenotypic similarity 0.749 to Loeys-Dietz syndrome 1 associated with TGFBR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0001166, Arachnodactyly
Proximity score 0.503 in interactome to TGFBR1 and phenotypic similarity 0.952 to mouse mutant of TGFBR1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.328

Phenotype Score: 0.503

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 1-151501822-C-T [0/1] rs1664773807
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
CGN:ENST00000271636.7:c.1897-4C>T:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.326

Phenotype Score: 0.502

Variant Score: 0.800

Phenotype matches:
Proximity score 0.502 in interactome to BMS1 and phenotypic similarity 0.602 to Aplasia cutis congenita associated with BMS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.502 in interactome to BMS1 and phenotypic similarity 0.299 to mouse mutant of BMS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.326

Phenotype Score: 0.502

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 12-75900396-C-CA [0/1] rs35071517
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

Phenotype matches:
Proximity score 0.501 in interactome to NOS3 and phenotypic similarity 0.712 to mouse mutant of NOS3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 15-69334995-T-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.245 to mouse mutant involving SEC63.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0010124, decreased bone mineral content
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.665 to Okur-Chung neurodevelopmental syndrome associated with CSNK2A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0030084, Clinodactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.501 in interactome to CSNK2A1 and phenotypic similarity 0.535 to mouse mutant of CSNK2A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology
HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape
HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology
HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology
Known diseases:
OMIM:617004 Polycystic liver disease 2 - autosomal dominant
ORPHA:2924 Isolated polycystic liver disease - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.324

Phenotype Score: 0.501

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 6-108197874-C-CAAA [0/1] rs749125299
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
SEC63:ENST00000369002.4:c.1936-9_1936-8insTTT:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.324

Phenotype Score: 0.506

Variant Score: 0.794

Phenotype matches:
Proximity score 0.506 in interactome to EPB41L1 and phenotypic similarity 0.684 to ?Intellectual developmental disorder, autosomal dominant 11 associated with EPB41L1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.506 in interactome to EPB41L1 and phenotypic similarity 0.294 to mouse mutant of EPB41L1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001340, abnormal eyelid morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.324

Phenotype Score: 0.506

Variant Score: 0.794

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 11-64490434-CCA-C [0/1] rs1189888724
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.0517%
gnomAD_G_NFE: 0.0235%

GPT

Exomiser Score: 0.323

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:
Proximity score 0.500 in interactome to PIGK and phenotypic similarity 0.660 to Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures associated with PIGK.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.323

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 8-145730879-T-TGCCC [0/1] rs1826753684
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.303 to mouse mutant involving EYA3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to MEIS2 and phenotypic similarity 0.856 to Cleft palate, cardiac defects, and mental retardation associated with MEIS2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009237, Short 5th finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.500 in interactome to MEIS2 and phenotypic similarity 0.299 to mouse mutant of MEIS2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 1-28337454-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:
Proximity score 0.500 in interactome to COL11A2 and phenotypic similarity 0.660 to Fibrochondrogenesis associated with COL11A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0000885, Broad ribs
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to COL11A2 and phenotypic similarity 0.502 to mouse mutant of COL11A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate
HP:0001363, Craniosynostosis - MP:0030049, prominent forehead
HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate
HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate
Proximity score 0.500 in interactome to COL11A2 and phenotypic similarity 0.447 to fish mutant of COL11A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0000119, endochondral ossification disrupted, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 13-21361194-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
XPO4:ENST00000255305.6:c.3168G>A:p.(=)
XPO4:ENST00000400602.2:c.3168G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

Phenotype matches:
Proximity score 0.500 in interactome to TELO2 and phenotypic similarity 0.650 to TELO2-related intellectual disability-neurodevelopmental disorder associated with TELO2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0004692, 4-5 toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.322

Phenotype Score: 0.500

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 5-146752857-T-C [0/1] rs1394522288
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
STK32A:ENST00000397936.3:c.903T>C:p.(=)
STK32A:ENST00000398523.3:c.903T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.319

Phenotype Score: 0.500

Variant Score: 0.798

Phenotype matches:
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput
HP:0011304, Broad thumb - HP:0010557, Overlapping fingers
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.319

Phenotype Score: 0.500

Variant Score: 0.798

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 1-26013026-C-T [0/1] rs769609026
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.798 CONTRIBUTING VARIANT
Transcripts:
MAN1C1:ENST00000263979.3:c.96C>T:p.(=)
MAN1C1:ENST00000374332.4:c.636C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0030%
ExAC AMR: 0.0173%
ExAC NFE: 0.0030%
gnomAD_E_AMR: 0.0149%
gnomAD_E_NFE: 0.0045%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.316

Phenotype Score: 0.500

Variant Score: 0.797

Phenotype matches:
Proximity score 0.500 in interactome to EXOC8 and phenotypic similarity 0.635 to ?Neurodevelopmental disorder with microcephaly, seizures, and brain atrophy associated with EXOC8.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.316

Phenotype Score: 0.500

Variant Score: 0.797

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 17-43480072-C-T [0/1] rs745879917
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0038%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0018%
gnomAD_G_FIN: 0.0286%

Exomiser Score: 0.309

Phenotype Score: 0.500

Variant Score: 0.793

Phenotype matches:
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput
HP:0011304, Broad thumb - HP:0010557, Overlapping fingers
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.309

Phenotype Score: 0.500

Variant Score: 0.793

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 20-34145191-C-T [0/1] rs746387753
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ExAC EAS: 0.0347%
gnomAD_E_EAS: 0.0232%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.303

Phenotype Score: 0.501

Variant Score: 0.789

Phenotype matches:
Phenotypic similarity 0.288 to mouse mutant involving NRG1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001322, abnormal iris morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to EVX2 and phenotypic similarity 0.952 to mouse mutant of EVX2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002543, brachyphalangia
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.303

Phenotype Score: 0.501

Variant Score: 0.789

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 8-32620883-G-C [0/1] rs751248065
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0026%
ExAC EAS: 0.0927%
gnomAD_E_EAS: 0.0871%
gnomAD_G_EAS: 0.0618%

Exomiser Score: 0.302

Phenotype Score: 0.504

Variant Score: 0.786

Phenotype matches:
Phenotypic similarity 0.332 to Aromatase deficiency associated with CYP19A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002857, Genu valgum
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0002857, Genu valgum
HP:0010055, Broad hallux - HP:0002857, Genu valgum
Phenotypic similarity 0.352 to mouse mutant involving CYP19A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to SC5D and phenotypic similarity 0.646 to Lathosterolosis associated with SC5D.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.504 in interactome to SC5D and phenotypic similarity 0.731 to mouse mutant of SC5D.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis - MP:0002639, micrognathia
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
Known diseases:
OMIM:139300 Aromatase excess syndrome - autosomal dominant
OMIM:613546 Aromatase deficiency - autosomal recessive
ORPHA:91 Aromatase deficiency - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.302

Phenotype Score: 0.504

Variant Score: 0.786

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-51514597-G-A [0/1] rs761722363
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.78617
Polyphen2: 0.001 (B)
Mutation Taster: 0.786
SIFT: 0.252 (T)
Frequency Data:
TOPMed: 0.0011%
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0018%

Exomiser Score: 0.301

Phenotype Score: 0.314

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.314 to mouse mutant involving ZSCAN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.301

Phenotype Score: 0.314

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-85164121-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.094 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.226 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.288

Phenotype Score: 0.315

Variant Score: 0.991

Phenotype matches:
Phenotypic similarity 0.464 to Arthrogryposis multiplex congenita 3, myogenic type associated with SYNE1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001181, Adducted thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0001181, Adducted thumb
Phenotypic similarity 0.305 to mouse mutant involving SYNE1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009434, paraparesis
HP:0001363, Craniosynostosis - MP:0001852, conjunctivitis
HP:0011304, Broad thumb - MP:0009434, paraparesis
HP:0010055, Broad hallux - MP:0009434, paraparesis
Known diseases:
OMIM:610743 Spinocerebellar ataxia, autosomal recessive 8 - autosomal recessive
OMIM:612998 Emery-Dreifuss muscular dystrophy 4, autosomal dominant - autosomal dominant
OMIM:618484 Arthrogryposis multiplex congenita 3, myogenic type - autosomal recessive
ORPHA:88644 Autosomal recessive ataxia, Beauce type - autosomal recessive
ORPHA:98853 Autosomal dominant Emery-Dreifuss muscular dystrophy - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.288

Phenotype Score: 0.315

Variant Score: 0.991

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.315 to ORPHA:98853 Autosomal dominant Emery-Dreifuss muscular dystrophy
Variants contributing to score:
MISSENSE_VARIANT SNV 6-152651397-G-A [0/1] rs373040273
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.999954
Polyphen2: 0.074 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.041 (D)
Frequency Data:
TOPMed: 0.0135%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC AMR: 0.0086%
ExAC EAS: 0.0347%
ExAC NFE: 0.0060%
ExAC SAS: 0.0061%
gnomAD_E_AMR: 0.0060%
gnomAD_E_EAS: 0.0464%
gnomAD_E_NFE: 0.0063%
gnomAD_E_SAS: 0.0032%
gnomAD_G_EAS: 0.0617%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.285

Phenotype Score: 0.501

Variant Score: 0.780

Phenotype matches:
Proximity score 0.501 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput
HP:0011304, Broad thumb - HP:0010557, Overlapping fingers
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.501 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.285

Phenotype Score: 0.501

Variant Score: 0.780

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-91452720-A-C [0/1] rs184915505
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.002 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.110 (T)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0143%
ExAC EAS: 0.1041%
gnomAD_E_EAS: 0.1160%
gnomAD_G_EAS: 0.0617%
MISSENSE_VARIANT SNV 15-91462950-C-T [0/1] rs182134455
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999988
Polyphen2: 0.006 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.274 (T)
Frequency Data:
1000Genomes: 0.3395%
TOPMed: 0.0521%
ExAC EAS: 1.2133%
ExAC NFE: 0.0030%
gnomAD_E_EAS: 1.2757%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0182%
gnomAD_E_SAS: 0.0032%
gnomAD_G_EAS: 1.4180%

Exomiser Score: 0.282

Phenotype Score: 0.504

Variant Score: 0.775

Phenotype matches:
Phenotypic similarity 0.275 to mouse mutant involving RGPD4.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004021, abnormal rod electrophysiology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to GRIP1 and phenotypic similarity 0.584 to Fraser syndrome associated with GRIP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.504 in interactome to GRIP1 and phenotypic similarity 0.757 to mouse mutant of GRIP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.282

Phenotype Score: 0.504

Variant Score: 0.775

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-108479427-G-A [0/1] rs746041708
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.778
Polyphen2: 0.000 (B)
SIFT: 0.222 (T)
Frequency Data:
gnomAD_E_EAS: 0.0295%
gnomAD_E_FIN: 0.0045%
gnomAD_E_NFE: 0.0028%
gnomAD_E_OTH: 0.0187%
gnomAD_E_SAS: 0.0177%
gnomAD_G_NFE: 0.0153%

Exomiser Score: 0.262

Phenotype Score: 0.295

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.295 to mouse mutant involving GBP3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.262

Phenotype Score: 0.295

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 1-89480231-A-AGG [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
GBP3:ENST00000370481.4:c.426_427insCC:p.(Tyr143Profs*4)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.124

Phenotype Score: 0.295

Variant Score: 0.900

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 1-89480231-A-AGG [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
GBP3:ENST00000370481.4:c.426_427insCC:p.(Tyr143Profs*4)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 1-89480232-C-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
GBP3:ENST00000370481.4:c.426G>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.253

Phenotype Score: 0.294

Variant Score: 0.996

Phenotype matches:
Phenotypic similarity 0.294 to mouse mutant involving TMEM145.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001304, cataract
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.253

Phenotype Score: 0.294

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-42827820-C-G [0/1] rs772304118
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.996 CONTRIBUTING VARIANT
Transcripts:
TMEM145:ENST00000301204.3:c.1280C>G:p.(Pro427Arg)
Pathogenicity Data:
Best Score: 0.997535
Polyphen2: 0.675 (P)
Mutation Taster: 0.998 (P)
SIFT: 0.428 (T)
Frequency Data:
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.249

Phenotype Score: 0.314

Variant Score: 0.972

Phenotype matches:
Phenotypic similarity 0.314 to mouse mutant involving GOLGA8T.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.249

Phenotype Score: 0.314

Variant Score: 0.972

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-32688688-G-C [0/1] rs1440004475
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.972 CONTRIBUTING VARIANT
Transcripts:
GOLGA8K:ENST00000512626.2:c.931C>G:p.(Leu311Val)
Pathogenicity Data:
Best Score: 0.976
Mutation Taster: 0.506
SIFT: 0.024 (D)
Frequency Data:
gnomAD_G_FIN: 0.0306%
gnomAD_G_NFE: 0.0081%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.005

Phenotype Score: 0.314

Variant Score: 0.521

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-32688688-G-C [0/1] rs1440004475
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.972 CONTRIBUTING VARIANT
Transcripts:
GOLGA8K:ENST00000512626.2:c.931C>G:p.(Leu311Val)
Pathogenicity Data:
Best Score: 0.976
Mutation Taster: 0.506
SIFT: 0.024 (D)
Frequency Data:
gnomAD_G_FIN: 0.0306%
gnomAD_G_NFE: 0.0081%
SYNONYMOUS_VARIANT SNV 15-32685337-G-A [0/1] rs1186711865
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.070 CONTRIBUTING VARIANT
Transcripts:
GOLGA8K:ENST00000512626.2:c.1623C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 1.1773%
gnomAD_G_AMR: 0.7788%
gnomAD_G_EAS: 0.5426%
gnomAD_G_FIN: 0.4038%
gnomAD_G_NFE: 0.5090%
gnomAD_G_OTH: 0.4087%

Exomiser Score: 0.223

Phenotype Score: 0.275

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.275 to mouse mutant involving C11orf54.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0011960, abnormal eye anterior chamber depth
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.223

Phenotype Score: 0.275

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT SNV 11-93494680-G-A [0/1] rs1196671772
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.196

Phenotype Score: 0.500

Variant Score: 0.727

Phenotype matches:
Proximity score 0.500 in interactome to GRHL2 and phenotypic similarity 0.347 to Ectodermal dysplasia/short stature syndrome associated with GRHL2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0008404, Nail dystrophy
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0008404, Nail dystrophy
HP:0010055, Broad hallux - HP:0008404, Nail dystrophy
Proximity score 0.500 in interactome to GRHL2 and phenotypic similarity 0.756 to mouse mutant of GRHL2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.196

Phenotype Score: 0.500

Variant Score: 0.727

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 21-33691626-C-T [0/1] rs1287941853
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.727 CONTRIBUTING VARIANT
Transcripts:
URB1:ENST00000382751.3:c.5693G>A:p.(Arg1898His)
Pathogenicity Data:
Best Score: 0.728
Polyphen2: 0.000 (B)
SIFT: 0.272 (T)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_AMR: 0.0042%
gnomAD_E_NFE: 0.0035%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.667 to 1p36 deletion syndrome associated with KCNAB2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Proximity score 0.505 in interactome to KCNH1 and phenotypic similarity 0.856 to Temple-Baraitser syndrome associated with KCNH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Known diseases - observed variants incompatible with mode of inheritance:
ORPHA:1606 1p36 deletion syndrome (CNV)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-6159993-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 1.0
SIFT: 0.000 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.185

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-6159993-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 1.0
SIFT: 0.000 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV 1-6159992-C-T [0/1] rs1377464015
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
gnomAD_E_NFE: 0.0038%

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.275 to mouse mutant involving ITPR3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001314, corneal opacity
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.505 in interactome to INPP5K and phenotypic similarity 0.631 to Marinesco-Sjögren syndrome associated with INPP5K.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0010508, Metatarsus valgus
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:222100 Diabetes, type 1, susceptibility to (susceptibility)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.186

Phenotype Score: 0.253

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-33635728-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.999998
Polyphen2: 0.825 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.006 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.185

Phenotype Score: 0.252

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.473 to Microcephaly 16, primary, autosomal recessive associated with ANKLE2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001181, Adducted thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0001181, Adducted thumb
Phenotypic similarity 0.244 to mouse mutant involving ANKLE2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to LEMD2 and phenotypic similarity 0.629 to Marbach-Rustad progeroid syndrome associated with LEMD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0031846, Femur fracture
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0031846, Femur fracture
HP:0010055, Broad hallux - HP:0031846, Femur fracture
Proximity score 0.504 in interactome to LEMD2 and phenotypic similarity 0.257 to mouse mutant of LEMD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0006069, abnormal retinal neuronal layer morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:616681 Microcephaly 16, primary, autosomal recessive - autosomal recessive
ORPHA:2512 Autosomal recessive primary microcephaly - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.185

Phenotype Score: 0.252

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-133338300-G-A [0/1] rs1189947782
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.958 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.021 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.183

Phenotype Score: 0.251

Variant Score: 1.000

Phenotype matches:
Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.656 to 2q37 microdeletion syndrome associated with HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.934 to mouse mutant of HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0001363, Craniosynostosis - MP:0030356, premature lambdoid suture closure
HP:0011304, Broad thumb - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0010055, Broad hallux - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.614 to fish mutant of HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0107238, anguloarticular premature ossification, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:209920 MHC class II deficiency, complementation group B - autosomal recessive
ORPHA:572 Immunodeficiency by defective expression of MHC class II - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.183

Phenotype Score: 0.251

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-19308935-T-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.995 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.026 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.620 to Osteogenesis imperfecta, type VII associated with CRTAP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002979, Bowing of the legs
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0002812, Coxa vara
HP:0010055, Broad hallux - HP:0002979, Bowing of the legs
Phenotypic similarity 0.491 to mouse mutant involving CRTAP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate
HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization
HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate
HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate
Proximity score 0.500 in interactome to DDR2 and phenotypic similarity 0.612 to Spondylometaepiphyseal dysplasia, short limb-hand type associated with DDR2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0006009, Broad phalanx
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0009875, Triangular shaped distal phalanges of the hand
HP:0010055, Broad hallux - HP:0006009, Broad phalanx
Proximity score 0.500 in interactome to DDR2 and phenotypic similarity 0.515 to mouse mutant of DDR2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0000438, abnormal cranium morphology
HP:0011304, Broad thumb - MP:0006395, abnormal epiphyseal plate morphology
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:610682 Osteogenesis imperfecta, type VII - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-33175692-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.991 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.479 to Primary ciliary dyskinesia associated with CCDC40.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.712 to Trichothiodystrophy associated with RNF113A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Proximity score 0.500 in interactome to RNF113A and phenotypic similarity 0.262 to mouse mutant of RNF113A.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002792, abnormal retinal vasculature morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:613808 Ciliary dyskinesia, primary, 15 - autosomal recessive
ORPHA:244 Primary ciliary dyskinesia - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_TRUNCATION DEL 17-78064000-AGGCACGTGCACGAAGAACACGGGACGCGCGCAGGCACGTGCACGAACAACACGGGACGCGCGCG-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.322 to mouse mutant involving PCDH15.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.703 to Neurofacioskeletal syndrome with or without renal agenesis associated with HS2ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0011927, Short digit
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger
HP:0010055, Broad hallux - HP:0010186, Broad distal phalanx of the toes
Proximity score 0.500 in interactome to HS2ST1 and phenotypic similarity 0.698 to mouse mutant of HS2ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:601067 Usher syndrome, type 1D/F digenic - autosomal recessive
OMIM:602083 Usher syndrome, type 1F - autosomal recessive
OMIM:609533 Deafness, autosomal recessive 23 - autosomal recessive
ORPHA:231169 Usher syndrome type 1 - autosomal recessive
ORPHA:231169 Usher syndrome type 1 - autosomal recessive
Gene scores under compatible inheritance modes:

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:
Proximity score 0.500 in interactome to GDF5 and phenotypic similarity 0.832 to Brachydactyly, type A2 associated with GDF5.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009536, Short 2nd finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009182, Triangular shaped middle phalanx of the 5th finger
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.500 in interactome to GDF5 and phenotypic similarity 0.911 to mouse mutant of GDF5.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:615112 Urofacial syndrome 2 - autosomal recessive
ORPHA:2704 Ochoa syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-113641340-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
LRIG2:ENST00000361127.5:c.1105A>C:p.(Asn369His)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

Phenotype matches:
Phenotypic similarity 0.271 to mouse mutant involving MGME1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to SNRPN and phenotypic similarity 0.664 to Prader-Willi syndrome due to translocation associated with SNRPN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0005469, Flat occiput
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001845, Overlapping toe
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:615084 Mitochondrial DNA depletion syndrome 11 - autosomal recessive
ORPHA:352447 Progressive external ophthalmoplegia-myopathy-emaciation syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.182

Phenotype Score: 0.250

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 20-17968847-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.176

Phenotype Score: 0.250

Variant Score: 0.996

Phenotype matches:
Phenotypic similarity 0.334 to mouse mutant involving TTLL5.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002864, abnormal ocular fundus morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to RXRA and phenotypic similarity 0.772 to mouse mutant of RXRA.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases:
OMIM:615860 Cone-rod dystrophy 19 - autosomal recessive
ORPHA:1872 Cone rod dystrophy - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.176

Phenotype Score: 0.250

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
START_LOST SNV 14-76219261-A-G [0/1] rs781316021
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.961 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0057%
ExAC AMR: 0.0173%
ExAC NFE: 0.0075%
ExAC SAS: 0.0121%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0060%
gnomAD_E_NFE: 0.0054%
gnomAD_E_SAS: 0.0065%
gnomAD_G_AFR: 0.0115%
gnomAD_G_FIN: 0.0286%
gnomAD_G_NFE: 0.0067%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.041

Phenotype Score: 0.500

Variant Score: 0.538

No phenotype matches to diseases with this MOI.
Variants contributing to score:
START_LOST SNV 14-76219261-A-G [0/1] rs781316021
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PVS1, PP3]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.961 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0057%
ExAC AMR: 0.0173%
ExAC NFE: 0.0075%
ExAC SAS: 0.0121%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0060%
gnomAD_E_NFE: 0.0054%
gnomAD_E_SAS: 0.0065%
gnomAD_G_AFR: 0.0115%
gnomAD_G_FIN: 0.0286%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 14-76230983-T-C [0/1] rs2288142
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.3594%
TOPMed: 0.0642%
ESP EA: 0.0349%
ESP All: 0.0231%
ExAC EAS: 0.9373%
ExAC FIN: 0.5897%
ExAC NFE: 0.0959%
ExAC OTH: 0.5507%
ExAC SAS: 0.1272%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.9047%
gnomAD_E_FIN: 0.4172%
gnomAD_E_NFE: 0.0422%
gnomAD_E_OTH: 0.3648%
gnomAD_E_SAS: 0.1300%
gnomAD_G_EAS: 0.7398%
gnomAD_G_FIN: 0.6297%
gnomAD_G_NFE: 0.0866%
gnomAD_G_OTH: 0.3055%

Exomiser Score: 0.158

Phenotype Score: 0.500

Variant Score: 0.699

Phenotype matches:
Proximity score 0.500 in interactome to DPH1 and phenotypic similarity 0.740 to Developmental delay with short stature, dysmorphic facial features, and sparse hair associated with DPH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001800, Hypoplastic toenails
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001800, Hypoplastic toenails
HP:0010055, Broad hallux - HP:0001800, Hypoplastic toenails
Proximity score 0.500 in interactome to DPH1 and phenotypic similarity 0.739 to mouse mutant of DPH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis - MP:0002116, abnormal craniofacial bone morphology
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.158

Phenotype Score: 0.500

Variant Score: 0.699

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-5145458-G-A [0/1] rs1298821277
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.699
Polyphen2: 0.006 (B)
SIFT: 0.301 (T)
Frequency Data:
TOPMed: 0.0011%

Exomiser Score: 0.149

Phenotype Score: 0.506

Variant Score: 0.685

Phenotype matches:
Proximity score 0.506 in interactome to STAMBP and phenotypic similarity 0.666 to Microcephaly-capillary malformation syndrome associated with STAMBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.506 in interactome to STAMBP and phenotypic similarity 0.268 to mouse mutant of STAMBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:219090 Pituitary adenoma 4, ACTH-secreting, somatic - autosomal dominant/recessive
ORPHA:96253 Cushing disease (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.149

Phenotype Score: 0.506

Variant Score: 0.685

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-50774228-A-T [0/1] rs1274994081
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.685
Polyphen2: 0.006 (B)
SIFT: 0.315 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.144

Phenotype Score: 0.503

Variant Score: 0.683

Phenotype matches:
Proximity score 0.503 in interactome to GKN2 and phenotypic similarity 0.935 to mouse mutant of GKN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.144

Phenotype Score: 0.503

Variant Score: 0.683

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-1016733-G-T [0/1] rs548701018
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.726 CONTRIBUTING VARIANT
Transcripts:
MUC6:ENST00000421673.2:c.6068C>A:p.(Thr2023Lys)
Pathogenicity Data:
Best Score: 0.948
Polyphen2: 0.005 (B)
SIFT: 0.052 (D)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
gnomAD_G_AFR: 0.2420%
gnomAD_G_EAS: 0.1190%
gnomAD_G_FIN: 1.0045%
gnomAD_G_NFE: 0.3645%
gnomAD_G_OTH: 0.5000%
SPLICE_REGION_VARIANT SNV 11-1028885-G-A [0/1] rs202152925
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.640 CONTRIBUTING VARIANT
Transcripts:
MUC6:ENST00000421673.2:c.1453+4C>T:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1198%
TOPMed: 0.0574%
ExAC AFR: 0.0103%
ExAC AMR: 0.0087%
ExAC EAS: 0.9061%
ExAC NFE: 0.0030%
ExAC SAS: 0.0303%
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0089%
gnomAD_E_EAS: 0.8935%
gnomAD_E_NFE: 0.0036%
gnomAD_E_SAS: 0.0292%
gnomAD_G_EAS: 0.6790%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.025

Phenotype Score: 0.503

Variant Score: 0.479

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-1017186-A-G [0/1] rs74579726
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.479 CONTRIBUTING VARIANT
Transcripts:
MUC6:ENST00000421673.2:c.5615T>C:p.(Met1872Thr)
Pathogenicity Data:
Best Score: 0.481
Polyphen2: 0.094 (B)
SIFT: 0.519 (T)
Frequency Data:
gnomAD_E_FIN: 0.0149%
gnomAD_E_NFE: 0.0026%
gnomAD_E_OTH: 0.0286%
Other passed variants:
SYNONYMOUS_VARIANT SNV 11-1016714-G-A [0/1] rs373360588
Variant score: 0.100
Transcripts:
MUC6:ENST00000421673.2:c.6087C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 11-1017470-G-T [0/1] rs75533660
Variant score: 0.100
Transcripts:
MUC6:ENST00000421673.2:c.5331C>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 11-1017200-G-C [0/1] rs763772915
Variant score: 0.100
Transcripts:
MUC6:ENST00000421673.2:c.5601C>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_NFE: 0.0020%
SYNONYMOUS_VARIANT SNV 11-1017161-C-T [0/1] rs374837441
Variant score: 0.100
Transcripts:
MUC6:ENST00000421673.2:c.5640G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0206%
gnomAD_E_AMR: 0.0041%
gnomAD_E_EAS: 0.0102%
gnomAD_E_FIN: 0.0066%
gnomAD_E_NFE: 0.0106%
gnomAD_E_OTH: 0.0258%
gnomAD_E_SAS: 0.0080%
SYNONYMOUS_VARIANT SNV 11-1017833-C-T [0/1] rs373775476
Variant score: 0.084
Transcripts:
MUC6:ENST00000421673.2:c.4968G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.7955%
gnomAD_E_AMR: 0.0549%
gnomAD_E_EAS: 0.1312%
gnomAD_E_FIN: 0.1639%
gnomAD_E_NFE: 0.0564%
gnomAD_E_OTH: 0.0898%
gnomAD_E_SAS: 0.0475%
SYNONYMOUS_VARIANT SNV 11-1016732-T-C [0/1] rs527248643
Variant score: 0.080
Transcripts:
MUC6:ENST00000421673.2:c.6069A>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
gnomAD_G_AFR: 0.2656%
gnomAD_G_EAS: 0.1220%
gnomAD_G_FIN: 0.9091%
gnomAD_G_NFE: 0.3708%
gnomAD_G_OTH: 0.5025%

Exomiser Score: 0.143

Phenotype Score: 0.501

Variant Score: 0.686

Phenotype matches:
Phenotypic similarity 0.331 to mouse mutant involving FOXK2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to SIN3A and phenotypic similarity 0.696 to 15q24 microdeletion syndrome associated with SIN3A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009623, Proximal placement of thumb
HP:0010055, Broad hallux - HP:0001780, Abnormality of toe
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.143

Phenotype Score: 0.501

Variant Score: 0.686

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-80545133-G-A [0/1] rs201027007
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.686 CONTRIBUTING VARIANT
Transcripts:
FOXK2:ENST00000335255.5:c.1771G>A:p.(Gly591Ser)
Pathogenicity Data:
Best Score: 0.69
Polyphen2: 0.011 (B)
SIFT: 0.310 (T)
Frequency Data:
TOPMed: 0.0144%
ExAC AFR: 0.0098%
ExAC AMR: 0.0087%
ExAC EAS: 0.0463%
ExAC NFE: 0.0228%
ExAC SAS: 0.0303%
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0238%
gnomAD_E_EAS: 0.0464%
gnomAD_E_NFE: 0.0252%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0260%
gnomAD_G_AFR: 0.0343%

Exomiser Score: 0.139

Phenotype Score: 0.396

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.396 to mouse mutant involving SVEP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002109, abnormal limb morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002109, abnormal limb morphology
HP:0010055, Broad hallux - MP:0002109, abnormal limb morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.139

Phenotype Score: 0.396

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 9-113137745-TAAA-T [0/1] rs71373993
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.137

Phenotype Score: 0.507

Variant Score: 0.673

Phenotype matches:
Proximity score 0.507 in interactome to B4GALT7 and phenotypic similarity 0.696 to Ehlers-Danlos syndrome, spondylodysplastic type, 1 associated with B4GALT7.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0011308, Slender toe
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0006243, Phalangeal dislocation
HP:0010055, Broad hallux - HP:0011308, Slender toe
Proximity score 0.507 in interactome to B4GALT7 and phenotypic similarity 0.328 to fish mutant of B4GALT7.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0001049, head circular, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.137

Phenotype Score: 0.507

Variant Score: 0.673

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-42538423-A-G [0/1] rs1309618680
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.918
Polyphen2: 0.007 (B)
SIFT: 0.082 (T)
Frequency Data:
gnomAD_G_AFR: 0.0435%
gnomAD_G_FIN: 0.3147%
gnomAD_G_NFE: 0.0077%
MISSENSE_VARIANT SNV 12-42538415-C-G [0/1] rs1367553026
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.1590%
gnomAD_G_AMR: 0.9328%
gnomAD_G_EAS: 0.0914%
gnomAD_G_FIN: 0.6334%
gnomAD_G_NFE: 0.0320%
gnomAD_G_OTH: 0.1359%
Other passed variants:
MISSENSE_VARIANT SNV 12-42538412-C-T [0/1] rs1273118984
Pathogenicity Data:
Best Score: 0.908
Polyphen2: 0.051 (B)
SIFT: 0.092 (T)
Frequency Data:
gnomAD_G_AFR: 0.2225%
gnomAD_G_AMR: 1.7110%
gnomAD_G_EAS: 0.5144%
gnomAD_G_FIN: 0.8319%
gnomAD_G_NFE: 0.0496%
gnomAD_G_OTH: 0.1475%
SYNONYMOUS_VARIANT SNV 12-42538428-G-C [0/1] rs779360753
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC NFE: 0.0124%
gnomAD_E_NFE: 0.0061%
gnomAD_G_AFR: 0.0441%
gnomAD_G_FIN: 0.1923%

Exomiser Score: 0.131

Phenotype Score: 0.551

Variant Score: 0.617

Phenotype matches:
Phenotypic similarity 0.551 to Alström syndrome associated with ALMS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001831, Short toe
HP:0001363, Craniosynostosis - HP:0004438, Hyperostosis frontalis interna
HP:0011304, Broad thumb - HP:0009381, Short finger
HP:0010055, Broad hallux - HP:0001831, Short toe
Phenotypic similarity 0.298 to mouse mutant involving ALMS1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001326, retinal degeneration
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.503 in interactome to SDCCAG8 and phenotypic similarity 0.504 to Bardet-Biedl syndrome associated with SDCCAG8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0006101, Finger syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001162, Postaxial hand polydactyly
HP:0010055, Broad hallux - HP:0006101, Finger syndactyly
Proximity score 0.503 in interactome to SDCCAG8 and phenotypic similarity 0.737 to mouse mutant of SDCCAG8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Known diseases:
OMIM:203800 Alstrom syndrome - autosomal recessive
ORPHA:64 Alström syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.131

Phenotype Score: 0.551

Variant Score: 0.617

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.551 to ORPHA:64 Alström syndrome
Phenotypic similarity 0.383 to OMIM:203800 Alstrom syndrome
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 2-73613031-T-TGGAGGAGGAGGA [-/1] rs55889738
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 2-73677983-G-T [0/1] rs192499639
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1997%
TOPMed: 0.0495%
ExAC AFR: 0.0102%
ExAC AMR: 0.0087%
ExAC EAS: 0.7655%
ExAC OTH: 0.2222%
ExAC SAS: 0.0242%
gnomAD_E_AFR: 0.0131%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.7713%
gnomAD_E_OTH: 0.0549%
gnomAD_E_SAS: 0.0260%
gnomAD_G_AFR: 0.0458%
gnomAD_G_EAS: 1.2979%
gnomAD_G_OTH: 0.1018%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.054

Phenotype Score: 0.252

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 2-73613031-T-TGGAGGAGGAGGA [-/1] rs55889738
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SYNONYMOUS_VARIANT SNV 2-73717084-A-G [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.127

Phenotype Score: 0.250

Variant Score: 0.954

Phenotype matches:
Proximity score 0.500 in interactome to USP12 and phenotypic similarity 0.737 to mouse mutant of USP12.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000565, oligodactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000565, oligodactyly
HP:0010055, Broad hallux - MP:0000565, oligodactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:300066 Deafness, X-linked 4 - X-linked dominant
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.127

Phenotype Score: 0.250

Variant Score: 0.954

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-21761945-T-C [0/1] rs759552778
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3, BP6]
Variant score: 0.954 CONTRIBUTING VARIANT
Transcripts:
SMPX:ENST00000379494.3:c.55A>G:p.(Asn19Asp)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.986 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0064%
ExAC EAS: 0.1816%
ExAC OTH: 0.1587%
gnomAD_E_EAS: 0.2410%
gnomAD_G_EAS: 0.2904%

Exomiser Score: 0.116

Phenotype Score: 0.350

Variant Score: 0.829

Phenotype matches:
Phenotypic similarity 0.667 to 1p36 deletion syndrome associated with HSPG2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000270, Delayed cranial suture closure
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Phenotypic similarity 0.701 to mouse mutant involving HSPG2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006397, disorganized long bone epiphyseal plate
HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures
HP:0011304, Broad thumb - MP:0006397, disorganized long bone epiphyseal plate
HP:0010055, Broad hallux - MP:0006397, disorganized long bone epiphyseal plate
Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.332 to Hypogonadotropic hypogonadism 15 with or without anosmia associated with HS6ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002857, Genu valgum
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0002857, Genu valgum
HP:0010055, Broad hallux - HP:0002857, Genu valgum
Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.783 to mouse mutant of HS6ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005104, abnormal tarsal bone morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:224410 Dyssegmental dysplasia, Silverman-Handmaker type - autosomal recessive
OMIM:255800 Schwartz-Jampel syndrome, type 1 - autosomal recessive
ORPHA:1606 1p36 deletion syndrome (CNV)
ORPHA:1865 Dyssegmental dysplasia, Silverman-Handmaker type - autosomal recessive
ORPHA:800 Schwartz-Jampel syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.116

Phenotype Score: 0.350

Variant Score: 0.829

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-22179539-C-T [0/1] rs575744546
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 0.838
Polyphen2: 0.018 (B)
SIFT: 0.162 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0104%
ExAC EAS: 0.0466%
gnomAD_E_EAS: 0.0755%
gnomAD_E_NFE: 0.0009%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.109

Phenotype Score: 0.326

Variant Score: 0.850

Phenotype matches:
Phenotypic similarity 0.326 to mouse mutant involving FADS6.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.109

Phenotype Score: 0.326

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 17-72889676-G-GGGCTCCGTAGGTTCCATGGGCTCCGTAGGTTCCATGGGCTCCGTAGGTTCCATC [1/1] rs1598567899
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.109

Phenotype Score: 0.500

Variant Score: 0.651

Phenotype matches:
Proximity score 0.500 in interactome to DOCK3 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with DOCK3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.109

Phenotype Score: 0.500

Variant Score: 0.651

No phenotype matches to diseases with this MOI.
Variants contributing to score:
STOP_GAINED SNV 4-103826685-T-A [0/1] rs77618489
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
gnomAD_E_AFR: 0.0136%
gnomAD_E_AMR: 0.0061%
gnomAD_E_EAS: 0.0060%
gnomAD_E_NFE: 0.0027%
gnomAD_E_SAS: 0.0033%
gnomAD_G_AFR: 0.3301%
gnomAD_G_AMR: 0.7102%
gnomAD_G_EAS: 0.5691%
gnomAD_G_FIN: 0.4237%
gnomAD_G_NFE: 0.2110%
gnomAD_G_OTH: 0.2451%
SPLICE_REGION_VARIANT SNV 4-103826813-A-G [0/1] rs879245359
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.443 CONTRIBUTING VARIANT
Transcripts:
SLC9B1:ENST00000296422.7:c.1196-6T>C:p.?
SLC9B1:ENST00000394789.3:c.1196-6T>C:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0275%
gnomAD_E_AMR: 0.0138%
gnomAD_E_EAS: 0.0061%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0194%
gnomAD_E_SAS: 0.0110%
gnomAD_G_AFR: 0.6667%
gnomAD_G_AMR: 1.3678%
gnomAD_G_EAS: 0.8772%
gnomAD_G_FIN: 1.4587%
gnomAD_G_NFE: 0.4727%
gnomAD_G_OTH: 0.5249%

Exomiser Score: 0.092

Phenotype Score: 0.506

Variant Score: 0.625

Phenotype matches:
Phenotypic similarity 0.503 to Trismus-pseudocamptodactyly syndrome associated with MYH8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010621, Cutaneous syndactyly of toes
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001840, Metatarsus adductus
HP:0010055, Broad hallux - HP:0001765, Hammertoe
Proximity score 0.506 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases:
OMIM:158300 Trismus-pseudocamptodactyly syndrome - autosomal dominant
OMIM:608837 Carney complex variant - autosomal dominant
ORPHA:3377 Trismus-pseudocamptodactyly syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.092

Phenotype Score: 0.506

Variant Score: 0.625

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.503 to OMIM:158300 Trismus-pseudocamptodactyly syndrome
Phenotypic similarity 0.452 to ORPHA:3377 Trismus-pseudocamptodactyly syndrome
Variants contributing to score:
MISSENSE_VARIANT SNV 17-10305050-T-G [0/1] rs780682650
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.625 CONTRIBUTING VARIANT
Transcripts:
MYH8:ENST00000403437.2:c.2741A>C:p.(Asn914Thr)
Pathogenicity Data:
Best Score: 0.626
Polyphen2: 0.000 (B)
SIFT: 0.374 (T)
Frequency Data:
TOPMed: 0.0011%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.090

Phenotype Score: 0.611

Variant Score: 0.503

Phenotype matches:
Phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Phenotypic similarity 0.611 to mouse mutant involving TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification
HP:0011304, Broad thumb - MP:0004351, short humerus
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
Proximity score 0.503 in interactome to MYH3 and phenotypic similarity 0.728 to Contractures, pterygia, and spondylocarpostarsal fusion syndrome 1A associated with MYH3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0008368, Tarsal synostosis
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0009702, Carpal synostosis
HP:0010055, Broad hallux - HP:0008368, Tarsal synostosis
Known diseases:
OMIM:601680 Arthrogryposis, distal, type 2B1 - autosomal dominant
ORPHA:1146 Distal arthrogryposis type 1 - autosomal dominant
ORPHA:1147 Sheldon-Hall syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.090

Phenotype Score: 0.611

Variant Score: 0.503

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.494 to ORPHA:1146 Distal arthrogryposis type 1
Phenotypic similarity 0.478 to ORPHA:1147 Sheldon-Hall syndrome
Phenotypic similarity 0.417 to OMIM:601680 Arthrogryposis, distal, type 2B1
Variants contributing to score:
MISSENSE_VARIANT SNV 11-1861812-G-A [0/1] rs761650095
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.504
Polyphen2: 0.073 (B)
SIFT: 0.496 (T)
Frequency Data:
TOPMed: 0.0015%
ExAC EAS: 0.0118%
ExAC NFE: 0.0016%
gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.086

Phenotype Score: 0.502

Variant Score: 0.621

Phenotype matches:
Proximity score 0.502 in interactome to NUP188 and phenotypic similarity 0.609 to Sandestig-Stefanova syndrome associated with NUP188.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0030084, Clinodactyly
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0030084, Clinodactyly
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.086

Phenotype Score: 0.502

Variant Score: 0.621

No phenotype matches to diseases with this MOI.
Variants contributing to score:
INFRAME_DELETION DEL 1-29475218-CCTT-C [0/1] rs772412205
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0144%
ESP AA: 0.7501%
ESP EA: 0.5937%
ESP All: 0.6470%
ExAC AFR: 0.2414%
ExAC AMR: 0.3114%
ExAC EAS: 0.4309%
ExAC FIN: 0.1362%
ExAC NFE: 0.3920%
ExAC OTH: 0.5531%
ExAC SAS: 0.6689%
gnomAD_E_AFR: 0.0333%
gnomAD_E_AMR: 0.0061%
gnomAD_E_EAS: 0.0239%
gnomAD_E_FIN: 0.0282%
gnomAD_E_NFE: 0.0184%
gnomAD_E_SAS: 0.0134%
gnomAD_G_AFR: 0.0345%
gnomAD_G_NFE: 0.0134%
SPLICE_REGION_VARIANT DEL 1-29481428-GA-G [0/1] rs758506993
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.520 CONTRIBUTING VARIANT
Transcripts:
SRSF4:ENST00000373795.4:c.364-7del:p.?
SRSF4:ENST00000546138.1:c.363+4457del:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1198%
TOPMed: 0.1198%
ESP AA: 1.0080%
ESP EA: 1.0177%
ESP All: 1.0144%
ExAC AFR: 0.4176%
ExAC AMR: 0.1745%
ExAC EAS: 1.1193%
ExAC FIN: 0.0157%
ExAC NFE: 0.8665%
ExAC OTH: 0.8621%
ExAC SAS: 0.3222%
gnomAD_E_AFR: 0.0460%
gnomAD_E_AMR: 0.1459%
gnomAD_E_EAS: 1.2767%
gnomAD_E_FIN: 0.0461%
gnomAD_E_NFE: 0.0631%
gnomAD_E_OTH: 0.1893%
gnomAD_E_SAS: 0.1594%
gnomAD_G_EAS: 0.5703%
gnomAD_G_FIN: 0.0515%
gnomAD_G_NFE: 0.0392%
gnomAD_G_OTH: 0.1370%

Exomiser Score: 0.074

Phenotype Score: 0.505

Variant Score: 0.601

Phenotype matches:
Phenotypic similarity 0.375 to mouse mutant involving CD36.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003664, ocular pterygium
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.505 in interactome to THBS3 and phenotypic similarity 0.694 to mouse mutant of THBS3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000559, abnormal femur morphology
HP:0001363, Craniosynostosis - MP:0003416, premature bone ossification
HP:0011304, Broad thumb - MP:0000559, abnormal femur morphology
HP:0010055, Broad hallux - MP:0000559, abnormal femur morphology
Known diseases:
OMIM:608404 Platelet glycoprotein IV deficiency - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.074

Phenotype Score: 0.505

Variant Score: 0.601

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-80302123-A-T [0/1] rs201355711
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0144%
ExAC EAS: 0.6437%
gnomAD_E_EAS: 0.5500%
gnomAD_E_OTH: 0.0184%
gnomAD_G_EAS: 0.7453%

Exomiser Score: 0.065

Phenotype Score: 0.500

Variant Score: 0.591

Phenotype matches:
Proximity score 0.500 in interactome to ZMPSTE24 and phenotypic similarity 0.646 to Mandibuloacral dysplasia with type B lipodystrophy associated with ZMPSTE24.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009803, Short phalanx of finger
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger
HP:0010055, Broad hallux - HP:0001870, Acroosteolysis of distal phalanges (feet)
Proximity score 0.500 in interactome to ZMPSTE24 and phenotypic similarity 0.679 to mouse mutant of ZMPSTE24.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000558, abnormal tibia morphology
HP:0001363, Craniosynostosis - MP:0002835, abnormal cranial suture morphology
HP:0011304, Broad thumb - MP:0000558, abnormal tibia morphology
HP:0010055, Broad hallux - MP:0000558, abnormal tibia morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.065

Phenotype Score: 0.500

Variant Score: 0.591

No phenotype matches to diseases with this MOI.
Variants contributing to score:
STOP_GAINED SNV 7-151716809-C-T [0/1] rs148537699
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0076%
ESP AA: 0.0227%
ESP EA: 0.0116%
ESP All: 0.0154%
ExAC AFR: 0.0096%
ExAC EAS: 0.0693%
ExAC NFE: 0.0120%
gnomAD_E_AFR: 0.0065%
gnomAD_E_EAS: 0.0812%
gnomAD_E_NFE: 0.0098%
gnomAD_E_SAS: 0.0032%
gnomAD_G_EAS: 0.1235%
MISSENSE_VARIANT SNV 7-151668119-G-A [0/1] rs181262306
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.959
Polyphen2: 0.003 (B)
SIFT: 0.041 (D)
Frequency Data:
1000Genomes: 0.1398%
TOPMed: 0.1730%
ExAC AFR: 0.0194%
ExAC AMR: 1.9247%
ExAC EAS: 1.1477%
ExAC NFE: 0.0075%
ExAC SAS: 0.0122%
gnomAD_E_AFR: 0.0131%
gnomAD_E_AMR: 1.7037%
gnomAD_E_EAS: 1.1608%
gnomAD_E_NFE: 0.0045%
gnomAD_E_OTH: 0.1278%
gnomAD_E_SAS: 0.0098%
gnomAD_G_AFR: 0.0115%
gnomAD_G_AMR: 1.5513%
gnomAD_G_EAS: 1.1728%
gnomAD_G_OTH: 0.2041%

Exomiser Score: 0.058

Phenotype Score: 0.500

Variant Score: 0.577

Phenotype matches:
Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.058

Phenotype Score: 0.500

Variant Score: 0.577

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-3195053-T-C [0/1] rs201389844
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.577 CONTRIBUTING VARIANT
Transcripts:
OR3A1:ENST00000323404.1:c.824A>G:p.(Lys275Arg)
Pathogenicity Data:
Best Score: 0.579
Polyphen2: 0.344 (B)
SIFT: 0.421 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0011%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.057

Phenotype Score: 0.504

Variant Score: 0.570

Phenotype matches:
Proximity score 0.504 in interactome to POGZ and phenotypic similarity 0.707 to White-Sutton syndrome associated with POGZ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.057

Phenotype Score: 0.504

Variant Score: 0.570

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-129339273-T-C [0/1] rs191895201
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.570 CONTRIBUTING VARIANT
Transcripts:
ZNF280C:ENST00000370978.4:c.2159A>G:p.(Asn720Ser)
Pathogenicity Data:
Best Score: 0.866
Polyphen2: 0.022 (B)
SIFT: 0.134 (T)
Frequency Data:
1000Genomes: 0.1325%
TOPMed: 0.0665%
ExAC EAS: 1.0749%
ExAC NFE: 0.0042%
ExAC SAS: 0.0103%
gnomAD_E_EAS: 1.1985%
gnomAD_E_NFE: 0.0026%
gnomAD_E_SAS: 0.0119%
gnomAD_G_EAS: 1.2597%

Exomiser Score: 0.054

Phenotype Score: 0.503

Variant Score: 0.566

Phenotype matches:
Phenotypic similarity 0.262 to mouse mutant involving ALDH1L2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001325, abnormal retina morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.503 in interactome to SHMT2 and phenotypic similarity 0.669 to Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities associated with SHMT2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009943, Complete duplication of thumb phalanx
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Proximity score 0.503 in interactome to SHMT2 and phenotypic similarity 0.262 to mouse mutant of SHMT2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0008259, abnormal optic disk morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.054

Phenotype Score: 0.503

Variant Score: 0.566

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-105455412-G-C [0/1] rs761986038
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.571
Polyphen2: 0.016 (B)
SIFT: 0.429 (T)
Frequency Data:
ExAC EAS: 0.0347%
gnomAD_E_EAS: 0.0464%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.049

Phenotype Score: 0.551

Variant Score: 0.502

Phenotype matches:
Phenotypic similarity 0.551 to Congenital muscular dystrophy, Ullrich type associated with COL6A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001238, Slender finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010511, Long toe
Known diseases:
OMIM:158810 Bethlem myopathy 1 - autosomal dominant/recessive
OMIM:254090 Ullrich congenital muscular dystrophy 1 - autosomal dominant/recessive
OMIM:255600 ?Myosclerosis, congenital (unconfirmed)
ORPHA:610 Bethlem myopathy - autosomal dominant/recessive
ORPHA:75840 Congenital muscular dystrophy, Ullrich type - autosomal dominant/recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.049

Phenotype Score: 0.551

Variant Score: 0.502

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.551 to ORPHA:75840 Congenital muscular dystrophy, Ullrich type
Phenotypic similarity 0.475 to ORPHA:610 Bethlem myopathy
Phenotypic similarity 0.396 to OMIM:158810 Bethlem myopathy 1
Phenotypic similarity 0.324 to OMIM:254090 Ullrich congenital muscular dystrophy 1
Variants contributing to score:
MISSENSE_VARIANT SNV 21-47531486-G-C [0/1] rs1450538075
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.502
Polyphen2: 0.001 (B)
SIFT: 0.498 (T)
Frequency Data:
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.045

Phenotype Score: 0.133

Variant Score: 0.965

Phenotype matches:
Phenotypic similarity 0.265 to mouse mutant involving NLRP7.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005543, decreased cornea thickness
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:231090 Hydatidiform mole, recurrent, 1 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.045

Phenotype Score: 0.133

Variant Score: 0.965

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55450929-C-T [0/1] rs771101644
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.973
Polyphen2: 0.901 (P)
SIFT: 0.027 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC EAS: 0.0362%
gnomAD_E_EAS: 0.0409%
gnomAD_G_EAS: 0.0620%

Exomiser Score: 0.044

Phenotype Score: 0.320

Variant Score: 0.748

Phenotype matches:
Phenotypic similarity 0.320 to mouse mutant involving FSD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.044

Phenotype Score: 0.320

Variant Score: 0.748

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-83447635-C-T [0/1] rs200246355
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.753977
Polyphen2: 0.005 (B)
Mutation Taster: 0.754
SIFT: 0.513 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0072%
ESP AA: 0.0544%
ESP All: 0.0168%
ExAC AFR: 0.0102%
ExAC AMR: 0.0086%
ExAC EAS: 0.0232%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0065%
gnomAD_E_AMR: 0.0060%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0183%

Exomiser Score: 0.043

Phenotype Score: 0.274

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.559 to Phelan-McDermid syndrome associated with SHANK3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Phenotypic similarity 0.548 to mouse mutant involving SHANK3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000572, abnormal autopod morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000572, abnormal autopod morphology
HP:0010055, Broad hallux - MP:0000572, abnormal autopod morphology
Proximity score 0.507 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:606232 Phelan-McDermid syndrome - autosomal dominant
OMIM:613950 Schizophrenia 15 (susceptibility)
ORPHA:48652 Monosomy 22q13.3 (CNV)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.043

Phenotype Score: 0.274

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 22-51135986-T-C [1/1] rs1469966522
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SYNONYMOUS_VARIANT SNV 22-51135983-A-C [1/1] rs1430487902
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.042

Phenotype Score: 0.505

Variant Score: 0.535

Phenotype matches:
Proximity score 0.505 in interactome to BRIP1 and phenotypic similarity 0.676 to Fanconi anemia associated with BRIP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.505 in interactome to BRIP1 and phenotypic similarity 0.275 to mouse mutant of BRIP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001304, cataract
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:614337 Colorectal cancer, hereditary nonpolyposis, type 4 - autosomal dominant
OMIM:619101 Mismatch repair cancer syndrome 4 - autosomal recessive
ORPHA:144 Lynch syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.042

Phenotype Score: 0.505

Variant Score: 0.535

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-6017340-T-C [0/1] rs17420802
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3, BP6_Strong]
ClinVar: BENIGN (reviewed by expert panel)
Pathogenicity Data:
Best Score: 0.999977
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.218 (T)
Frequency Data:
gnomAD_E_AMR: 0.0388%
gnomAD_E_NFE: 0.0371%
gnomAD_E_OTH: 0.0549%
gnomAD_E_SAS: 0.0098%
gnomAD_G_AFR: 0.0582%
gnomAD_G_EAS: 0.1880%
gnomAD_G_FIN: 0.0291%
gnomAD_G_NFE: 0.1291%
SYNONYMOUS_VARIANT SNV 7-6018249-A-G [0/1] rs1805325
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]
ClinVar: BENIGN (reviewed by expert panel)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC NFE: 0.0047%
gnomAD_E_AFR: 0.0198%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0054%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0033%
gnomAD_G_AFR: 0.0818%
gnomAD_G_FIN: 0.0291%
gnomAD_G_NFE: 0.0203%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-6018249-A-G [0/1] rs1805325
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]
ClinVar: BENIGN (reviewed by expert panel)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC NFE: 0.0047%
gnomAD_E_AFR: 0.0198%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0054%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0033%
gnomAD_G_AFR: 0.0818%
gnomAD_G_FIN: 0.0291%
gnomAD_G_NFE: 0.0203%

Exomiser Score: 0.041

Phenotype Score: 0.333

Variant Score: 0.727

Phenotype matches:
Phenotypic similarity 0.365 to Metaphyseal anadysplasia 2 associated with MMP9.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002979, Bowing of the legs
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0002979, Bowing of the legs
HP:0010055, Broad hallux - HP:0002979, Bowing of the legs
Phenotypic similarity 0.666 to mouse mutant involving MMP9.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003072, abnormal metatarsal bone morphology
HP:0001363, Craniosynostosis - MP:0000060, delayed bone ossification
HP:0011304, Broad thumb - MP:0003072, abnormal metatarsal bone morphology
HP:0010055, Broad hallux - MP:0003072, abnormal metatarsal bone morphology
Proximity score 0.527 in interactome to RECK and phenotypic similarity 0.705 to mouse mutant of RECK.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:613073 Metaphyseal anadysplasia 2 - autosomal recessive
ORPHA:1040 Metaphyseal anadysplasia - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.041

Phenotype Score: 0.333

Variant Score: 0.727

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 20-44642043-A-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.727 CONTRIBUTING VARIANT
Transcripts:
MMP9:ENST00000372330.3:c.1480A>T:p.(Thr494Ser)
Pathogenicity Data:
Best Score: 0.727
Polyphen2: 0.047 (B)
SIFT: 0.273 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.040

Phenotype Score: 0.506

Variant Score: 0.529

Phenotype matches:
Proximity score 0.506 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.040

Phenotype Score: 0.506

Variant Score: 0.529

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-65968887-T-A [0/1] rs779985646
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.52900004
SIFT: 0.471 (T)
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.039

Phenotype Score: 0.502

Variant Score: 0.529

Phenotype matches:
Proximity score 0.502 in interactome to EIF3C and phenotypic similarity 1.000 to mouse mutant of EIF3C.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0009049, abnormal hallux morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.039

Phenotype Score: 0.502

Variant Score: 0.529

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 22-39713638-C-CA [0/1] rs201453499
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
Variant score: 0.754 CONTRIBUTING VARIANT
Transcripts:
RPL3:ENST00000216146.4:c.197-5_197-4insT:p.?
RPL3:ENST00000401609.1:c.41-5_41-4insT:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AFR: 0.0517%
ExAC AMR: 0.1177%
ExAC EAS: 0.1725%
ExAC FIN: 0.0154%
ExAC NFE: 0.0430%
ExAC OTH: 0.1163%
ExAC SAS: 0.3514%
gnomAD_G_AMR: 0.1259%
gnomAD_G_EAS: 0.1247%
gnomAD_G_NFE: 0.0141%
SPLICE_REGION_VARIANT SNV 22-39715593-C-G [0/1] rs200650933
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.303 CONTRIBUTING VARIANT
Transcripts:
RPL3:ENST00000216146.4:c.3+7G>C:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0998%
TOPMed: 0.0276%
ExAC EAS: 1.7216%
ExAC OTH: 0.3906%
gnomAD_E_AMR: 0.0038%
gnomAD_E_EAS: 0.6846%
gnomAD_E_OTH: 0.0473%
gnomAD_G_EAS: 0.8015%

Exomiser Score: 0.036

Phenotype Score: 0.260

Variant Score: 0.795

Phenotype matches:
Phenotypic similarity 0.646 to Developmental and epileptic encephalopathy 80 associated with PIGB.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001182, Tapered finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001182, Tapered finger
Proximity score 0.520 in interactome to PIGO and phenotypic similarity 0.865 to Hyperphosphatasia with mental retardation syndrome 2 associated with PIGO.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis - HP:0011326, Anterior plagiocephaly
HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:618580 Developmental and epileptic encephalopathy 80 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.036

Phenotype Score: 0.260

Variant Score: 0.795

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-55626174-G-C [0/1] rs1243578081
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.795
Polyphen2: 0.014 (B)
SIFT: 0.205 (T)
Frequency Data:
TOPMed: 0.0008%

NEB

Exomiser Score: 0.035

Phenotype Score: 0.252

Variant Score: 0.800

Phenotype matches:
Phenotypic similarity 0.541 to Arthrogryposis multiplex congenita 6 associated with NEB.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001181, Adducted thumb
HP:0001363, Craniosynostosis - HP:0000239, Large fontanelles
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0001181, Adducted thumb
Phenotypic similarity 0.268 to mouse mutant involving NEB.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.494 to Distal arthrogryposis type 1 associated with TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.504 in interactome to TNNI2 and phenotypic similarity 0.611 to mouse mutant of TNNI2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0008273, abnormal intramembranous bone ossification
HP:0011304, Broad thumb - MP:0004351, short humerus
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
Known diseases:
OMIM:256030 Nemaline myopathy 2, autosomal recessive - autosomal recessive
OMIM:619334 Arthrogryposis multiplex congenita 6 - autosomal recessive
ORPHA:171430 Severe congenital nemaline myopathy - autosomal recessive
ORPHA:171433 Intermediate nemaline myopathy - autosomal recessive
ORPHA:171436 Typical nemaline myopathy - autosomal recessive
ORPHA:171439 Childhood-onset nemaline myopathy - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.035

Phenotype Score: 0.252

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 2-152458415-G-A [0/1] rs876657541
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.028

Phenotype Score: 0.541

Variant Score: 0.447

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to OMIM:619334 Arthrogryposis multiplex congenita 6
Phenotypic similarity 0.526 to ORPHA:171430 Severe congenital nemaline myopathy
Phenotypic similarity 0.346 to ORPHA:171436 Typical nemaline myopathy
Phenotypic similarity 0.324 to ORPHA:171439 Childhood-onset nemaline myopathy
Phenotypic similarity 0.237 to OMIM:256030 Nemaline myopathy 2, autosomal recessive
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 2-152458415-G-A [0/1] rs876657541
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 2-152460241-G-A [0/1] rs147579763
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.3778%
gnomAD_G_AFR: 0.1316%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.034

Phenotype Score: 0.254

Variant Score: 0.795

Phenotype matches:
Phenotypic similarity 0.556 to 6q25 microdeletion syndrome associated with ARID1B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
Proximity score 0.507 in interactome to SMARCD2 and phenotypic similarity 0.657 to Specific granule deficiency 2 associated with SMARCD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001852, Sandal gap
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:135900 Coffin-Siris syndrome 1 - autosomal dominant
ORPHA:1465 Coffin-Siris syndrome - autosomal dominant
ORPHA:251056 6q25 microdeletion syndrome (CNV)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.034

Phenotype Score: 0.254

Variant Score: 0.795

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_DELETION DEL 6-157100430-AGGC-A [0/1] rs777545000
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_NFE: 0.0394%
gnomAD_G_AFR: 0.0272%
gnomAD_G_FIN: 0.2500%
gnomAD_G_OTH: 0.1667%
DISRUPTIVE_INFRAME_DELETION DEL 6-157100092-CGCG-C [0/1] rs764418312
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_FIN: 0.1145%
gnomAD_E_NFE: 0.5144%
gnomAD_E_SAS: 0.2688%

Exomiser Score: 0.031

Phenotype Score: 0.500

Variant Score: 0.508

Phenotype matches:
Proximity score 0.500 in interactome to ENPP1 and phenotypic similarity 0.697 to Autosomal recessive hypophosphatemic rickets associated with ENPP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002970, Genu varum
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0002982, Tibial bowing
HP:0010055, Broad hallux - HP:0002970, Genu varum
Proximity score 0.500 in interactome to ENPP1 and phenotypic similarity 0.578 to mouse mutant of ENPP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0008915, fused carpal bones
HP:0001363, Craniosynostosis - MP:0006392, abnormal nucleus pulposus morphology
HP:0011304, Broad thumb - MP:0008915, fused carpal bones
HP:0010055, Broad hallux - MP:0008915, fused carpal bones
Proximity score 0.500 in interactome to ENPP1 and phenotypic similarity 0.563 to fish mutant of ENPP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0012007, ceratohyal cartilage premature perichondral ossification, abnormal
HP:0011304, Broad thumb - ZP:0006782, cleithrum nodular, abnormal
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.031

Phenotype Score: 0.500

Variant Score: 0.508

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-104160692-A-T [0/1] rs201971373
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.915 CONTRIBUTING VARIANT
Transcripts:
AMY2A:ENST00000414303.2:c.285A>T:p.(Arg95Ser)
Pathogenicity Data:
Best Score: 0.999918
Polyphen2: 0.472 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.205 (T)
Frequency Data:
1000Genomes: 0.0998%
TOPMed: 0.0200%
ExAC EAS: 0.4870%
gnomAD_E_EAS: 0.4646%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0185%
gnomAD_G_EAS: 0.2488%
SYNONYMOUS_VARIANT SNV 1-104161706-C-A [0/1] rs752786393
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
AMY2A:ENST00000414303.2:c.489C>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-104161706-C-A [0/1] rs752786393
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
AMY2A:ENST00000414303.2:c.489C>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.030

Phenotype Score: 0.510

Variant Score: 0.491

Phenotype matches:
Proximity score 0.510 in interactome to FMN1 and phenotypic similarity 0.772 to mouse mutant of FMN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.030

Phenotype Score: 0.510

Variant Score: 0.491

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-62302543-G-A [0/1] rs76611638
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.999486
Polyphen2: 0.967 (D)
Mutation Taster: 0.999 (P)
SIFT: 0.006 (D)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0175%
UK10K: 0.0132%
ExAC EAS: 0.0929%
ExAC NFE: 0.0106%
ExAC SAS: 0.0061%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0754%
gnomAD_E_NFE: 0.0081%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0130%
gnomAD_G_EAS: 0.1233%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 11-62295075-C-T [0/1] rs183783741
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.002
Polyphen2: 0.002 (B)
SIFT: 1.000 (T)
Frequency Data:
1000Genomes: 0.7188%
TOPMed: 0.0654%
ExAC AFR: 0.0096%
ExAC EAS: 1.7102%
ExAC NFE: 0.0015%
ExAC SAS: 0.0484%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 1.6872%
gnomAD_E_NFE: 0.0045%
gnomAD_E_OTH: 0.0911%
gnomAD_E_SAS: 0.0487%
gnomAD_G_EAS: 1.7901%

Exomiser Score: 0.029

Phenotype Score: 0.507

Variant Score: 0.490

Phenotype matches:
Proximity score 0.507 in interactome to NLRP3 and phenotypic similarity 0.705 to CINCA syndrome associated with NLRP3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001476, Delayed closure of the anterior fontanelle
HP:0011304, Broad thumb - HP:0001156, Brachydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.507 in interactome to NLRP3 and phenotypic similarity 0.486 to mouse mutant of NLRP3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0030825, decreased femur size
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0030825, decreased femur size
HP:0010055, Broad hallux - MP:0030825, decreased femur size
Known diseases:
OMIM:618497 Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements - autosomal recessive
ORPHA:442835 Non-specific early-onset epileptic encephalopathy - autosomal dominant/recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.029

Phenotype Score: 0.507

Variant Score: 0.490

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 9-140953560-G-A [0/1] rs1388466870
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
gnomAD_E_NFE: 0.0009%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.507

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 9-140953560-G-A [0/1] rs1388466870
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.025

Phenotype Score: 0.504

Variant Score: 0.478

Phenotype matches:
Proximity score 0.504 in interactome to TRIP12 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with TRIP12.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.025

Phenotype Score: 0.504

Variant Score: 0.478

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-128119379-T-C [0/1] rs2896399
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.478
SIFT: 0.522 (T)
Frequency Data:
gnomAD_E_NFE: 0.0009%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.009

Phenotype Score: 0.504

Variant Score: 0.370

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-128119379-T-C [0/1] rs2896399
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.478
SIFT: 0.522 (T)
Frequency Data:
gnomAD_E_NFE: 0.0009%
MISSENSE_VARIANT SNV 7-128119380-G-C [0/1] rs1053120
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.26200002
SIFT: 0.738 (T)
Frequency Data:
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.023

Phenotype Score: 0.501

Variant Score: 0.472

Phenotype matches:
Proximity score 0.501 in interactome to DVL3 and phenotypic similarity 0.823 to Robinow syndrome, autosomal dominant 3 associated with DVL3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.501 in interactome to DVL3 and phenotypic similarity 0.513 to mouse mutant of DVL3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004678, split xiphoid process
HP:0001363, Craniosynostosis - MP:0004522, abnormal orientation of cochlear hair cell stereociliary bundles
HP:0011304, Broad thumb - MP:0004678, split xiphoid process
HP:0010055, Broad hallux - MP:0004678, split xiphoid process
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.023

Phenotype Score: 0.501

Variant Score: 0.472

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-1033543-G-A [0/1] rs769021504
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.473
Polyphen2: 0.002 (B)
SIFT: 0.527 (T)
Frequency Data:
ExAC NFE: 0.0097%
gnomAD_E_NFE: 0.0024%
gnomAD_E_SAS: 0.0039%

Exomiser Score: 0.022

Phenotype Score: 0.500

Variant Score: 0.470

Phenotype matches:
Proximity score 0.500 in interactome to MDGA2 and phenotypic similarity 0.635 to mouse mutant of MDGA2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000554, abnormal carpal bone morphology
HP:0001363, Craniosynostosis - MP:0000554, abnormal carpal bone morphology
HP:0011304, Broad thumb - MP:0000554, abnormal carpal bone morphology
HP:0010055, Broad hallux - MP:0000554, abnormal carpal bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.022

Phenotype Score: 0.500

Variant Score: 0.470

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-10541402-C-A [0/1] rs766926962
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.47100002
SIFT: 0.529 (T)
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0232%
gnomAD_E_EAS: 0.0116%

Exomiser Score: 0.022

Phenotype Score: 0.501

Variant Score: 0.466

Phenotype matches:
Proximity score 0.501 in interactome to PRKAR1A and phenotypic similarity 0.684 to Acrodysostosis 1, with or without hormone resistance associated with PRKAR1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0004490, Calvarial hyperostosis
HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger
HP:0010055, Broad hallux - HP:0001847, Long hallux
Proximity score 0.501 in interactome to PRKAR1A and phenotypic similarity 0.852 to mouse mutant of PRKAR1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0003419, delayed endochondral bone ossification
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.022

Phenotype Score: 0.501

Variant Score: 0.466

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-50121521-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.46600002
Polyphen2: 0.025 (B)
SIFT: 0.534 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.019

Phenotype Score: 0.504

Variant Score: 0.446

Phenotype matches:
Phenotypic similarity 0.272 to mouse mutant involving RAD54L.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0012121, sclerocornea
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to RAD51C and phenotypic similarity 0.676 to Fanconi anemia associated with RAD51C.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Known diseases:
OMIM:114480 Breast cancer, invasive ductal (susceptibility)
OMIM:605027 Lymphoma, non-Hodgkin, somatic - unknown
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.019

Phenotype Score: 0.504

Variant Score: 0.446

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-46715694-G-C [0/1] rs764303863
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.45
Polyphen2: 0.001 (B)
SIFT: 0.550 (T)
Frequency Data:
TOPMed: 0.0064%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0290%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.017

Phenotype Score: 0.500

Variant Score: 0.439

Phenotype matches:
Proximity score 0.500 in interactome to SFN and phenotypic similarity 0.710 to mouse mutant of SFN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0000454, abnormal jaw morphology
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.017

Phenotype Score: 0.500

Variant Score: 0.439

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 13-24892967-C-T [0/1] rs150781719
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.837
Polyphen2: 0.448 (P)
SIFT: 0.163 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
ExAC AMR: 0.0259%
ExAC EAS: 0.1040%
ExAC NFE: 0.0105%
gnomAD_E_AMR: 0.0119%
gnomAD_E_EAS: 0.1045%
gnomAD_E_NFE: 0.0107%
gnomAD_E_OTH: 0.0365%
gnomAD_E_SAS: 0.0097%
gnomAD_G_AFR: 0.0114%
gnomAD_G_EAS: 0.1233%
gnomAD_G_NFE: 0.0200%
gnomAD_G_OTH: 0.1022%
SYNONYMOUS_VARIANT SNV 13-24895711-T-C [0/1] rs377422263
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.056 CONTRIBUTING VARIANT
Transcripts:
C1QTNF9:ENST00000332018.4:c.807T>C:p.(=)
C1QTNF9:ENST00000382071.2:c.807T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AFR: 0.0288%
ExAC AMR: 0.0432%
ExAC EAS: 0.0925%
ExAC NFE: 0.0030%
ExAC OTH: 0.1109%
ExAC SAS: 1.4514%
gnomAD_E_AFR: 0.0327%
gnomAD_E_AMR: 0.0238%
gnomAD_E_EAS: 0.0812%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0365%
gnomAD_E_SAS: 1.3941%
gnomAD_G_AFR: 0.0459%
gnomAD_G_EAS: 0.0621%

Exomiser Score: 0.016

Phenotype Score: 0.502

Variant Score: 0.433

Phenotype matches:
Proximity score 0.502 in interactome to PSEN1 and phenotypic similarity 0.175 to Familial isolated dilated cardiomyopathy associated with PSEN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0000982, Palmoplantar keratoderma
HP:0010055, Broad hallux - HP:0000982, Palmoplantar keratoderma
Proximity score 0.502 in interactome to PSEN1 and phenotypic similarity 0.685 to mouse mutant of PSEN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000592, short tail
HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology
HP:0011304, Broad thumb - MP:0000592, short tail
HP:0010055, Broad hallux - MP:0000592, short tail
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.502

Variant Score: 0.433

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-62135281-C-T [0/1] rs371477913
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.433 CONTRIBUTING VARIANT
Transcripts:
ERN1:ENST00000433197.3:c.1279G>A:p.(Ala427Thr)
Pathogenicity Data:
Best Score: 0.43699998
Polyphen2: 0.002 (B)
SIFT: 0.563 (T)
Frequency Data:
TOPMed: 0.0060%
ESP AA: 0.0250%
ESP All: 0.0081%
ExAC FIN: 0.0414%
ExAC NFE: 0.0160%
ExAC SAS: 0.0079%
gnomAD_E_AMR: 0.0031%
gnomAD_E_EAS: 0.0060%
gnomAD_E_FIN: 0.0366%
gnomAD_E_NFE: 0.0102%
gnomAD_G_EAS: 0.0617%
gnomAD_G_FIN: 0.0287%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-105413578-G-A [0/1] rs1211896206
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.996 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.014

Phenotype Score: 0.000

Variant Score: 0.985

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-105413578-G-A [0/1] rs1211896206
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.996 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 14-105410512-G-A [0/1] rs762470858
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.972
Polyphen2: 0.010 (B)
SIFT: 0.028 (D)
Frequency Data:
UK10K: 0.0132%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0195%
gnomAD_G_AFR: 0.0122%
gnomAD_G_NFE: 0.0135%
Other passed variants:
MISSENSE_VARIANT SNV 14-105410461-G-C [0/1] rs771414548
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.944 (P)
SIFT: 0.000 (D)
Frequency Data:
gnomAD_G_AFR: 0.1652%
gnomAD_G_EAS: 0.2146%
gnomAD_G_NFE: 0.0068%
MISSENSE_VARIANT SNV 14-105410383-T-C [0/1] rs553656839
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.471 (P)
Mutation Taster: 1.000 (P)
SIFT: 0.028 (D)
Frequency Data:
1000Genomes: 0.1797%
TOPMed: 0.1797%
gnomAD_E_NFE: 0.0009%
gnomAD_G_AFR: 0.1322%
gnomAD_G_EAS: 0.2941%
gnomAD_G_NFE: 0.0137%
MISSENSE_VARIANT SNV 14-105419314-T-G [0/1] rs557538603
Pathogenicity Data:
Best Score: 0.612
Polyphen2: 0.013 (B)
SIFT: 0.388 (T)
Frequency Data:
UK10K: 0.0132%
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0298%
gnomAD_E_EAS: 0.0058%
gnomAD_E_FIN: 0.0179%
gnomAD_E_NFE: 0.0673%
gnomAD_E_OTH: 0.0548%
gnomAD_E_SAS: 0.0033%
MISSENSE_VARIANT SNV 14-105413040-T-C [0/1] rs755431279
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.006 (B)
SIFT: 0.007 (D)
Frequency Data:
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0328%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0548%
gnomAD_E_SAS: 0.0032%
gnomAD_G_AFR: 1.7907%
gnomAD_G_AMR: 0.1302%
gnomAD_G_EAS: 1.5228%
gnomAD_G_FIN: 0.1180%
gnomAD_G_NFE: 0.0560%
gnomAD_G_OTH: 0.1087%
SYNONYMOUS_VARIANT SNV 14-105419298-G-A [0/1] rs746412834
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0197%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0032%
gnomAD_G_AFR: 0.0471%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 14-105410502-C-G [0/1] rs1197255416
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.0125%
gnomAD_G_EAS: 0.0668%
gnomAD_G_NFE: 0.0069%
SYNONYMOUS_VARIANT SNV 14-105410508-A-G [0/1] rs1253609445
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_EAS: 0.0678%
gnomAD_G_NFE: 0.0069%
SYNONYMOUS_VARIANT SNV 14-105410481-C-G [0/1] rs1340610489
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.0629%
gnomAD_G_EAS: 0.1376%
gnomAD_G_NFE: 0.0068%
SYNONYMOUS_VARIANT SNV 14-105410352-T-C [0/1] rs554470062
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0998%
TOPMed: 0.0998%
gnomAD_E_AFR: 0.1244%
gnomAD_E_AMR: 0.0089%
gnomAD_E_NFE: 0.0063%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0976%
gnomAD_G_AFR: 0.1686%
gnomAD_G_NFE: 0.0136%
SYNONYMOUS_VARIANT SNV 14-105410463-G-A [0/1] rs777192686
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.1812%
gnomAD_G_EAS: 0.2152%
gnomAD_G_NFE: 0.0136%
SYNONYMOUS_VARIANT SNV 14-105410460-T-C [0/1] rs760792869
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AFR: 0.0204%
ExAC EAS: 0.0116%
ExAC NFE: 0.0015%
ExAC SAS: 0.0303%
gnomAD_E_AFR: 0.0131%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0227%
gnomAD_G_AFR: 0.2503%
gnomAD_G_EAS: 0.2915%
gnomAD_G_NFE: 0.0137%
SYNONYMOUS_VARIANT SNV 14-105410451-T-C [0/1] rs199536215
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0066%
gnomAD_E_SAS: 0.0033%
gnomAD_G_AFR: 0.3233%
gnomAD_G_EAS: 0.6192%
gnomAD_G_NFE: 0.0141%
SYNONYMOUS_VARIANT SNV 14-105412014-C-A [0/1] rs533365075
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0799%
TOPMed: 0.0234%
ExAC EAS: 0.6378%
ExAC NFE: 0.0015%
ExAC SAS: 0.0122%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.5532%
gnomAD_E_NFE: 0.0019%
gnomAD_E_OTH: 0.0191%
gnomAD_E_SAS: 0.0101%
gnomAD_G_EAS: 0.8301%
gnomAD_G_NFE: 0.0085%
MISSENSE_VARIANT SNV 14-105415607-C-G [0/1] rs112699389
Pathogenicity Data:
Best Score: 0.184
Polyphen2: 0.184 (B)
SIFT: 1.000 (T)
Frequency Data:
1000Genomes: 0.3195%
TOPMed: 0.3195%
ExAC AFR: 0.0434%
ExAC AMR: 0.2236%
ExAC EAS: 1.7005%
ExAC NFE: 0.0830%
ExAC OTH: 1.0938%
ExAC SAS: 0.7985%
gnomAD_E_AFR: 0.0274%
gnomAD_E_AMR: 0.0547%
gnomAD_E_EAS: 0.0484%
gnomAD_E_NFE: 0.0014%
gnomAD_E_SAS: 0.0633%
gnomAD_G_AFR: 0.0273%
gnomAD_G_AMR: 0.3390%
gnomAD_G_EAS: 0.5785%
gnomAD_G_NFE: 0.1383%
gnomAD_G_OTH: 0.1639%
SYNONYMOUS_VARIANT SNV 14-105418080-C-A [0/1] rs546876487
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 1.0780%
TOPMed: 1.0780%
gnomAD_E_AFR: 0.2453%
gnomAD_E_AMR: 0.0193%
gnomAD_E_NFE: 0.0024%
gnomAD_E_OTH: 0.0230%
gnomAD_E_SAS: 0.0083%
gnomAD_G_AFR: 1.1684%
gnomAD_G_AMR: 0.1404%
gnomAD_G_EAS: 0.3981%
gnomAD_G_NFE: 0.1363%
gnomAD_G_OTH: 0.5348%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 1-41847872-G-GGCCCGCGCCGGGACGCCCGCCTACTTCGGCGGCTGCAAGGGCGGCGCCTACGGCGGGGGCGGGGGCTTCGGGCCGCCGGCGATGGGCGCTCTGCGCCGTCTGCCCATGCAGACCATCCAGGAGAACAAGCAGGCCAGCTTCGTGCCGGCCGCGGCGCCCTTCCGCCCTGGGGCGCTGCCCGCGCTGCTGCCGCCGCCGCC [1/1] rs1643606760
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 20-29625985-G-C [0/1] rs79368216
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 20-29625985-G-C [0/1] rs79368216
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
STOP_GAINED SNV 20-29632660-G-T [0/1] rs796333808
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SPLICE_DONOR_VARIANT SNV 20-29612103-T-C [0/1] rs73906354
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0200%
INFRAME_INSERTION INS 20-29625924-A-ACTT [0/1] rs377364132
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
DISRUPTIVE_INFRAME_DELETION DEL 20-29628274-TGAAGCAGGGGACATAGAA-T [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 20-29612099-G-A [0/1] rs139498073
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 20-29625984-T-C [0/1] rs80066412
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 20-29625979-C-A [0/1] rs7272849
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 20-29628241-G-C [0/1] rs1436052500
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 20-29628243-T-C [0/1] rs754561929
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 20-29628257-T-C [0/1] rs1035506847
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 20-29628273-A-G [0/1] rs749727422
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 20-29633900-A-G [0/1] rs60081496
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0543%
gnomAD_E_EAS: 0.0060%
gnomAD_E_FIN: 0.0046%
gnomAD_E_NFE: 0.0252%
gnomAD_E_OTH: 0.0190%
gnomAD_E_SAS: 0.0803%
MISSENSE_VARIANT SNV 20-29623224-C-A [0/1] rs779430348
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0515%
gnomAD_E_AMR: 0.0341%
gnomAD_E_EAS: 0.0198%
gnomAD_E_FIN: 0.0228%
gnomAD_E_NFE: 0.0573%
gnomAD_E_OTH: 0.0287%
gnomAD_E_SAS: 0.0467%
gnomAD_G_AFR: 0.0910%
gnomAD_G_EAS: 0.1253%
gnomAD_G_NFE: 0.0515%
MISSENSE_VARIANT SNV 20-29625877-G-A [0/1] rs7266938
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AFR: 0.1137%
ExAC AMR: 0.0087%
ExAC EAS: 0.2110%
ExAC FIN: 0.0152%
ExAC NFE: 0.0153%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0268%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.1000%
gnomAD_E_NFE: 0.0063%
gnomAD_E_OTH: 0.0184%
gnomAD_E_SAS: 0.0066%
SYNONYMOUS_VARIANT SNV 20-29632680-G-A [0/1] rs4892355
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0070%
gnomAD_E_AMR: 0.0385%
gnomAD_E_EAS: 0.2344%
gnomAD_E_NFE: 0.0199%
gnomAD_E_OTH: 0.0195%
gnomAD_E_SAS: 0.0105%
gnomAD_G_AFR: 0.0116%
gnomAD_G_EAS: 0.0708%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_TRUNCATION DEL 3-75713658-AAG-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_TRUNCATION DEL 3-75713658-AAG-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
FRAMESHIFT_TRUNCATION DEL 3-75714805-TG-T [0/1] rs144577984
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
FRAMESHIFT_TRUNCATION DEL 3-75714824-AG-A [0/1] rs373728386
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75715124-C-T [0/1] rs72503535
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.986 (D)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75715181-G-A [0/1] rs4054107
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.979 (D)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714807-G-A [0/1] rs62247158
Pathogenicity Data:
Best Score: 0.998
Polyphen2: 0.998 (D)
SIFT: 0.003 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75713561-C-T [0/1] rs199575562
Pathogenicity Data:
Best Score: 0.996
Polyphen2: 0.888 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0004%
MISSENSE_VARIANT SNV 3-75713563-C-G [0/1] rs201362708
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.944 (P)
SIFT: 0.007 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75715173-C-T [0/1] rs79506752
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.971 (D)
SIFT: 0.007 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75713654-G-A [0/1] rs73840317
Pathogenicity Data:
Best Score: 0.99
Polyphen2: 0.101 (B)
SIFT: 0.010 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714950-C-A [0/1] rs73840338
Pathogenicity Data:
Best Score: 0.986
Polyphen2: 0.986 (D)
SIFT: 0.016 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75713555-G-A [0/1] rs201766868
Pathogenicity Data:
Best Score: 0.982
Polyphen2: 0.982 (D)
SIFT: 0.050 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714345-G-T [0/1] rs73840324
Pathogenicity Data:
Best Score: 0.979
Polyphen2: 0.246 (B)
SIFT: 0.021 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714819-G-A [0/1] rs74497996
Pathogenicity Data:
Best Score: 0.964
Polyphen2: 0.001 (B)
SIFT: 0.036 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714917-G-A [0/1] rs75138472
Pathogenicity Data:
Best Score: 0.959
Polyphen2: 0.002 (B)
SIFT: 0.041 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714771-A-G [0/1] rs79973298
Pathogenicity Data:
Best Score: 0.943
Polyphen2: 0.943 (P)
SIFT: 0.076 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714929-G-A [0/1] rs75980922
Pathogenicity Data:
Best Score: 0.94200003
Polyphen2: 0.905 (P)
SIFT: 0.058 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714809-C-T [0/1] rs77371781
Pathogenicity Data:
Best Score: 0.939
Polyphen2: 0.001 (B)
SIFT: 0.061 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75713618-A-T [0/1] rs78279965
Pathogenicity Data:
Best Score: 0.889
Polyphen2: 0.001 (B)
SIFT: 0.111 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714825-G-A [0/1] rs74640812
Pathogenicity Data:
Best Score: 0.833
Polyphen2: 0.015 (B)
SIFT: 0.167 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714831-G-A [0/1] rs138192454
Pathogenicity Data:
Best Score: 0.815
Polyphen2: 0.001 (B)
SIFT: 0.185 (T)
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 3-75714674-G-A [0/1] rs62247156
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714843-T-A [0/1] rs77860721
Pathogenicity Data:
Best Score: 0.758
Polyphen2: 0.181 (B)
SIFT: 0.242 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75713669-G-A [0/1] rs73840318
Pathogenicity Data:
Best Score: 0.652
Polyphen2: 0.003 (B)
SIFT: 0.348 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714337-T-G [0/1] rs73840323
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714702-A-G [0/1] rs62247157
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714840-A-G [0/1] rs77669108
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75715118-G-A [0/1] rs73840339
Pathogenicity Data:
Best Score: 0.599
SIFT: 0.401 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75715099-T-A [0/1] rs2118760
Pathogenicity Data:
Best Score: 0.376
Polyphen2: 0.001 (B)
SIFT: 0.624 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714298-A-G [0/1] rs74714110
Pathogenicity Data:
Best Score: 0.112999976
SIFT: 0.887 (T)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75713566-T-C [0/1] rs74910647
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714311-G-A [0/1] rs79850029
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714709-G-T [0/1] rs75314787
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714835-C-T [0/1] rs150744016
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714853-G-A [0/1] rs75091771
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714898-G-A [0/1] rs62247159
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714976-C-T [0/1] rs62247960
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75714980-C-A [0/1] rs78599742
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75715033-T-C [0/1] rs79024020
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75715087-T-A [0/1] rs62247961
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75715174-T-G [0/1] rs78974762
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75714788-A-C [0/1] rs77229582
Pathogenicity Data:
Best Score: 0.008000016
SIFT: 0.992 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_VARIANT INS 6-32487158-G-GCA [0/1] rs138885982
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
HLA-DRB5:ENST00000374975.3:c.640_641insTG:p.(Thr214Metfs*17)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT SNV 6-32521178-T-C [0/1] rs1368270719
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
HLA-DRB6:ENST00000411500.1:n.852-2A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.900

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT SNV 6-32521178-T-C [0/1] rs1368270719
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
HLA-DRB6:ENST00000411500.1:n.852-2A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 6-32521179-G-A [0/1] rs113640313
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
HLA-DRB6:ENST00000411500.1:n.852-3C>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SPLICE_REGION_VARIANT SNV 6-32521183-A-G [0/1] rs112119119
Variant score: 0.800
Transcripts:
HLA-DRB6:ENST00000411500.1:n.852-7T>C:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
Other passed variants:

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 19-55358654-T-TGC [0/1] rs2063706973
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 19-55358654-T-TGC [0/1] rs2063706973
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
FRAMESHIFT_TRUNCATION DEL 19-55358657-ATG-A [0/1] rs2063708159
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
FRAMESHIFT_VARIANT INS 19-55358736-C-CA [0/1] rs145114829
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
FRAMESHIFT_TRUNCATION DEL 19-55359243-AAC-A [0/1] rs138992022
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55358645-C-T [0/1] rs144486451
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55358658-T-C [0/1] rs72489166
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55358686-A-C [0/1] rs112697729
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55359210-T-A [0/1] rs78348350
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55359227-A-G [0/1] rs78647568
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55359234-A-G [0/1] rs113921547
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55359255-C-G [0/1] rs1130471
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55359371-A-G [0/1] rs112305589
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55344239-T-G [0/1] rs1130476
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_EAS: 0.0122%
MISSENSE_VARIANT SNV 19-55349320-G-C [0/1] rs1130494
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 1.5180%
TOPMed: 1.5180%
ExAC AFR: 0.0098%
ExAC EAS: 0.0120%
gnomAD_E_EAS: 0.0181%
MISSENSE_VARIANT SNV 19-55349328-T-C [0/1] rs201518955
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 1.5180%
TOPMed: 1.5180%
ExAC EAS: 0.0120%
gnomAD_E_EAS: 0.0182%
gnomAD_E_NFE: 0.0019%
MISSENSE_VARIANT SNV 19-55346565-G-T [0/1] rs1130478
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 1.9570%
TOPMed: 1.9570%
ExAC AFR: 0.0784%
ExAC AMR: 0.0366%
ExAC EAS: 0.0361%
ExAC FIN: 0.1796%
ExAC NFE: 0.1766%
ExAC OTH: 0.3529%
ExAC SAS: 0.0832%
gnomAD_E_AFR: 0.0133%
gnomAD_E_AMR: 0.0160%
gnomAD_E_EAS: 0.0182%
gnomAD_E_FIN: 0.0578%
gnomAD_E_NFE: 0.0972%
gnomAD_E_OTH: 0.0195%
gnomAD_E_SAS: 0.0297%
SYNONYMOUS_VARIANT SNV 19-55358734-G-A [0/1] rs757178914
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 19-55359211-G-T [0/1] rs80015348
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-1887763-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
LSP1:ENST00000381775.1:c.59C>T:p.(Pro20Leu)
LSP1:ENST00000311604.3:c.53+13336C>T:p.(=)
Pathogenicity Data:
Best Score: 1.0
SIFT: 0.000 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT INS 12-40859390-T-TGACCA [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
MUC19:ENST00000454784.4:c.3884-1_3884insACCAG:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-231264881-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 1.0
SIFT: 0.000 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 2-133066897-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ZNF285CP:ENST00000424130.2:n.15+1G>T:
ZNF285CP:ENST00000438300.1:n.15+1G>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.900

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 2-133066897-G-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ZNF285CP:ENST00000424130.2:n.15+1G>T:
ZNF285CP:ENST00000438300.1:n.15+1G>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 2-133074683-T-C [0/1] rs7355726
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
ZNF285CP:ENST00000424130.2:n.144T>C:
ZNF285CP:ENST00000438300.1:n.148T>C:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_TRUNCATION DEL 3-75786041-AG-A [0/1] rs150497643
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_TRUNCATION DEL 3-75786041-AG-A [0/1] rs150497643
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786243-C-T [0/1] rs139633377
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
Other passed variants:
STOP_GAINED SNV 3-75786256-T-A [0/1] rs113251431
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786278-A-C [0/1] rs79811623
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786337-G-A [0/1] rs78596620
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.076 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786354-G-A [0/1] rs77045598
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786417-T-C [0/1] rs77452946
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.001 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786518-A-C [0/1] rs113078821
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786607-C-T [0/1] rs113494751
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.135 (T)
Frequency Data:
No frequency data
STOP_GAINED SNV 3-75786610-T-A [0/1] rs80021495
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786670-G-A [0/1] rs80089603
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.014 (D)
Frequency Data:
No frequency data
FRAMESHIFT_TRUNCATION DEL 3-75786743-TA-T [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786754-G-T [0/1] rs77394685
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.056 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786773-T-A [0/1] rs76175438
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.020 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV 3-75786827-A-T [0/1] rs79635065
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786892-A-C [0/1] rs76826286
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV 3-75786916-C-A [0/1] rs78906544
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786919-A-T [0/1] rs77101176
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.005 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787015-C-T [0/1] rs76263679
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.006 (D)
Frequency Data:
No frequency data
STOP_GAINED INS 3-75787044-A-ACTT [0/1] rs373780316
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787081-A-T [0/1] rs77378861
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787116-T-G [0/1] rs77490669
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.003 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV 3-75787127-G-T [0/1] rs74740396
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787228-A-C [0/1] rs78763958
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787240-A-G [0/1] rs76111663
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787264-C-T [0/1] rs80019510
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.005 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787273-G-T [0/1] rs77118311
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787276-T-C [0/1] rs113168258
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.029 (D)
Frequency Data:
No frequency data
FRAMESHIFT_TRUNCATION DEL 3-75787348-CCCCTG-C [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787405-C-T [0/1] rs73843014
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.023 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787516-C-G [0/1] rs79870536
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.021 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787519-C-A [0/1] rs76144260
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
FRAMESHIFT_TRUNCATION DEL 3-75787645-GAA-G [0/1] rs67579270
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787732-A-C [0/1] rs74776730
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787770-C-T [0/1] rs74873974
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.002 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV 3-75788028-G-C [0/1] rs77971486
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
Frequency Data:
No frequency data
FRAMESHIFT_VARIANT INS 3-75788150-A-AG [0/1] rs143871834
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
FRAMESHIFT_VARIANT INS 3-75788403-G-GT [0/1] rs140509507
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75790466-G-T [0/1] rs78571006
Pathogenicity Data:
Best Score: 1.0
SIFT: 0.000 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786438-G-A [0/1] rs79994093
Pathogenicity Data:
Best Score: 0.999999
Mutation Taster: 1.000 (P)
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786759-T-C [0/1] rs75759940
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.027 (D)
Frequency Data:
gnomAD_E_NFE: 0.0020%
MISSENSE_VARIANT SNV 3-75786288-A-G [0/1] rs76707683
Pathogenicity Data:
Best Score: 0.999
SIFT: 0.001 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787317-T-A [0/1] rs148436228
Pathogenicity Data:
Best Score: 0.999
Mutation Taster: 0.864
SIFT: 0.001 (D)
Frequency Data:
No frequency data
FRAMESHIFT_ELONGATION INS 3-75786035-G-GA [0/1] rs149076283
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_NFE: 0.0092%
MISSENSE_VARIANT SNV 3-75786597-C-T [0/1] rs76585055
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.080 (T)
Frequency Data:
gnomAD_E_EAS: 0.0116%
MISSENSE_VARIANT SNV 3-75786993-T-A [0/1] rs149887072
Pathogenicity Data:
Best Score: 0.998
SIFT: 0.002 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787416-C-T [0/1] rs10442977
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
gnomAD_E_AFR: 0.0290%
MISSENSE_VARIANT SNV 3-75786942-C-A [0/1] rs2918517
Pathogenicity Data:
Best Score: 0.999999
Mutation Taster: 1.000 (P)
SIFT: 0.084 (T)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
gnomAD_E_AFR: 0.0152%
gnomAD_E_EAS: 0.0111%
gnomAD_E_OTH: 0.0275%
gnomAD_G_AFR: 0.0132%
FRAMESHIFT_TRUNCATION DEL 3-75787098-CCT-C [0/1] rs146514807
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0146%
gnomAD_E_NFE: 0.0163%
gnomAD_E_SAS: 0.0551%
gnomAD_G_AFR: 0.0185%
gnomAD_G_NFE: 0.0094%
MISSENSE_VARIANT SNV 3-75788130-C-A [0/1] rs113708852
Pathogenicity Data:
Best Score: 0.992
SIFT: 0.008 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787032-T-C [0/1] rs111273070
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.031 (D)
Frequency Data:
gnomAD_E_EAS: 0.0676%
MISSENSE_VARIANT SNV 3-75786211-A-G [0/1] rs77715040
Pathogenicity Data:
Best Score: 0.987
SIFT: 0.013 (D)
Frequency Data:
gnomAD_E_NFE: 0.0058%
MISSENSE_VARIANT SNV 3-75786036-A-G [0/1] rs113748085
Pathogenicity Data:
Best Score: 0.982
SIFT: 0.018 (D)
Frequency Data:
TOPMed: 0.0004%
MISSENSE_VARIANT SNV 3-75787927-A-G [0/1] rs75388892
Pathogenicity Data:
Best Score: 0.978051
Mutation Taster: 0.978 (P)
SIFT: 0.124 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75781272-C-A [0/1] rs79724453
Variant score: 0.978
Transcripts:
ZNF717:ENST00000477374.1:c.278G>T:p.(Gly93Val)
Pathogenicity Data:
Best Score: 0.978
SIFT: 0.022 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788227-A-G [0/1] rs79108208
Pathogenicity Data:
Best Score: 0.977
SIFT: 0.023 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786225-G-A [0/1] rs76757483
Pathogenicity Data:
Best Score: 0.973
SIFT: 0.027 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75781257-T-G [0/1] rs62250086
Variant score: 0.969
Transcripts:
ZNF717:ENST00000477374.1:c.293A>C:p.(Gln98Pro)
Pathogenicity Data:
Best Score: 0.969
SIFT: 0.031 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786042-G-A [0/1] rs77747132
Pathogenicity Data:
Best Score: 0.962
SIFT: 0.038 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787204-C-A [0/1] rs75063165
Pathogenicity Data:
Best Score: 0.951
SIFT: 0.049 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75790472-C-T [0/1] rs200497785
Pathogenicity Data:
Best Score: 0.939
SIFT: 0.061 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786802-G-A [0/1] rs77826574
Pathogenicity Data:
Best Score: 0.93299997
SIFT: 0.067 (T)
Frequency Data:
gnomAD_E_AMR: 0.0215%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0270%
gnomAD_E_SAS: 0.0198%
gnomAD_G_AFR: 0.0135%
gnomAD_G_NFE: 0.0148%
MISSENSE_VARIANT SNV 3-75788432-T-A [0/1] rs74703212
Pathogenicity Data:
Best Score: 0.928
SIFT: 0.072 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786991-C-T [0/1] rs76496075
Pathogenicity Data:
Best Score: 0.901
SIFT: 0.099 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788115-G-A [0/1] rs62246570
Pathogenicity Data:
Best Score: 0.902
SIFT: 0.098 (T)
Frequency Data:
gnomAD_E_EAS: 0.0148%
MISSENSE_VARIANT SNV 3-75788484-A-G [0/1] rs74485599
Pathogenicity Data:
Best Score: 0.898
SIFT: 0.102 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787897-T-C [0/1] rs77452021
Pathogenicity Data:
Best Score: 0.879
SIFT: 0.121 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786501-T-A [0/1] rs372539402
Pathogenicity Data:
Best Score: 0.878
SIFT: 0.122 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787159-C-T [0/1] rs77322475
Pathogenicity Data:
Best Score: 0.943
SIFT: 0.057 (D)
Frequency Data:
gnomAD_E_AFR: 0.0215%
gnomAD_E_NFE: 0.0271%
gnomAD_E_SAS: 0.4466%
gnomAD_G_AFR: 0.0223%
gnomAD_G_NFE: 0.0231%
MISSENSE_VARIANT SNV 3-75786450-G-A [0/1] rs77097895
Pathogenicity Data:
Best Score: 0.86800003
SIFT: 0.132 (T)
Frequency Data:
gnomAD_E_AFR: 0.0313%
DISRUPTIVE_INFRAME_DELETION DEL 3-75786314-CCTACATTCT-C [0/1] rs66703079
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
INFRAME_DELETION DEL 3-75786817-CACATTCATT-C [0/1] rs57577072
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
DISRUPTIVE_INFRAME_INSERTION INS 3-75787353-G-GAAA [0/1]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788226-C-A [0/1] rs74816619
Pathogenicity Data:
Best Score: 0.837
SIFT: 0.163 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787726-G-A [0/1] rs1962893
Pathogenicity Data:
Best Score: 0.806
SIFT: 0.194 (T)
Frequency Data:
gnomAD_E_SAS: 0.0159%
MISSENSE_VARIANT SNV 3-75788316-C-T [0/1] rs79165653
Pathogenicity Data:
Best Score: 0.803
SIFT: 0.197 (T)
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 3-75788504-G-A [0/1] rs796592912
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 3-75790527-T-C [0/1] rs75965304
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786740-C-G [0/1] rs74699492
Pathogenicity Data:
Best Score: 0.796
SIFT: 0.204 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786298-T-C [0/1] rs76137150
Pathogenicity Data:
Best Score: 0.786
SIFT: 0.214 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786490-C-G [0/1] rs113382015
Pathogenicity Data:
Best Score: 0.763
SIFT: 0.237 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788158-G-C [0/1] rs3009004
Pathogenicity Data:
Best Score: 0.741
SIFT: 0.259 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788088-C-T [0/1] rs77856895
Pathogenicity Data:
Best Score: 0.726
SIFT: 0.274 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75790447-G-A [0/1] rs76526276
Pathogenicity Data:
Best Score: 0.713
SIFT: 0.287 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786071-C-A [0/1] rs111230396
Pathogenicity Data:
Best Score: 0.7
SIFT: 0.300 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787962-G-C [0/1] rs79540623
Pathogenicity Data:
Best Score: 0.68200004
SIFT: 0.318 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787224-C-T [0/1] rs112847134
Pathogenicity Data:
Best Score: 0.671
SIFT: 0.329 (T)
Frequency Data:
TOPMed: 0.0038%
MISSENSE_VARIANT SNV 3-75787305-C-T [0/1] rs77389541
Pathogenicity Data:
Best Score: 0.649
SIFT: 0.351 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787222-A-G [0/1] rs78680336
Pathogenicity Data:
Best Score: 0.62
SIFT: 0.380 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786619-T-C [0/1] rs77250491
Pathogenicity Data:
Best Score: 0.616
SIFT: 0.384 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786079-C-T [0/1] rs202061186
Pathogenicity Data:
Best Score: 0.62
SIFT: 0.380 (T)
Frequency Data:
gnomAD_G_AFR: 0.0804%
MISSENSE_VARIANT SNV 3-75790444-G-A [0/1] rs1971517
Pathogenicity Data:
Best Score: 0.60899997
SIFT: 0.391 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788023-C-T [0/1] rs76889571
Pathogenicity Data:
Best Score: 0.595
SIFT: 0.405 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788366-C-A [0/1] rs80085410
Pathogenicity Data:
Best Score: 0.593
SIFT: 0.407 (T)
Frequency Data:
gnomAD_E_NFE: 0.0091%
gnomAD_G_AMR: 0.4785%
gnomAD_G_EAS: 0.2252%
gnomAD_G_FIN: 0.4098%
gnomAD_G_NFE: 0.0948%
gnomAD_G_OTH: 0.4608%
MISSENSE_VARIANT SNV 3-75781243-T-C [0/1] rs62250085
Variant score: 0.538
Transcripts:
ZNF717:ENST00000477374.1:c.307A>G:p.(Ile103Val)
Pathogenicity Data:
Best Score: 0.538
SIFT: 0.462 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786379-T-C [0/1] rs80170761
Pathogenicity Data:
Best Score: 0.525
SIFT: 0.475 (T)
Frequency Data:
gnomAD_E_NFE: 0.0039%
MISSENSE_VARIANT SNV 3-75786245-T-A [0/1] rs149660902
Pathogenicity Data:
Best Score: 0.513
SIFT: 0.487 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786784-T-C [0/1] rs78490340
Pathogenicity Data:
Best Score: 0.513
SIFT: 0.487 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788068-A-C [0/1] rs74357986
Pathogenicity Data:
Best Score: 0.50699997
SIFT: 0.493 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786618-C-A [0/1] rs140085908
Pathogenicity Data:
Best Score: 0.49400002
SIFT: 0.506 (T)
Frequency Data:
TOPMed: 0.0008%
MISSENSE_VARIANT SNV 3-75787794-A-G [0/1] rs75467043
Pathogenicity Data:
Best Score: 0.621
SIFT: 0.379 (T)
Frequency Data:
ExAC AFR: 0.3497%
ExAC NFE: 0.2069%
ExAC SAS: 0.0965%
gnomAD_E_AFR: 0.4339%
gnomAD_E_AMR: 1.0563%
gnomAD_E_EAS: 0.6369%
gnomAD_E_FIN: 0.0977%
gnomAD_E_NFE: 0.6241%
gnomAD_E_OTH: 1.0050%
gnomAD_E_SAS: 0.7068%
gnomAD_G_AFR: 0.5263%
gnomAD_G_EAS: 0.4545%
gnomAD_G_FIN: 0.0942%
gnomAD_G_NFE: 0.6169%
MISSENSE_VARIANT SNV 3-75786741-A-G [0/1] rs79103664
Pathogenicity Data:
Best Score: 0.42299998
SIFT: 0.577 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788010-A-C [1/1] rs3009006
Pathogenicity Data:
Best Score: 0.531
SIFT: 0.469 (T)
Frequency Data:
gnomAD_E_AFR: 0.0842%
gnomAD_E_AMR: 0.8284%
gnomAD_E_EAS: 1.0030%
gnomAD_E_NFE: 0.1708%
gnomAD_E_OTH: 0.6536%
gnomAD_E_SAS: 0.2796%
MISSENSE_VARIANT SNV 3-75787801-T-C [0/1] rs200891949
Pathogenicity Data:
Best Score: 0.376
SIFT: 0.624 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75788281-T-C [0/1] rs76243986
Pathogenicity Data:
Best Score: 0.49400002
SIFT: 0.506 (T)
Frequency Data:
gnomAD_E_AFR: 0.0315%
gnomAD_E_AMR: 0.0160%
gnomAD_E_EAS: 0.0288%
gnomAD_E_NFE: 0.0431%
gnomAD_G_AFR: 0.7027%
gnomAD_G_AMR: 1.1494%
gnomAD_G_EAS: 0.8427%
gnomAD_G_FIN: 0.1264%
gnomAD_G_NFE: 0.5653%
gnomAD_G_OTH: 1.0695%
SPLICE_REGION_VARIANT SNV 3-75790419-T-C [0/1] rs201067375
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 1.4888%
gnomAD_G_AMR: 1.6484%
gnomAD_G_FIN: 1.0949%
gnomAD_G_NFE: 1.5110%
gnomAD_G_OTH: 0.6098%
SPLICE_REGION_VARIANT SNV 3-75790420-G-A [0/1] rs201879005
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 1.5038%
gnomAD_G_AMR: 1.6484%
gnomAD_G_FIN: 1.0922%
gnomAD_G_NFE: 1.5257%
gnomAD_G_OTH: 0.6250%
MISSENSE_VARIANT SNV 3-75788362-A-T [0/1] rs754406448
Pathogenicity Data:
Best Score: 0.36699998
SIFT: 0.633 (T)
Frequency Data:
gnomAD_G_AMR: 0.4808%
gnomAD_G_EAS: 0.2273%
gnomAD_G_FIN: 0.2927%
gnomAD_G_NFE: 0.0677%
gnomAD_G_OTH: 0.4405%
MISSENSE_VARIANT SNV 3-75788199-T-C [0/1] rs77110669
Pathogenicity Data:
Best Score: 0.269
SIFT: 0.731 (T)
Frequency Data:
gnomAD_E_FIN: 0.0080%
MISSENSE_VARIANT SNV 3-75786628-G-C [0/1] rs3009023
Pathogenicity Data:
Best Score: 0.20899999
SIFT: 0.791 (T)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0599%
gnomAD_E_AMR: 0.0045%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0057%
MISSENSE_VARIANT SNV 3-75790427-C-T [0/1] rs199946555
Pathogenicity Data:
Best Score: 0.877
SIFT: 0.123 (T)
Frequency Data:
gnomAD_E_AFR: 0.0855%
gnomAD_E_AMR: 0.1728%
gnomAD_E_FIN: 0.3078%
gnomAD_E_NFE: 0.5178%
gnomAD_E_OTH: 0.2488%
gnomAD_E_SAS: 1.0075%
gnomAD_G_AFR: 1.5723%
gnomAD_G_AMR: 1.7442%
gnomAD_G_EAS: 0.5435%
gnomAD_G_FIN: 1.4031%
gnomAD_G_NFE: 1.7981%
gnomAD_G_OTH: 1.9481%
MISSENSE_VARIANT SNV 3-75787464-C-T [0/1] rs74861398
Pathogenicity Data:
Best Score: 0.14600003
SIFT: 0.854 (T)
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786059-C-T [0/1] rs73843008
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786302-G-A [0/1] rs80001478
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786476-G-A [0/1] rs111381670
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786506-T-C [0/1] rs79902440
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786521-G-A [0/1] rs76396775
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786533-T-G [0/1] rs79051543
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786623-G-T [0/1] rs78134363
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786854-A-T [0/1] rs76921234
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786866-G-T [0/1] rs79516801
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786965-C-T [0/1] rs76347222
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787043-G-A [0/1] rs78806516
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787145-T-C [0/1] rs79560192
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787202-G-T [0/1] rs76713735
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787208-G-A [0/1] rs79982156
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787265-C-G [0/1] rs77829652
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787304-A-T [0/1] rs77311242
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787427-T-C [0/1] rs76082496
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787637-C-T [0/1] rs28632074
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787679-T-C [0/1] rs74620322
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787688-T-A [0/1] rs77688099
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787802-G-A [0/1] rs201430954
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787880-A-G [0/1] rs78071099
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75787961-A-G [0/1] rs76334908
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75788291-A-G [0/1] rs75972102
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75788489-C-T [0/1] rs111354562
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75790446-G-T [0/1] rs79202307
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75790479-C-T [0/1] rs79902868
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75790822-A-G [0/1] rs2918520
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 3-75786899-T-C [0/1] rs78828372
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC NFE: 0.0123%
gnomAD_E_AMR: 0.0045%
gnomAD_E_NFE: 0.0093%
SYNONYMOUS_VARIANT SNV 3-75787949-C-T [0/1] rs76105745
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.2376%
gnomAD_E_AMR: 0.4876%
gnomAD_E_EAS: 0.2569%
gnomAD_E_FIN: 0.1065%
gnomAD_E_NFE: 0.2428%
gnomAD_E_OTH: 0.1225%
gnomAD_E_SAS: 0.1079%
gnomAD_G_AFR: 0.2022%
gnomAD_G_AMR: 0.4854%
gnomAD_G_NFE: 0.1141%
SYNONYMOUS_VARIANT SNV 3-75786080-G-A [0/1] rs2118754
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_EAS: 0.7576%
gnomAD_G_NFE: 0.0330%
SYNONYMOUS_VARIANT SNV 3-75788258-C-A [0/1] rs79526626
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0510%
gnomAD_E_AMR: 0.0229%
gnomAD_E_NFE: 0.0047%
gnomAD_E_SAS: 0.0228%
gnomAD_G_AFR: 0.4636%
gnomAD_G_AMR: 1.2821%
gnomAD_G_EAS: 0.2463%
gnomAD_G_FIN: 0.2160%
gnomAD_G_NFE: 0.4739%
gnomAD_G_OTH: 0.7538%
MISSENSE_VARIANT SNV 3-75788434-G-T [0/1] rs4011155
Pathogenicity Data:
Best Score: 0.021000028
SIFT: 0.979 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786060-A-G [0/1] rs76046078
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75786469-G-A [0/1] rs113197025
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 3-75787458-G-A [0/1] rs76333414
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-156702151-C-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.999977
Mutation Taster: 1.000 (P)
SIFT: 0.174 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
Known diseases:
ORPHA:269 Facioscapulohumeral dystrophy - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 4-190881969-G-A [0/1] rs6846627
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
FRG1:ENST00000226798.4:c.604G>A:p.(Val202Ile)
Pathogenicity Data:
Best Score: 0.999968
Polyphen2: 0.038 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.132 (T)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 4-190881969-G-A [0/1] rs6846627
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
FRG1:ENST00000226798.4:c.604G>A:p.(Val202Ile)
Pathogenicity Data:
Best Score: 0.999968
Polyphen2: 0.038 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.132 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 4-190874255-A-T [0/1] rs17425201
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.997 CONTRIBUTING VARIANT
Transcripts:
FRG1:ENST00000226798.4:c.292A>T:p.(Thr98Ser)
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.083 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.046 (D)
Frequency Data:
gnomAD_E_AFR: 0.0219%
gnomAD_E_AMR: 0.0094%
gnomAD_E_NFE: 0.0077%
gnomAD_E_SAS: 0.0035%
Other passed variants:
MISSENSE_VARIANT SNV 4-190876196-G-A [0/1] rs17425208
Variant score: 0.996
Transcripts:
FRG1:ENST00000226798.4:c.322G>A:p.(Ala108Thr)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.241 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.038 (D)
Frequency Data:
TOPMed: 0.0019%
ExAC FIN: 0.0303%
ExAC NFE: 0.0075%
ExAC SAS: 0.0121%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0098%
SPLICE_REGION_VARIANT SNV 4-190881997-A-G [0/1] rs77084305
Variant score: 0.800
Transcripts:
FRG1:ENST00000226798.4:c.629+3A>G:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_NFE: 0.0010%
SPLICE_REGION_VARIANT SNV 4-190881992-T-C [0/1] rs75112782
Variant score: 0.798
Transcripts:
FRG1:ENST00000226798.4:c.627T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_OTH: 0.0204%
MISSENSE_VARIANT SNV 4-190881933-A-G [0/1] rs184307882
Variant score: 0.576
Transcripts:
FRG1:ENST00000226798.4:c.568A>G:p.(Lys190Glu)
Pathogenicity Data:
Best Score: 0.575598
Polyphen2: 0.034 (B)
Mutation Taster: 0.576
SIFT: 0.615 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-168720112-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.99996
Polyphen2: 0.997 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.003 (D)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-45649651-T-C [0/1] rs1435233668
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 9-68433464-C-T [0/1] rs79004307
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.695+1G>A:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.900

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 9-68433464-C-T [0/1] rs79004307
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.695+1G>A:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
SPLICE_REGION_VARIANT SNV 9-68430172-A-G [0/1] rs796550725
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.785T>C:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SPLICE_REGION_VARIANT SNV 9-68430269-T-A [0/1] rs146972178
Variant score: 0.800
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.696-8A>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 9-68433462-T-C [0/1] rs111392331
Variant score: 0.800
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.695+3A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT DEL 9-68438557-CCTT-C [0/1] rs144201632
Variant score: 0.800
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.410_412del:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 9-68438558-C-T [0/1] rs202077200
Variant score: 0.800
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.412G>A:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
SPLICE_REGION_VARIANT SNV 9-68430167-T-C [0/1] rs796325229
Variant score: 0.800
Transcripts:
RP11-764K9.4:ENST00000376334.3:n.787+3A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0045%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 9-67927076-G-A [0/1] rs1587593556
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ANKRD20A1:ENST00000377477.2:c.203+1G>A:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_DONOR_VARIANT SNV 9-67927076-G-A [0/1] rs1587593556
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
ANKRD20A1:ENST00000377477.2:c.203+1G>A:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
MISSENSE_VARIANT SNV 9-67927062-G-A [0/1] rs1587593550
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.995 CONTRIBUTING VARIANT
Transcripts:
ANKRD20A1:ENST00000377477.2:c.190G>A:p.(Asp64Asn)
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.995 (D)
Frequency Data:
No frequency data
Other passed variants:
SYNONYMOUS_VARIANT SNV 9-67927043-C-T [0/1] rs1275954344
Variant score: 0.100
Transcripts:
ANKRD20A1:ENST00000377477.2:c.171C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SYNONYMOUS_VARIANT SNV 9-67927052-G-A [0/1] rs1587593541
Variant score: 0.100
Transcripts:
ANKRD20A1:ENST00000377477.2:c.180G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-55172708-T-G [0/1] rs1047034
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.271 (B)
SIFT: 0.000 (D)
Frequency Data:
ExAC NFE: 0.0021%
gnomAD_E_NFE: 0.0012%

X_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-55172708-T-G [0/1] rs1047034
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.271 (B)
SIFT: 0.000 (D)
Frequency Data:
ExAC NFE: 0.0021%
gnomAD_E_NFE: 0.0012%
Other passed variants:
MISSENSE_VARIANT SNV X-55172716-C-T [0/1] rs5018688
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.760 (P)
SIFT: 0.007 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV X-55172687-T-C [0/1] rs1047037
Pathogenicity Data:
Best Score: 0.986
Polyphen2: 0.062 (B)
SIFT: 0.014 (D)
Frequency Data:
No frequency data
STOP_GAINED SNV X-55172537-G-A [0/1] rs1047054
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AFR: 0.4172%
ExAC FIN: 0.0244%
ExAC NFE: 0.0070%
ExAC SAS: 0.0112%
gnomAD_E_AFR: 0.0176%
gnomAD_E_NFE: 0.0026%
gnomAD_E_SAS: 0.0054%
MISSENSE_VARIANT SNV X-55172659-A-G [0/1] rs5018687
Pathogenicity Data:
Best Score: 0.677
Polyphen2: 0.677 (P)
SIFT: 0.403 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV X-55172645-C-T [0/1] rs1047042
Pathogenicity Data:
Best Score: 0.325
Polyphen2: 0.001 (B)
SIFT: 0.675 (T)
Frequency Data:
1000Genomes: 0.1325%
TOPMed: 0.1325%
SYNONYMOUS_VARIANT SNV X-55187581-G-T [0/1] rs1602316798
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 1.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-81294838-G-C [0/1] rs760677834
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 1.000 CONTRIBUTING VARIANT
Transcripts:
TLNRD1:ENST00000267984.2:c.226G>C:p.(Glu76Gln)
Pathogenicity Data:
Best Score: 0.999999
Polyphen2: 0.318 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.240 (T)
Frequency Data:
TOPMed: 0.0023%
ExAC NFE: 0.0018%
gnomAD_E_NFE: 0.0013%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-140201733-A-G [0/1] rs782800067
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.017 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.261 (T)
Frequency Data:
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.999

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 9-69423792-A-T [0/1] rs75696372
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.999 CONTRIBUTING VARIANT
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.2088A>T:p.(Gln696His)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.001 (B)
SIFT: 0.000 (D)
Frequency Data:
gnomAD_E_SAS: 0.0069%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 9-69423792-A-T [0/1] rs75696372
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.999 CONTRIBUTING VARIANT
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.2088A>T:p.(Gln696His)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.001 (B)
SIFT: 0.000 (D)
Frequency Data:
gnomAD_E_SAS: 0.0069%
MISSENSE_VARIANT SNV 9-69423703-A-C [0/1] rs200741673
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.982 CONTRIBUTING VARIANT
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.1999A>C:p.(Thr667Pro)
Pathogenicity Data:
Best Score: 0.982
Polyphen2: 0.009 (B)
SIFT: 0.018 (D)
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 9-69423550-G-T [0/1] rs200486187
Variant score: 0.904
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.1846G>T:p.(Ala616Ser)
Pathogenicity Data:
Best Score: 0.904
Polyphen2: 0.662 (P)
SIFT: 0.096 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 9-69391111-G-A [0/1] rs796094018
Variant score: 0.491
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.619G>A:p.(Val207Ile)
Pathogenicity Data:
Best Score: 0.549
Polyphen2: 0.013 (B)
SIFT: 0.451 (T)
Frequency Data:
gnomAD_G_AFR: 0.5743%
gnomAD_G_AMR: 0.1678%
gnomAD_G_FIN: 0.1068%
gnomAD_G_NFE: 0.0338%
gnomAD_G_OTH: 0.1319%
MISSENSE_VARIANT SNV 9-69391114-T-C [0/1] rs1309858726
Variant score: 0.400
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.622T>C:p.(Tyr208His)
Pathogenicity Data:
Best Score: 0.45499998
Polyphen2: 0.000 (B)
SIFT: 0.545 (T)
Frequency Data:
gnomAD_G_AFR: 0.6425%
gnomAD_G_AMR: 0.3322%
gnomAD_G_EAS: 0.0768%
gnomAD_G_FIN: 0.0730%
gnomAD_G_NFE: 0.0595%
gnomAD_G_OTH: 0.1348%
MISSENSE_VARIANT SNV 9-69423755-G-C [0/1] rs77404847
Variant score: 0.288
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.2051G>C:p.(Ser684Thr)
Pathogenicity Data:
Best Score: 0.288
Polyphen2: 0.000 (B)
SIFT: 0.712 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 9-69423700-G-A [0/1] rs79174276
Variant score: 0.000
Transcripts:
ANKRD20A4P:ENST00000357336.3:c.1996G>A:p.(Glu666Lys)
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
SIFT: 1.000 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-7386114-A-G [0/1] rs199996601
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.001 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.605 (T)
Frequency Data:
gnomAD_E_AMR: 0.0032%
gnomAD_E_NFE: 0.0121%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.998

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-6939829-C-T [0/1] rs782204273
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.981 (D)
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0011%
ExAC EAS: 0.0127%
gnomAD_E_EAS: 0.0058%
gnomAD_E_SAS: 0.0033%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.549

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-6939829-C-T [0/1] rs782204273
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.981 (D)
Mutation Taster: 1.000 (P)
Frequency Data:
TOPMed: 0.0011%
ExAC EAS: 0.0127%
gnomAD_E_EAS: 0.0058%
gnomAD_E_SAS: 0.0033%
SYNONYMOUS_VARIANT SNV 12-6937983-C-A [0/1] rs1486125401
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_G_AFR: 0.0120%

Exomiser Score: 0.016

Phenotype Score: 0.250

Variant Score: 0.715

Phenotype matches:
Phenotypic similarity 0.403 to mouse mutant involving ST14.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005650, abnormal limb bud morphology
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb - MP:0005650, abnormal limb bud morphology
HP:0010055, Broad hallux - MP:0005650, abnormal limb bud morphology
Proximity score 0.500 in interactome to MMP14 and phenotypic similarity 0.638 to Multicentric osteolysis-nodulosis-arthropathy spectrum associated with MMP14.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001230, Broad metacarpals
HP:0001363, Craniosynostosis - HP:0005441, Sclerotic cranial sutures
HP:0011304, Broad thumb - HP:0001230, Broad metacarpals
HP:0010055, Broad hallux - HP:0006234, Osteolysis involving tarsal bones
Proximity score 0.500 in interactome to MMP14 and phenotypic similarity 0.702 to mouse mutant of MMP14.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003055, abnormal long bone epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0002835, abnormal cranial suture morphology
HP:0011304, Broad thumb - MP:0003055, abnormal long bone epiphyseal plate morphology
HP:0010055, Broad hallux - MP:0003055, abnormal long bone epiphyseal plate morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:602400 Ichthyosis, congenital, autosomal recessive 11 - autosomal recessive
ORPHA:91132 Ichthyosis-hypotrichosis syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.250

Variant Score: 0.715

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-130060579-G-A [0/1] rs758552937
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.715 CONTRIBUTING VARIANT
Transcripts:
ST14:ENST00000278742.5:c.865G>A:p.(Ala289Thr)
Pathogenicity Data:
Best Score: 0.71500003
Polyphen2: 0.063 (B)
SIFT: 0.285 (T)
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_NFE: 0.0038%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-194349230-T-C [0/1] rs200109302
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.999 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.004 (D)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_OTH: 0.0184%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-1784444-G-A [0/1] rs746674332
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999
Polyphen2: 0.563 (P)
Mutation Taster: 0.904
SIFT: 0.001 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC SAS: 0.0125%
gnomAD_E_SAS: 0.0042%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

Phenotype matches:
No phenotype or PPI evidence
Known diseases:
OMIM:618074 ?Epilepsy, familial adult myoclonic, 6 (unconfirmed)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.997

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-24762086-G-C [0/1] rs777624725
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.997
Polyphen2: 0.104 (B)
SIFT: 0.003 (D)
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_ELONGATION INS 16-22087020-A-ATGATCCTTTTCTGTATGGCTGCCCTAATATTTCCAATAGGATTTTACATCAAT [0/1] rs777064731
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0138%
gnomAD_E_NFE: 0.0176%
gnomAD_E_OTH: 0.0266%
gnomAD_E_SAS: 0.0176%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.996

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 16-28509412-C-T [0/1] rs765533147
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
TOPMed: 0.0008%
ExAC EAS: 0.0242%
gnomAD_E_EAS: 0.0315%

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.995

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.016

Phenotype Score: 0.000

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.995 (D)
SIFT: 0.011 (D)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55377348-G-C [0/1] rs150217832
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Pathogenicity Data:
Best Score: 0.995
Polyphen2: 0.995 (D)
SIFT: 0.011 (D)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377325-C-T [0/1] rs1338748485
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.993
Polyphen2: 0.993 (D)
SIFT: 0.630 (T)
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 19-55367083-A-G [0/1] rs985925024
Pathogenicity Data:
Best Score: 0.99
Polyphen2: 0.990 (D)
SIFT: 0.118 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377343-C-T [0/1] rs138402445
Pathogenicity Data:
Best Score: 0.982
Polyphen2: 0.724 (P)
SIFT: 0.018 (D)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0027%
MISSENSE_VARIANT SNV 19-55377302-T-C [0/1] rs1224475740
Pathogenicity Data:
Best Score: 0.966
Polyphen2: 0.966 (D)
SIFT: 0.105 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377265-T-C [0/1] rs796466301
Pathogenicity Data:
Best Score: 0.866
SIFT: 0.134 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377280-G-A [0/1] rs796782943
Pathogenicity Data:
Best Score: 0.848
Polyphen2: 0.010 (B)
SIFT: 0.152 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377875-C-G [0/1] rs973541788
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377319-C-A [0/1] rs1296399738
Pathogenicity Data:
Best Score: 0.491
Polyphen2: 0.009 (B)
SIFT: 0.509 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 19-55377340-T-C [0/1] rs2915987
Pathogenicity Data:
Best Score: 0.004
Polyphen2: 0.004 (B)
Frequency Data:
gnomAD_E_AMR: 0.0060%
MISSENSE_VARIANT SNV 19-55377307-T-A [0/1] rs2915986
Pathogenicity Data:
Best Score: 0.001
Polyphen2: 0.001 (B)
Frequency Data:
ExAC NFE: 0.0015%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.995

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.995

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_VARIANT INS 1-49201966-C-CT [0/1] rs756345162
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AFR: 0.0390%
ExAC EAS: 0.0118%
ExAC NFE: 0.0305%
ExAC SAS: 0.0188%

Exomiser Score: 0.015

Phenotype Score: 0.285

Variant Score: 0.672

Phenotype matches:
Phenotypic similarity 0.285 to zebrafish mutant involving KNG1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0019878, Meckel's cartilage truncated, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:619363 Angioedema, hereditary, 6 - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.285

Variant Score: 0.672

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-186440260-G-A [0/1] rs775305074
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.676
Polyphen2: 0.324 (B)
SIFT: 0.324 (T)
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0466%
gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-37027738-C-T [0/1] rs1927713694
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.994 CONTRIBUTING VARIANT
Transcripts:
FAM47C:ENST00000358047.3:c.1255C>T:p.(Pro419Ser)
Pathogenicity Data:
Best Score: 0.994
Polyphen2: 0.994 (D)
SIFT: 0.489 (T)
Frequency Data:
No frequency data

X_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-37027738-C-T [0/1] rs1927713694
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.994 CONTRIBUTING VARIANT
Transcripts:
FAM47C:ENST00000358047.3:c.1255C>T:p.(Pro419Ser)
Pathogenicity Data:
Best Score: 0.994
Polyphen2: 0.994 (D)
SIFT: 0.489 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.994

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-86393732-T-C [0/1] rs556796647
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.999366
Polyphen2: 0.512 (P)
Mutation Taster: 0.999 (P)
SIFT: 0.171 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0026%
ExAC EAS: 0.0351%
gnomAD_E_EAS: 0.0407%

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.993

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.993

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-1159283-G-A [0/1] rs767039287
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.980 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.019 (D)
Frequency Data:
TOPMed: 0.0011%
ExAC FIN: 0.0473%
ExAC NFE: 0.0015%
gnomAD_E_AMR: 0.0030%
gnomAD_E_FIN: 0.0240%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0032%
gnomAD_G_AFR: 0.0116%

Exomiser Score: 0.015

Phenotype Score: 0.510

Variant Score: 0.415

Phenotype matches:
Proximity score 0.510 in interactome to FSTL1 and phenotypic similarity 0.735 to mouse mutant of FSTL1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0020040, decreased bone ossification
HP:0011304, Broad thumb - MP:0008730, fused phalanges
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.510

Variant Score: 0.415

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-145073062-C-T [0/1] rs200572757
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.99938
Polyphen2: 0.934 (P)
Mutation Taster: 0.999 (P)
SIFT: 0.004 (D)
Frequency Data:
1000Genomes: 0.1398%
TOPMed: 0.0366%
ExAC EAS: 1.0956%
gnomAD_E_EAS: 1.0302%
gnomAD_E_OTH: 0.0377%
gnomAD_G_EAS: 1.0533%
SYNONYMOUS_VARIANT SNV 6-144898334-G-A [0/1] rs761662499
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
UTRN:ENST00000367545.3:c.7389G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ExAC EAS: 0.0117%
gnomAD_E_EAS: 0.0116%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.510

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-144898334-G-A [0/1] rs761662499
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
UTRN:ENST00000367545.3:c.7389G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ExAC EAS: 0.0117%
gnomAD_E_EAS: 0.0116%

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.991

Phenotype matches:
No phenotype or PPI evidence
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:206100 Anemia, hypochromic microcytic, with iron overload 1 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.991

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-51385452-G-A [0/1] rs118034836
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0200%
ExAC EAS: 0.0604%
gnomAD_E_EAS: 0.0581%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.990

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.000

Variant Score: 0.990

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-14200695-G-A [0/1] rs572586577
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Variant score: 0.990 CONTRIBUTING VARIANT
Transcripts:
SAMD1:ENST00000533683.2:c.538C>T:p.(Arg180Cys)
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.005 (B)
Mutation Taster: 0.995 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0091%
ExAC SAS: 0.0689%
gnomAD_E_NFE: 0.0060%
gnomAD_E_SAS: 0.0263%
gnomAD_G_NFE: 0.0143%

Exomiser Score: 0.015

Phenotype Score: 0.252

Variant Score: 0.703

Phenotype matches:
Phenotypic similarity 0.506 to Hypocalcemic vitamin D-dependent rickets associated with CYP2R1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002970, Genu varum
HP:0001363, Craniosynostosis - HP:0010537, Wide cranial sutures
HP:0011304, Broad thumb - HP:0002982, Tibial bowing
HP:0010055, Broad hallux - HP:0003029, Enlargement of the ankles
Proximity score 0.504 in interactome to DHCR7 and phenotypic similarity 0.681 to Smith-Lemli-Opitz syndrome associated with DHCR7.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0004422, Biparietal narrowing
HP:0011304, Broad thumb - HP:0009623, Proximal placement of thumb
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Proximity score 0.504 in interactome to DHCR7 and phenotypic similarity 0.737 to mouse mutant of DHCR7.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:600081 Rickets due to defect in vitamin D 25-hydroxylation deficiency - autosomal recessive
ORPHA:289157 Hypocalcemic vitamin D-dependent rickets - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.015

Phenotype Score: 0.252

Variant Score: 0.703

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-14913577-A-G [0/1] rs555180485
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.703 CONTRIBUTING VARIANT
Transcripts:
CYP2R1:ENST00000334636.5:c.175T>C:p.(Ser59Pro)
Pathogenicity Data:
Best Score: 0.70500004
Polyphen2: 0.006 (B)
SIFT: 0.295 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0004%
gnomAD_E_EAS: 0.0058%

ZFX

Exomiser Score: 0.015

Phenotype Score: 0.501

Variant Score: 0.420

Phenotype matches:
Proximity score 0.501 in interactome to POLA1 and phenotypic similarity 0.625 to X-linked intellectual disability, Van Esch type associated with POLA1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger
HP:0001363, Craniosynostosis - HP:0004440, Coronal craniosynostosis
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.015

Phenotype Score: 0.501

Variant Score: 0.420

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-24228952-T-C [0/1] rs371967051
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.449
Polyphen2: 0.027 (B)
SIFT: 0.551 (T)
Frequency Data:
1000Genomes: 0.0265%
TOPMed: 0.0185%
ExAC EAS: 0.2411%
ExAC SAS: 0.0099%
gnomAD_E_EAS: 0.2409%
gnomAD_E_SAS: 0.0052%
gnomAD_G_EAS: 0.3854%

Exomiser Score: 0.014

Phenotype Score: 0.000

Variant Score: 0.985

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.014

Phenotype Score: 0.000

Variant Score: 0.985

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-15708597-G-A [0/1] rs138226187
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 0.994
Polyphen2: 0.994 (D)
SIFT: 0.009 (D)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0004%
gnomAD_E_EAS: 0.0586%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.014

Phenotype Score: 0.240

Variant Score: 0.711

Phenotype matches:
Phenotypic similarity 0.240 to mouse mutant involving EVA1C.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002638, abnormal pupillary reflex
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.014

Phenotype Score: 0.240

Variant Score: 0.711

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 21-33840145-T-C [0/1] rs757227833
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.71099997
Polyphen2: 0.015 (B)
SIFT: 0.289 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.013

Phenotype Score: 0.000

Variant Score: 0.979

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.013

Phenotype Score: 0.000

Variant Score: 0.979

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 15-75500578-C-T [0/1] rs1388490359
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.979
Polyphen2: 0.008 (B)
SIFT: 0.021 (D)
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.011

Phenotype Score: 0.318

Variant Score: 0.600

Phenotype matches:
Phenotypic similarity 0.318 to mouse mutant involving ZNF407.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.011

Phenotype Score: 0.318

Variant Score: 0.600

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 18-72343286-G-C [0/1] rs200972611
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ExAC NFE: 0.0030%
gnomAD_E_NFE: 0.0018%

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.939

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.939

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 18-14513678-T-G [0/1] rs28606506
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.939 CONTRIBUTING VARIANT
Transcripts:
POTEC:ENST00000358970.5:c.1516A>C:p.(Lys506Gln)
Pathogenicity Data:
Best Score: 0.939
Polyphen2: 0.137 (B)
SIFT: 0.061 (T)
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.005

Phenotype Score: 0.000

Variant Score: 0.862

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 18-14513678-T-G [0/1] rs28606506
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.939 CONTRIBUTING VARIANT
Transcripts:
POTEC:ENST00000358970.5:c.1516A>C:p.(Lys506Gln)
Pathogenicity Data:
Best Score: 0.939
Polyphen2: 0.137 (B)
SIFT: 0.061 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 18-14533084-T-C [0/1] rs202042216
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP3]
Variant score: 0.785 CONTRIBUTING VARIANT
Transcripts:
POTEC:ENST00000358970.5:c.1031A>G:p.(Tyr344Cys)
Pathogenicity Data:
Best Score: 0.998
Polyphen2: 0.998 (D)
SIFT: 0.007 (D)
Frequency Data:
TOPMed: 0.0404%
gnomAD_E_EAS: 0.9464%
gnomAD_E_SAS: 0.0136%
gnomAD_G_EAS: 0.9375%

Exomiser Score: 0.009

Phenotype Score: 0.500

Variant Score: 0.368

Phenotype matches:
Proximity score 0.500 in interactome to STAMBP and phenotypic similarity 0.666 to Microcephaly-capillary malformation syndrome associated with STAMBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.500 in interactome to STAMBP and phenotypic similarity 0.268 to mouse mutant of STAMBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.009

Phenotype Score: 0.500

Variant Score: 0.368

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-64111665-C-T [0/1] rs79318041
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.996
Polyphen2: 0.056 (B)
SIFT: 0.004 (D)
Frequency Data:
1000Genomes: 0.3395%
TOPMed: 0.2203%
ESP AA: 0.3862%
ESP EA: 0.0116%
ESP All: 0.1385%
ExAC AFR: 0.2759%
ExAC AMR: 0.0346%
ExAC EAS: 1.5552%
ExAC NFE: 0.0046%
ExAC OTH: 0.3341%
ExAC SAS: 0.4931%
gnomAD_E_AFR: 0.2755%
gnomAD_E_AMR: 0.0273%
gnomAD_E_EAS: 1.5382%
gnomAD_E_NFE: 0.0054%
gnomAD_E_OTH: 0.2033%
gnomAD_E_SAS: 0.5660%
gnomAD_G_AFR: 0.2754%
gnomAD_G_AMR: 0.2387%
gnomAD_G_EAS: 1.0481%
gnomAD_G_NFE: 0.0067%
gnomAD_G_OTH: 0.1020%
MISSENSE_VARIANT SNV 11-64121190-C-G [0/1] rs80109197
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.296 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.137 (T)
Frequency Data:
1000Genomes: 0.5791%
TOPMed: 0.1991%
ESP AA: 0.1363%
ESP EA: 0.0233%
ESP All: 0.0616%
ExAC AFR: 0.1445%
ExAC AMR: 0.0432%
ExAC EAS: 1.8848%
ExAC NFE: 0.0075%
ExAC OTH: 0.4415%
ExAC SAS: 0.3696%
gnomAD_E_AFR: 0.1372%
gnomAD_E_AMR: 0.0357%
gnomAD_E_EAS: 1.7683%
gnomAD_E_FIN: 0.0045%
gnomAD_E_NFE: 0.0090%
gnomAD_E_OTH: 0.2007%
gnomAD_E_SAS: 0.4256%
gnomAD_G_AFR: 0.1953%
gnomAD_G_AMR: 0.2387%
gnomAD_G_EAS: 0.9271%
gnomAD_G_NFE: 0.0201%
gnomAD_G_OTH: 0.1020%
Other passed variants:
SYNONYMOUS_VARIANT SNV 11-64109160-G-C [0/1] rs79183699
Variant score: 0.049
Transcripts:
CCDC88B:ENST00000356786.5:c.621G>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.3395%
TOPMed: 0.2180%
ESP AA: 0.3635%
ESP EA: 0.0116%
ESP All: 0.1308%
ExAC AFR: 0.2819%
ExAC AMR: 0.0353%
ExAC EAS: 1.5585%
ExAC NFE: 0.0048%
ExAC OTH: 0.3817%
ExAC SAS: 0.5178%
gnomAD_E_AFR: 0.2741%
gnomAD_E_AMR: 0.0277%
gnomAD_E_EAS: 1.5260%
gnomAD_E_NFE: 0.0056%
gnomAD_E_OTH: 0.1701%
gnomAD_E_SAS: 0.5276%
gnomAD_G_AFR: 0.2880%
gnomAD_G_AMR: 0.2392%
gnomAD_G_EAS: 1.0533%
gnomAD_G_NFE: 0.0067%
gnomAD_G_OTH: 0.1033%
SYNONYMOUS_VARIANT SNV 11-64108207-C-T [0/1] rs78194959
Variant score: 0.048
Transcripts:
CCDC88B:ENST00000356786.5:c.189C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.2995%
TOPMed: 0.1557%
ESP AA: 0.0929%
ESP EA: 0.0117%
ESP All: 0.0390%
ExAC AFR: 0.0430%
ExAC AMR: 0.0348%
ExAC EAS: 1.5789%
ExAC NFE: 0.0047%
ExAC OTH: 0.3480%
ExAC SAS: 0.3821%
gnomAD_E_AFR: 0.0594%
gnomAD_E_AMR: 0.0270%
gnomAD_E_EAS: 1.5352%
gnomAD_E_NFE: 0.0056%
gnomAD_E_OTH: 0.2038%
gnomAD_E_SAS: 0.4014%
gnomAD_G_AFR: 0.0575%
gnomAD_G_AMR: 0.2387%
gnomAD_G_EAS: 1.1111%
gnomAD_G_NFE: 0.0067%
gnomAD_G_OTH: 0.1025%

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.931

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.009

Phenotype Score: 0.000

Variant Score: 0.931

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 21-14982886-G-A [1/1] rs6517869
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.931 CONTRIBUTING VARIANT
Transcripts:
POTED:ENST00000299443.5:c.337G>A:p.(Gly113Ser)
Pathogenicity Data:
Best Score: 0.937
Polyphen2: 0.937 (P)
SIFT: 0.153 (T)
Frequency Data:
gnomAD_E_AFR: 0.0481%
gnomAD_E_NFE: 0.0078%
gnomAD_E_SAS: 0.0092%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 21-14992475-T-C [0/1] rs3865072
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
POTED:ENST00000299443.5:c.918-4T>C:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 21-15013735-A-G [1/1] rs9980783
Variant score: 0.785
Transcripts:
POTED:ENST00000299443.5:c.1603A>G:p.(Met535Val)
Pathogenicity Data:
Best Score: 0.78499997
Polyphen2: 0.007 (B)
SIFT: 0.215 (T)
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 21-14982952-A-G [1/1] rs6517870
Variant score: 0.590
Transcripts:
POTED:ENST00000299443.5:c.403A>G:p.(Ile135Val)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.1207%
gnomAD_E_FIN: 0.0120%
gnomAD_E_NFE: 0.0233%
gnomAD_G_FIN: 0.0794%
gnomAD_G_NFE: 0.0210%
MISSENSE_VARIANT SNV 21-14982577-A-G [0/1] rs373326718
Variant score: 0.274
Transcripts:
POTED:ENST00000299443.5:c.28A>G:p.(Thr10Ala)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.1953%
gnomAD_G_EAS: 1.6129%
gnomAD_G_FIN: 0.2466%
gnomAD_G_NFE: 0.0846%
MISSENSE_VARIANT SNV 21-14982586-A-G [0/1] rs200720062
Variant score: 0.100
Transcripts:
POTED:ENST00000299443.5:c.37A>G:p.(Thr13Ala)
Pathogenicity Data:
Best Score: 0.100000024
SIFT: 0.900 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.008

Phenotype Score: 0.504

Variant Score: 0.357

Phenotype matches:
Proximity score 0.504 in interactome to COMT and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with COMT.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.008

Phenotype Score: 0.504

Variant Score: 0.357

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 17-40997924-G-T [0/1] rs34351794
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 1.000 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.2995%
TOPMed: 0.0359%
ExAC AMR: 0.0087%
ExAC EAS: 1.2500%
ExAC SAS: 0.0061%
gnomAD_E_EAS: 1.3451%
gnomAD_E_OTH: 0.0182%
gnomAD_G_EAS: 0.8642%
gnomAD_G_NFE: 0.0067%
gnomAD_G_OTH: 0.1018%
SYNONYMOUS_VARIANT SNV 17-40998215-G-A [0/1] rs1268712624
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.098 CONTRIBUTING VARIANT
Transcripts:
AOC2:ENST00000253799.3:c.1572G>A:p.(=)
AOC2:ENST00000452774.2:c.1572G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_EAS: 0.0066%
gnomAD_G_AMR: 0.1199%

Exomiser Score: 0.008

Phenotype Score: 0.509

Variant Score: 0.345

Phenotype matches:
Phenotypic similarity 0.426 to Knobloch syndrome associated with COL18A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Phenotypic similarity 0.342 to mouse mutant involving COL18A1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.509 in interactome to CTSK and phenotypic similarity 0.712 to Pycnodysostosis associated with CTSK.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0009839, Osteolytic defects of the distal phalanges of the hand
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.509 in interactome to CTSK and phenotypic similarity 0.698 to mouse mutant of CTSK.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0030029, wide cranial sutures
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology
Known diseases:
OMIM:267750 Knobloch syndrome, type 1 - autosomal recessive
OMIM:618880 Glaucoma, primary closed-angle - autosomal dominant
ORPHA:1571 Knobloch syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.008

Phenotype Score: 0.509

Variant Score: 0.345

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.426 to ORPHA:1571 Knobloch syndrome
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 21-46925297-C-CCCCCCTGGG [0/1] rs749507428
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ESP AA: 0.1488%
ESP EA: 0.2895%
ESP All: 0.2464%
ExAC AFR: 0.0565%
ExAC AMR: 0.0140%
ExAC EAS: 0.2064%
ExAC FIN: 0.0229%
ExAC NFE: 0.1054%
ExAC SAS: 0.1092%
gnomAD_E_AFR: 0.0430%
gnomAD_E_AMR: 0.0337%
gnomAD_E_EAS: 0.2364%
gnomAD_E_FIN: 0.0187%
gnomAD_E_NFE: 0.0931%
gnomAD_E_OTH: 0.1179%
gnomAD_E_SAS: 0.1207%
gnomAD_G_AFR: 0.0807%
gnomAD_G_EAS: 0.9877%
gnomAD_G_NFE: 0.1943%
SYNONYMOUS_VARIANT SNV 21-46925161-G-C [0/1] rs367651350
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 1.7770%
TOPMed: 0.4922%
ESP AA: 0.0847%
ESP All: 0.0259%
ExAC AFR: 1.3370%
ExAC AMR: 0.0794%
ExAC EAS: 1.6159%
ExAC NFE: 0.0252%
ExAC OTH: 0.4601%
ExAC SAS: 0.0138%
gnomAD_E_AFR: 1.1691%
gnomAD_E_AMR: 0.0758%
gnomAD_E_EAS: 1.4811%
gnomAD_E_NFE: 0.0220%
gnomAD_E_OTH: 0.1177%
gnomAD_E_SAS: 0.0267%
gnomAD_G_AFR: 1.3263%
gnomAD_G_AMR: 0.2410%
gnomAD_G_EAS: 1.4180%
gnomAD_G_NFE: 0.0067%
gnomAD_G_OTH: 0.5165%

Exomiser Score: 0.008

Phenotype Score: 0.286

Variant Score: 0.595

Phenotype matches:
Phenotypic similarity 0.286 to mouse mutant involving FCGBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.008

Phenotype Score: 0.286

Variant Score: 0.595

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-40433068-C-A [0/1] rs773836016
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.595 CONTRIBUTING VARIANT
Transcripts:
FCGBP:ENST00000221347.6:c.1201G>T:p.(Ala401Ser)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0234%
gnomAD_E_EAS: 0.0180%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.903

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.007

Phenotype Score: 0.000

Variant Score: 0.903

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-97911776-T-C [1/1] rs200778176
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.903
Polyphen2: 0.010 (B)
SIFT: 0.097 (T)
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 2-97911802-A-G [0/1] rs1262462446
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
MISSENSE_VARIANT SNV 2-97779551-A-T [0/1] rs531465456
Pathogenicity Data:
Best Score: 0.666
Polyphen2: 0.074 (B)
SIFT: 0.334 (T)
Frequency Data:
1000Genomes: 0.2596%
TOPMed: 0.2596%
ExAC EAS: 0.1058%
ExAC NFE: 0.0045%
gnomAD_E_EAS: 0.0180%
gnomAD_E_NFE: 0.0054%
gnomAD_G_AFR: 0.1516%
gnomAD_G_AMR: 0.2410%
gnomAD_G_EAS: 0.4642%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 2-97779555-C-T [0/1] rs542428195
Pathogenicity Data:
Best Score: 0.607
SIFT: 0.393 (T)
Frequency Data:
1000Genomes: 0.3195%
TOPMed: 0.3195%
ExAC EAS: 0.1647%
ExAC NFE: 0.0030%
gnomAD_E_EAS: 0.0479%
gnomAD_E_NFE: 0.0045%
gnomAD_G_AFR: 0.1166%
gnomAD_G_AMR: 0.2398%
gnomAD_G_EAS: 0.5277%
gnomAD_G_NFE: 0.0067%
MISSENSE_VARIANT SNV 2-97779556-C-A [0/1] rs374398264
Pathogenicity Data:
Best Score: 0.41500002
SIFT: 0.585 (T)
Frequency Data:
1000Genomes: 0.3195%
TOPMed: 0.3195%
ExAC EAS: 0.1646%
ExAC NFE: 0.0030%
gnomAD_E_EAS: 0.1085%
gnomAD_E_NFE: 0.0045%
gnomAD_G_AFR: 0.1164%
gnomAD_G_AMR: 0.2404%
gnomAD_G_EAS: 0.5256%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.898

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.898

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-152101490-G-A [0/1] rs782117827
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.929
Polyphen2: 0.059 (B)
SIFT: 0.071 (T)
Frequency Data:
TOPMed: 0.0068%
ExAC EAS: 0.2218%
gnomAD_E_EAS: 0.1415%
gnomAD_E_OTH: 0.0276%
gnomAD_G_EAS: 0.0966%

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.896

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.006

Phenotype Score: 0.000

Variant Score: 0.896

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-100174621-G-A [0/1] rs199982219
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.904
Polyphen2: 0.003 (B)
SIFT: 0.096 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0008%
gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.826

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-100174621-G-A [0/1] rs199982219
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.904
Polyphen2: 0.003 (B)
SIFT: 0.096 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0008%
gnomAD_G_EAS: 0.0617%
MISSENSE_VARIANT SNV 7-100172813-A-G [0/1] rs201639027
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.936815
Polyphen2: 0.001 (B)
Mutation Taster: 0.937
SIFT: 0.211 (T)
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0144%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC EAS: 0.1047%
ExAC FIN: 0.8862%
ExAC NFE: 0.0647%
ExAC OTH: 0.1333%
ExAC SAS: 0.0067%
gnomAD_E_EAS: 0.0407%
gnomAD_E_FIN: 0.7570%
gnomAD_E_NFE: 0.0318%
gnomAD_E_OTH: 0.1112%
gnomAD_E_SAS: 0.0065%
gnomAD_G_EAS: 0.0617%
gnomAD_G_FIN: 0.7450%
gnomAD_G_NFE: 0.0804%
gnomAD_G_OTH: 0.2049%

Exomiser Score: 0.005

Phenotype Score: 0.500

Variant Score: 0.309

Phenotype matches:
Proximity score 0.500 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003109, short femur
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0003109, short femur
HP:0010055, Broad hallux - MP:0003109, short femur
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.005

Phenotype Score: 0.500

Variant Score: 0.309

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-58018149-G-C [0/1] rs768330529
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.31
Polyphen2: 0.023 (B)
SIFT: 0.690 (T)
Frequency Data:
TOPMed: 0.0008%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.004

Phenotype Score: 0.306

Variant Score: 0.504

Phenotype matches:
Phenotypic similarity 0.306 to mouse mutant involving NAALADL2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.306

Variant Score: 0.504

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-175165119-C-A [0/1] rs1485352972
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.504 CONTRIBUTING VARIANT
Transcripts:
NAALADL2:ENST00000454872.1:c.1193C>A:p.(Thr398Asn)
Pathogenicity Data:
Best Score: 0.504
Polyphen2: 0.001 (B)
SIFT: 0.496 (T)
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 15-23685922-C-CCCGCATCTTCTCCTCCTGCTT [0/1] rs748500078
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: UNCERTAIN_SIGNIFICANCE (no assertion criteria provided)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS 9-35906583-T-TCCACCACCACCA [0/1] rs79156963
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.850 CONTRIBUTING VARIANT
Transcripts:
HRCT1:ENST00000354323.2:c.305_316dup:p.(His102_His105dup)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_DELETION DEL 16-74425558-CCCTCTTCCACCCTCT-C [0/1] rs59612184
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.850 CONTRIBUTING VARIANT
Transcripts:
NPIPB15:ENST00000429990.1:c.927_941del:p.(Pro310_Ser314del)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.850

No phenotype matches to diseases with this MOI.
Variants contributing to score:
INFRAME_DELETION DEL 3-40503520-ACTG-A [-/1] rs57354599
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.004

Phenotype Score: 0.663

Variant Score: 0.099

Phenotype matches:
Phenotypic similarity 0.663 to Acrodysostosis with multiple hormone resistance associated with PDE4D.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger
HP:0010055, Broad hallux - HP:0001831, Short toe
Known diseases:
OMIM:614613 Acrodysostosis 2, with or without hormone resistance - autosomal dominant
ORPHA:280651 Acrodysostosis with multiple hormone resistance - autosomal dominant
ORPHA:950 Acrodysostosis - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.663

Variant Score: 0.099

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.663 to ORPHA:280651 Acrodysostosis with multiple hormone resistance
Phenotypic similarity 0.656 to ORPHA:950 Acrodysostosis
Phenotypic similarity 0.654 to OMIM:614613 Acrodysostosis 2, with or without hormone resistance
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 5-59189192-C-T [0/1] rs1013897220
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PP4, BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0026%
gnomAD_G_EAS: 0.0619%

Exomiser Score: 0.004

Phenotype Score: 0.741

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.741 to Macrocephaly-developmental delay syndrome associated with KPTN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
Phenotypic similarity 0.318 to mouse mutant involving KPTN.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:615637 Mental retardation, autosomal recessive 41 - autosomal recessive
ORPHA:397612 Macrocephaly-developmental delay syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.159

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-47979804-G-C [0/1] rs562237338
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
KPTN:ENST00000338134.3:c.1167C>G:p.(=)
KPTN:ENST00000536339.1:c.447C>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0024%
ExAC EAS: 0.0352%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0523%

LSR

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.833

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.833

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-35758059-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.833
Polyphen2: 0.718 (P)
SIFT: 0.167 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.004

Phenotype Score: 0.736

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.590 to Heart and brain malformation syndrome associated with SMG9.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0100490, Camptodactyly of finger
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0100490, Camptodactyly of finger
Phenotypic similarity 0.736 to mouse mutant involving SMG9.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis - MP:0001297, microphthalmia
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
Proximity score 0.501 in interactome to RPL27 and phenotypic similarity 0.670 to Blackfan-Diamond anemia associated with RPL27.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001199, Triphalangeal thumb
HP:0010055, Broad hallux - HP:0001199, Triphalangeal thumb
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:616920 Heart and brain malformation syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.368

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-44242304-G-A [0/1] rs774216418
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
SMG9:ENST00000270066.6:c.879C>T:p.(=)
SMG9:ENST00000601170.1:c.879C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC SAS: 0.0182%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0162%

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.832

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.004

Phenotype Score: 0.000

Variant Score: 0.832

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_VARIANT DEL 6-30994887-CCA-C [0/1] rs755828374
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.947 CONTRIBUTING VARIANT
Transcripts:
MUC22:ENST00000561890.1:c.1680_1681del:p.(Ile561Argfs*3)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0348%
gnomAD_E_AMR: 0.2382%
gnomAD_E_EAS: 0.0103%
gnomAD_E_FIN: 0.1303%
gnomAD_E_NFE: 0.3321%
gnomAD_E_OTH: 0.3049%
gnomAD_E_SAS: 0.0802%
gnomAD_G_AFR: 0.0476%
gnomAD_G_AMR: 0.1279%
gnomAD_G_EAS: 0.1882%
gnomAD_G_NFE: 0.2690%
gnomAD_G_OTH: 0.2183%
MISSENSE_VARIANT SNV 6-30994879-G-A [0/1] rs539565454
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.718 CONTRIBUTING VARIANT
Transcripts:
MUC22:ENST00000561890.1:c.1671G>A:p.(Met557Ile)
Pathogenicity Data:
Best Score: 0.909
SIFT: 0.091 (T)
Frequency Data:
1000Genomes: 0.9385%
TOPMed: 0.9385%
gnomAD_E_AFR: 0.6878%
gnomAD_E_AMR: 0.4289%
gnomAD_E_EAS: 0.3625%
gnomAD_E_FIN: 0.1513%
gnomAD_E_NFE: 0.5904%
gnomAD_E_OTH: 0.5532%
gnomAD_E_SAS: 0.1038%
gnomAD_G_AFR: 0.6377%
gnomAD_G_AMR: 0.3947%
gnomAD_G_EAS: 0.1951%
gnomAD_G_FIN: 0.0311%
gnomAD_G_NFE: 0.4824%
gnomAD_G_OTH: 0.3488%
Other passed variants:
MISSENSE_VARIANT SNV 6-30993419-A-G [0/1] rs117024916
Variant score: 0.456
Transcripts:
MUC22:ENST00000561890.1:c.211A>G:p.(Thr71Ala)
Pathogenicity Data:
Best Score: 0.61
SIFT: 0.390 (T)
Frequency Data:
1000Genomes: 0.4593%
TOPMed: 0.1949%
UK10K: 0.0661%
ExAC NFE: 0.5654%
ExAC SAS: 0.0534%
gnomAD_E_AFR: 0.0853%
gnomAD_E_AMR: 0.5208%
gnomAD_E_EAS: 1.0548%
gnomAD_E_FIN: 0.0189%
gnomAD_E_NFE: 0.0775%
gnomAD_E_OTH: 0.2576%
gnomAD_E_SAS: 0.0490%
gnomAD_G_AFR: 0.0690%
gnomAD_G_AMR: 0.4773%
gnomAD_G_EAS: 0.2472%
gnomAD_G_NFE: 0.0869%
MISSENSE_VARIANT SNV 6-30997275-C-G [0/1] rs146685560
Variant score: 0.328
Transcripts:
MUC22:ENST00000561890.1:c.4067C>G:p.(Thr1356Arg)
Pathogenicity Data:
Best Score: 0.897
SIFT: 0.103 (T)
Frequency Data:
1000Genomes: 0.9984%
TOPMed: 1.1600%
UK10K: 0.5157%
ExAC AFR: 1.5957%
ExAC NFE: 0.5499%
ExAC SAS: 0.1866%
gnomAD_E_AFR: 1.7188%
gnomAD_E_AMR: 0.6434%
gnomAD_E_EAS: 1.0870%
gnomAD_E_FIN: 0.2267%
gnomAD_E_NFE: 0.9553%
gnomAD_E_OTH: 1.0321%
gnomAD_E_SAS: 0.1693%
gnomAD_G_AFR: 1.7376%
gnomAD_G_AMR: 0.4773%
gnomAD_G_EAS: 0.2481%
gnomAD_G_FIN: 0.0574%
gnomAD_G_NFE: 0.9964%
gnomAD_G_OTH: 0.7187%
MISSENSE_VARIANT SNV 6-30994878-T-C [0/1] rs770369929
Variant score: 0.310
Transcripts:
MUC22:ENST00000561890.1:c.1670T>C:p.(Met557Thr)
Pathogenicity Data:
Best Score: 0.35799998
SIFT: 0.642 (T)
Frequency Data:
gnomAD_E_AFR: 0.6881%
gnomAD_E_AMR: 0.4515%
gnomAD_E_EAS: 0.3624%
gnomAD_E_FIN: 0.1942%
gnomAD_E_NFE: 0.5975%
gnomAD_E_OTH: 0.5832%
gnomAD_E_SAS: 0.1039%
gnomAD_G_AFR: 0.6418%
gnomAD_G_AMR: 0.3927%
gnomAD_G_EAS: 0.1940%
gnomAD_G_FIN: 0.0310%
gnomAD_G_NFE: 0.4875%
gnomAD_G_OTH: 0.3488%
MISSENSE_VARIANT SNV 6-30994232-A-G [0/1] rs116938859
Variant score: 0.094
Transcripts:
MUC22:ENST00000561890.1:c.1024A>G:p.(Met342Val)
Pathogenicity Data:
Best Score: 0.13499999
SIFT: 0.865 (T)
Frequency Data:
1000Genomes: 0.5791%
TOPMed: 0.5791%
UK10K: 0.5290%
ExAC AFR: 0.5263%
ExAC NFE: 0.6886%
ExAC SAS: 0.2089%
gnomAD_E_AFR: 0.2236%
gnomAD_E_AMR: 0.6378%
gnomAD_E_EAS: 1.1623%
gnomAD_E_FIN: 0.2587%
gnomAD_E_NFE: 1.0961%
gnomAD_E_OTH: 1.1710%
gnomAD_E_SAS: 0.1863%
gnomAD_G_AFR: 0.2950%
gnomAD_G_AMR: 0.3817%
gnomAD_G_EAS: 0.2522%
gnomAD_G_FIN: 0.0606%
gnomAD_G_NFE: 1.0753%
gnomAD_G_OTH: 0.6593%
SYNONYMOUS_VARIANT SNV 6-30994876-T-C [0/1] rs568996220
Variant score: 0.077
Transcripts:
MUC22:ENST00000561890.1:c.1668T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.9984%
TOPMed: 0.9984%
gnomAD_E_AFR: 0.7052%
gnomAD_E_AMR: 0.4500%
gnomAD_E_EAS: 0.3628%
gnomAD_E_FIN: 0.2160%
gnomAD_E_NFE: 0.6163%
gnomAD_E_OTH: 0.6146%
gnomAD_E_SAS: 0.1039%
gnomAD_G_AFR: 0.6429%
gnomAD_G_AMR: 0.3866%
gnomAD_G_EAS: 0.1926%
gnomAD_G_FIN: 0.0307%
gnomAD_G_NFE: 0.5068%
gnomAD_G_OTH: 0.3409%
MISSENSE_VARIANT SNV 6-30994778-A-G [0/1] rs117058095
Variant score: 0.000
Transcripts:
MUC22:ENST00000561890.1:c.1570A>G:p.(Lys524Glu)
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
1000Genomes: 0.9984%
TOPMed: 0.9984%
UK10K: 0.5554%
ExAC AFR: 1.5957%
ExAC NFE: 0.7645%
ExAC SAS: 0.2083%
gnomAD_E_AFR: 1.7562%
gnomAD_E_AMR: 0.7959%
gnomAD_E_EAS: 1.1526%
gnomAD_E_FIN: 0.2579%
gnomAD_E_NFE: 1.1191%
gnomAD_E_OTH: 1.1417%
gnomAD_E_SAS: 0.1863%
gnomAD_G_AFR: 1.7490%
gnomAD_G_AMR: 0.5141%
gnomAD_G_EAS: 0.2513%
gnomAD_G_FIN: 0.0305%
gnomAD_G_NFE: 1.1230%
gnomAD_G_OTH: 0.8734%

Exomiser Score: 0.003

Phenotype Score: 0.552

Variant Score: 0.198

Phenotype matches:
Phenotypic similarity 0.552 to mouse mutant involving TTC28.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology
HP:0001363, Craniosynostosis - MP:0004609, vertebral fusion
HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology
HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.552

Variant Score: 0.198

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 22-29075636-G-T [0/1] rs748336223
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.373 CONTRIBUTING VARIANT
Transcripts:
TTC28:ENST00000397906.2:c.76C>A:p.(Pro26Thr)
Pathogenicity Data:
Best Score: 0.853
Polyphen2: 0.014 (B)
SIFT: 0.147 (T)
Frequency Data:
ExAC SAS: 0.0189%
gnomAD_E_AMR: 0.1508%
gnomAD_E_EAS: 0.5597%
gnomAD_E_FIN: 0.0271%
gnomAD_E_NFE: 0.0238%
gnomAD_E_OTH: 0.1422%
gnomAD_E_SAS: 0.0449%
gnomAD_G_AFR: 0.1916%
gnomAD_G_AMR: 1.0234%
gnomAD_G_EAS: 0.0657%
gnomAD_G_FIN: 1.6406%
gnomAD_G_NFE: 0.0556%
gnomAD_G_OTH: 0.2212%
SYNONYMOUS_VARIANT SNV 22-29075634-T-G [0/1] rs1288874226
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.022 CONTRIBUTING VARIANT
Transcripts:
TTC28:ENST00000397906.2:c.78A>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.1421%
gnomAD_E_EAS: 0.3257%
gnomAD_E_FIN: 0.0517%
gnomAD_E_NFE: 0.0273%
gnomAD_E_OTH: 0.1979%
gnomAD_E_SAS: 0.0430%
gnomAD_G_AFR: 0.2551%
gnomAD_G_AMR: 1.0938%
gnomAD_G_EAS: 0.2199%
gnomAD_G_FIN: 1.9108%
gnomAD_G_NFE: 0.1018%
gnomAD_G_OTH: 0.2370%

Exomiser Score: 0.003

Phenotype Score: 0.501

Variant Score: 0.251

Phenotype matches:
Proximity score 0.501 in interactome to ANTXR2 and phenotypic similarity 0.651 to Infantile systemic hyalinosis associated with ANTXR2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.501

Variant Score: 0.251

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 22-19222234-A-G [0/1] rs117574531
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1198%
TOPMed: 0.0932%
ExAC EAS: 1.1714%
ExAC SAS: 0.0063%
gnomAD_E_EAS: 1.2929%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0366%
gnomAD_E_SAS: 0.0065%
gnomAD_G_EAS: 1.5432%
SYNONYMOUS_VARIANT SNV 22-19203638-A-C [0/1] rs782014996
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC SAS: 0.0062%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0033%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 22-19203638-A-C [0/1] rs782014996
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC SAS: 0.0062%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0033%

Exomiser Score: 0.003

Phenotype Score: 0.503

Variant Score: 0.248

Phenotype matches:
Proximity score 0.503 in interactome to IRF6 and phenotypic similarity 0.533 to Autosomal dominant popliteal pterygium syndrome associated with IRF6.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.503 in interactome to IRF6 and phenotypic similarity 0.715 to mouse mutant of IRF6.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0000060, delayed bone ossification
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.503

Variant Score: 0.248

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-231281027-G-A [0/1] rs151275724
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.436
Polyphen2: 0.002 (B)
SIFT: 0.564 (T)
Frequency Data:
1000Genomes: 0.0998%
TOPMed: 0.0155%
ExAC EAS: 0.4600%
gnomAD_E_EAS: 0.4531%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0184%
gnomAD_E_SAS: 0.0065%
gnomAD_G_EAS: 0.4326%
SYNONYMOUS_VARIANT SNV 2-231380145-C-T [0/1] rs186365701
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0191%
ExAC EAS: 0.2661%
gnomAD_E_EAS: 0.3711%
gnomAD_E_OTH: 0.0183%
gnomAD_G_EAS: 0.3717%

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.814

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.814

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 7-99084932-G-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.81406
Polyphen2: 0.001 (B)
Mutation Taster: 0.814
SIFT: 1.000 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.806

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.806

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55239223-G-A [1/1] rs270790
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.806
SIFT: 0.194 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

No phenotype matches to diseases with this MOI.
Variants contributing to score:
INFRAME_INSERTION INS X-114425181-A-AGAGGCCGCTCGCCCAACACCCACAGCG [-/1] rs781849390
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC EAS: 0.2294%
gnomAD_G_EAS: 0.3279%
gnomAD_G_NFE: 0.0104%

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.805

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-54439387-T-C [0/1] rs1214750545
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.805
Polyphen2: 0.004 (B)
SIFT: 0.195 (T)
Frequency Data:
gnomAD_E_FIN: 0.0045%

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 21-11021215-T-TA [0/1] rs71222366
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
BAGE2:ENST00000470054.1:n.1714-5_1714-4insT:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT INS 21-11021215-T-TA [0/1] rs71222366
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
BAGE2:ENST00000470054.1:n.1714-5_1714-4insT:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 21-11029594-G-T [0/1] rs10433054
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
BAGE2:ENST00000470054.1:n.1596+4C>A:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
Other passed variants:
SPLICE_REGION_VARIANT SNV 21-11038722-C-A [0/1] rs10433074
Variant score: 0.800
Transcripts:
BAGE2:ENST00000470054.1:n.1476+6G>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT DEL 21-11098703-CACTCCAGCCGCCATCTTACT-C [0/1] rs374894507
Variant score: 0.800
Transcripts:
BAGE2:ENST00000470054.1:n.203_222del:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 7-86556236-CAAA-C [0/1] rs397698585
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 1-16972920-C-T [0/1] rs4661882
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 9-72349174-TAAA-T [0/1] rs398010830
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
PTAR1:ENST00000340434.4:c.324-7_324-5del:p.?
PTAR1:ENST00000377200.5:c.87-7_87-5del:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 9-68728828-T-G [0/1] rs1587029293
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
RP11-391M20.1:ENST00000427066.1:n.62-6T>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 9-68728828-T-G [0/1] rs1587029293
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
RP11-391M20.1:ENST00000427066.1:n.62-6T>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
SPLICE_REGION_VARIANT SNV 9-68728895-C-T [0/1] rs1587029322
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.800 CONTRIBUTING VARIANT
Transcripts:
RP11-391M20.1:ENST00000427066.1:n.123C>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 9-69082238-TTG-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT DEL 1-24294450-CA-C [-/1] rs36002299
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

Phenotype matches:
No phenotype or PPI evidence
Known diseases:
OMIM:618734 ?Aneurysm, intracranial berry, 12 (unconfirmed)
ORPHA:231160 Familial cerebral saccular aneurysm - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.800

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 13-52971362-C-A [0/1] rs1594103112
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.799

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.003

Phenotype Score: 0.000

Variant Score: 0.799

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 1-1573856-A-C [0/1] rs1034314512
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_EAS: 0.0096%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.795

Phenotype matches:
Phenotypic similarity 0.333 to Dihydropyrimidine dehydrogenase deficiency associated with DPYD.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001799, Short nail
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0002656, Epiphyseal dysplasia
HP:0010055, Broad hallux - HP:0001799, Short nail
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:274270 Dihydropyrimidine dehydrogenase deficiency - autosomal recessive
ORPHA:1675 Dihydropyrimidine dehydrogenase deficiency - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.795

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 1-97915615-G-A [0/1] rs3918289
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Variant score: 0.795 CONTRIBUTING VARIANT
Transcripts:
DPYD:ENST00000370192.3:c.1905C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0253%
UK10K: 0.0264%
ESP EA: 0.0465%
ESP All: 0.0308%
ExAC AMR: 0.0087%
ExAC NFE: 0.0480%
ExAC SAS: 0.0182%
gnomAD_E_AMR: 0.0060%
gnomAD_E_NFE: 0.0188%
gnomAD_E_OTH: 0.0365%
gnomAD_E_SAS: 0.0162%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.793

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.793

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 16-22000120-G-C [0/1] rs1363119099
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
gnomAD_G_EAS: 0.0618%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.788

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.788

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 7-5873158-A-G [0/1] rs890163657
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.788 CONTRIBUTING VARIANT
Transcripts:
ZNF815P:ENST00000421890.1:n.471A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_EAS: 0.0646%
gnomAD_G_FIN: 0.0304%
gnomAD_G_NFE: 0.0206%
gnomAD_G_OTH: 0.1073%
SPLICE_REGION_VARIANT SNV 7-5873160-A-G [0/1] rs1316435088
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.788 CONTRIBUTING VARIANT
Transcripts:
ZNF815P:ENST00000421890.1:n.473A>G:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.0241%
gnomAD_G_EAS: 0.0643%
gnomAD_G_FIN: 0.0305%
gnomAD_G_NFE: 0.0275%
gnomAD_G_OTH: 0.1073%

Exomiser Score: 0.002

Phenotype Score: 0.693

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.693 to Mucolipidosis III alpha/beta associated with GNPTAB.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0006162, Soft tissue swelling of interphalangeal joints
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0006162, Soft tissue swelling of interphalangeal joints
HP:0010055, Broad hallux - HP:0006162, Soft tissue swelling of interphalangeal joints
Phenotypic similarity 0.482 to mouse mutant involving GNPTAB.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0006395, abnormal epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0006395, abnormal epiphyseal plate morphology
HP:0010055, Broad hallux - MP:0006395, abnormal epiphyseal plate morphology
Phenotypic similarity 0.463 to zebrafish mutant involving GNPTAB.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0019548, endochondral bone decreased occurrence ossification, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to FURIN and phenotypic similarity 0.935 to mouse mutant of FURIN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Proximity score 0.500 in interactome to FURIN and phenotypic similarity 0.274 to fish mutant of FURIN.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0006947, symplectic in contact with Meckel's cartilage, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:252500 Mucolipidosis II alpha/beta - autosomal recessive
OMIM:252600 Mucolipidosis III alpha/beta - autosomal recessive
ORPHA:576 Mucolipidosis type II - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 12-102158191-G-A [0/1] rs550940255
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Variant score: 0.000 CONTRIBUTING VARIANT
Transcripts:
GNPTAB:ENST00000299314.7:c.2504C>T:p.(Pro835Leu)
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
SIFT: 1.000 (T)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0023%
ExAC EAS: 0.0579%
gnomAD_E_EAS: 0.0697%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.768

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.768

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-104878038-C-T [0/1] rs1172126398
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.768
Polyphen2: 0.001 (B)
SIFT: 0.232 (T)
Frequency Data:
TOPMed: 0.0011%

Exomiser Score: 0.002

Phenotype Score: 0.382

Variant Score: 0.332

Phenotype matches:
Phenotypic similarity 0.763 to mouse mutant involving IGF2R.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0003416, premature bone ossification
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.784 to Pseudohypoparathyroidism type 1A associated with GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002684, Thickened calvaria
HP:0011304, Broad thumb - HP:0009642, Broad distal phalanx of the thumb
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.501 in interactome to GNAS and phenotypic similarity 0.497 to mouse mutant of GNAS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003109, short femur
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0003109, short femur
HP:0010055, Broad hallux - MP:0003109, short femur
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:114550 Hepatocellular carcinoma, somatic - somatic
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.382

Variant Score: 0.332

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 6-160485490-G-A [0/1] rs8191859
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.563 CONTRIBUTING VARIANT
Transcripts:
IGF2R:ENST00000356956.1:c.3944G>A:p.(Gly1315Glu)
Pathogenicity Data:
Best Score: 0.985
Polyphen2: 0.867 (P)
SIFT: 0.015 (D)
Frequency Data:
1000Genomes: 0.2396%
TOPMed: 0.0996%
ExAC AMR: 0.0086%
ExAC EAS: 1.3982%
ExAC NFE: 0.0015%
ExAC OTH: 0.1101%
gnomAD_E_AMR: 0.0089%
gnomAD_E_EAS: 1.4263%
gnomAD_E_NFE: 0.0045%
gnomAD_E_OTH: 0.0912%
gnomAD_G_EAS: 0.9864%
gnomAD_G_NFE: 0.0133%
gnomAD_G_OTH: 0.1018%
SYNONYMOUS_VARIANT SNV 6-160455457-G-A [0/1] rs145133650
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
IGF2R:ENST00000356956.1:c.1218G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0096%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0065%

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.382

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-160455457-G-A [0/1] rs145133650
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
IGF2R:ENST00000356956.1:c.1218G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0096%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0065%
Other passed variants:
SYNONYMOUS_VARIANT SNV 6-160482897-C-T [0/1] rs116968873
Variant score: 0.091
Transcripts:
IGF2R:ENST00000356956.1:c.3519C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0268%
ESP EA: 0.0233%
ESP All: 0.0154%
ExAC EAS: 0.4622%
ExAC NFE: 0.0225%
gnomAD_E_EAS: 0.5044%
gnomAD_E_NFE: 0.0170%
gnomAD_E_OTH: 0.0182%
gnomAD_E_SAS: 0.0032%
gnomAD_G_AFR: 0.0114%
gnomAD_G_EAS: 0.3083%
gnomAD_G_NFE: 0.0400%

Exomiser Score: 0.002

Phenotype Score: 0.541

Variant Score: 0.150

Phenotype matches:
Phenotypic similarity 0.541 to X-linked non-syndromic intellectual disability associated with ALG13.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004691, 2-3 toe syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers
HP:0010055, Broad hallux - HP:0004691, 2-3 toe syndactyly
Phenotypic similarity 0.318 to mouse mutant involving ALG13.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:300884 ?Congenital disorder of glycosylation, type Is (unconfirmed)
OMIM:300884 Developmental and epileptic encephalopathy 36 - X-linked dominant
ORPHA:324422 ALG13-CDG - X-linked dominant
ORPHA:777 X-linked non-syndromic intellectual disability - X-linked recessive
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.541

Variant Score: 0.150

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.541 to ORPHA:777 X-linked non-syndromic intellectual disability
Variants contributing to score:
DISRUPTIVE_INFRAME_INSERTION INS X-110987953-T-TACC [0/1] rs762039180
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AMR: 0.0831%
ExAC NFE: 0.0401%
gnomAD_E_AFR: 0.3811%
gnomAD_E_AMR: 0.1167%
gnomAD_E_EAS: 0.2426%
gnomAD_E_FIN: 0.0282%
gnomAD_E_NFE: 0.1428%
gnomAD_E_OTH: 0.2959%
gnomAD_E_SAS: 0.1309%
gnomAD_G_AFR: 0.8772%
gnomAD_G_AMR: 0.2179%
gnomAD_G_EAS: 1.9582%
gnomAD_G_FIN: 0.4594%
gnomAD_G_NFE: 0.8895%
gnomAD_G_OTH: 0.8197%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.760

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.760

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 14-94933567-T-A [0/1] rs1358181806
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.76
Polyphen2: 0.596 (P)
SIFT: 0.240 (T)
Frequency Data:
TOPMed: 0.0015%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.756

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.756

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-55598675-G-T [0/1] rs759944712
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PP3]
Pathogenicity Data:
Best Score: 1.0
Polyphen2: 0.986 (D)
Mutation Taster: 1.000 (P)
SIFT: 0.005 (D)
Frequency Data:
TOPMed: 0.0032%
ExAC EAS: 0.2187%
gnomAD_E_EAS: 0.0855%
MISSENSE_VARIANT SNV 19-55597526-G-A [0/1] rs140692049
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.61300004
Polyphen2: 0.002 (B)
SIFT: 0.387 (T)
Frequency Data:
1000Genomes: 0.0998%
TOPMed: 0.0113%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AMR: 0.0174%
ExAC EAS: 0.1391%
ExAC FIN: 0.0152%
ExAC NFE: 0.0108%
ExAC OTH: 0.2398%
ExAC SAS: 0.6030%
gnomAD_E_EAS: 0.1051%
gnomAD_E_FIN: 0.0093%
gnomAD_E_NFE: 0.0122%
gnomAD_E_OTH: 0.0572%
gnomAD_E_SAS: 0.4967%
gnomAD_G_NFE: 0.0067%
gnomAD_G_OTH: 0.2045%

Exomiser Score: 0.002

Phenotype Score: 0.667

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.340 to Combined immunodeficiency-enteropathy spectrum associated with TTC7A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0008404, Nail dystrophy
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0008404, Nail dystrophy
HP:0010055, Broad hallux - HP:0008404, Nail dystrophy
Phenotypic similarity 0.667 to mouse mutant involving TTC7A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000579, abnormal nail morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000579, abnormal nail morphology
HP:0010055, Broad hallux - MP:0000579, abnormal nail morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:243150 Gastrointestinal defects and immunodeficiency syndrome - autosomal recessive
ORPHA:2300 Multiple intestinal atresia - autosomal recessive
ORPHA:436252 Combined immunodeficiency-enteropathy spectrum - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.334

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 2-47300999-C-T [0/1] rs200826158
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0023%
ExAC EAS: 0.0465%
ExAC NFE: 0.0030%
ExAC SAS: 0.0121%
gnomAD_E_EAS: 0.0464%
gnomAD_E_NFE: 0.0036%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0065%

Exomiser Score: 0.002

Phenotype Score: 0.500

Variant Score: 0.183

Phenotype matches:
Proximity score 0.500 in interactome to PRKD1 and phenotypic similarity 0.756 to Congenital heart defects and ectodermal dysplasia associated with PRKD1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001159, Syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0001159, Syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.500

Variant Score: 0.183

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-11810230-A-G [0/1] rs1393371560
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.18300003
Polyphen2: 0.060 (B)
SIFT: 0.817 (T)
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.747

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.002

Phenotype Score: 0.000

Variant Score: 0.747

No phenotype matches to diseases with this MOI.
Variants contributing to score:
FRAMESHIFT_TRUNCATION DEL 16-28354288-AGC-A [0/1] rs2411938
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0225%
gnomAD_E_FIN: 0.8937%
gnomAD_E_NFE: 0.1165%
gnomAD_E_SAS: 0.0038%
gnomAD_G_AFR: 0.0250%
gnomAD_G_FIN: 0.0309%
gnomAD_G_NFE: 0.0658%
INFRAME_INSERTION INS 16-28354287-G-GGAC [0/1] rs757446940
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, PM4]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0341%
gnomAD_E_FIN: 0.8713%
gnomAD_E_NFE: 0.1408%
gnomAD_E_SAS: 0.0039%
gnomAD_G_AFR: 0.0238%
gnomAD_G_FIN: 0.0586%
gnomAD_G_NFE: 0.0578%

PTH

Exomiser Score: 0.002

Phenotype Score: 0.571

Variant Score: 0.099

Phenotype matches:
Phenotypic similarity 0.571 to mouse mutant involving PTH.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004634, short metacarpal bones
HP:0001363, Craniosynostosis - MP:0002896, abnormal bone mineralization
HP:0011304, Broad thumb - MP:0004634, short metacarpal bones
HP:0010055, Broad hallux - MP:0004635, short metatarsal bones
Proximity score 0.518 in interactome to MGP and phenotypic similarity 0.623 to Keutel syndrome associated with MGP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009778, Short thumb
HP:0010055, Broad hallux - HP:0010109, Short hallux
Proximity score 0.518 in interactome to MGP and phenotypic similarity 0.527 to mouse mutant of MGP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0003055, abnormal long bone epiphyseal plate morphology
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0003055, abnormal long bone epiphyseal plate morphology
HP:0010055, Broad hallux - MP:0003055, abnormal long bone epiphyseal plate morphology
Known diseases:
OMIM:146200 Hypoparathyroidism, familial isolated 1 - autosomal dominant/recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.002

Phenotype Score: 0.571

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 11-13514165-A-G [0/1] rs149916515
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
PTH:ENST00000282091.1:c.135T>C:p.(=)
PTH:ENST00000529816.1:c.135T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0004%
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.724

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.724

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-60456370-G-A [0/1] rs748270844
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.725
Polyphen2: 0.582 (P)
SIFT: 0.275 (T)
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.722

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.722

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 4-9250456-G-A [0/1] rs772097128
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.722 CONTRIBUTING VARIANT
Transcripts:
USP17L18:ENST00000504209.1:c.101G>A:p.(Arg34Gln)
Pathogenicity Data:
Best Score: 0.722
Polyphen2: 0.258 (B)
SIFT: 0.278 (T)
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.694

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.694

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-40512079-C-T [0/1] rs757487205
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.7
Polyphen2: 0.035 (B)
SIFT: 0.300 (T)
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0233%
gnomAD_G_EAS: 0.0617%

EN2

Exomiser Score: 0.001

Phenotype Score: 0.520

Variant Score: 0.100

Phenotype matches:
Proximity score 0.520 in interactome to ZIC1 and phenotypic similarity 0.698 to Isolated brachycephaly associated with ZIC1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly
HP:0011304, Broad thumb - HP:0009701, Metacarpal synostosis
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.520

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-155251474-A-G [0/1] rs1350806900
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
EN2:ENST00000297375.4:c.402A>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.117

Phenotype matches:
Proximity score 0.501 in interactome to NEPRO and phenotypic similarity 0.710 to Anauxetic dysplasia 3 associated with NEPRO.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0009844, Broad middle phalanx of finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.117

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-49337917-G-A [0/1] rs1263578277
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.116999984
Polyphen2: 0.010 (B)
SIFT: 0.883 (T)
Frequency Data:
TOPMed: 0.0042%
gnomAD_E_AFR: 0.0065%
gnomAD_E_NFE: 0.0009%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.516

Variant Score: 0.100

Phenotype matches:
Proximity score 0.516 in interactome to ASPH and phenotypic similarity 0.737 to mouse mutant of ASPH.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
Known diseases:
OMIM:115000 Ventricular arrythmias due to cardiac ryanodine receptor calcium release deficiency syndrome - autosomal dominant
OMIM:600996 Arrhythmogenic right ventricular dysplasia 2 - autosomal dominant
OMIM:604772 Ventricular tachycardia, catecholaminergic polymorphic, 1 - autosomal dominant
ORPHA:3286 Catecholaminergic polymorphic ventricular tachycardia - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.516

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-237713945-G-A [0/1] rs1183058696
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.001

Phenotype Score: 0.514

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.427 to Familial thoracic aortic aneurysm and aortic dissection associated with FOXE3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001166, Arachnodactyly
HP:0010055, Broad hallux - HP:0001166, Arachnodactyly
Phenotypic similarity 0.376 to mouse mutant involving FOXE3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005545, abnormal lens development
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.514 in interactome to ZEB2 and phenotypic similarity 0.818 to Mowat-Wilson syndrome due to monosomy 2q22 associated with ZEB2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis - HP:0011317, Right unicoronal synostosis
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Known diseases:
OMIM:610256 Anterior segment dysgenesis 2, multiple subtypes - autosomal recessive
OMIM:617349 Aortic aneurysm, familial thoracic 11, susceptibility to (susceptibility)
ORPHA:708 Peters anomaly - autosomal dominant/recessive
ORPHA:83461 Congenital primary aphakia - autosomal recessive
ORPHA:91387 Familial thoracic aortic aneurysm and aortic dissection - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.514

Variant Score: 0.100

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.427 to ORPHA:91387 Familial thoracic aortic aneurysm and aortic dissection
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-47882536-G-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
FOXE3:ENST00000335071.2:c.549G>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

Phenotype matches:
Phenotypic similarity 0.484 to mouse mutant involving TP73.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000440, domed cranium
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.511 in interactome to IFT57 and phenotypic similarity 0.652 to ?Orofaciodigital syndrome XVIII associated with IFT57.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0005819, Short middle phalanx of finger
HP:0010055, Broad hallux - HP:0001852, Sandal gap
Proximity score 0.511 in interactome to IFT57 and phenotypic similarity 0.732 to mouse mutant of IFT57.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0006197, ocular hypotelorism
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-3624160-C-T [0/1] rs201173391
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0034%
ExAC EAS: 0.0466%
ExAC SAS: 0.0488%
gnomAD_E_EAS: 0.0754%
gnomAD_E_SAS: 0.0455%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

Phenotype matches:
Proximity score 0.511 in interactome to KIF22 and phenotypic similarity 0.657 to Spondyloepimetaphyseal dysplasia with joint laxity, type 2 associated with KIF22.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0012296, Slender distal phalanx of finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009836, Broad distal phalanx of finger
HP:0010055, Broad hallux - HP:0012296, Slender distal phalanx of finger
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.511

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 5-154396863-C-T [0/1] rs139879144
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
KIF4B:ENST00000435029.4:c.3444C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0079%
ExAC EAS: 0.0347%
ExAC NFE: 0.0030%
gnomAD_E_AFR: 0.0065%
gnomAD_E_EAS: 0.0870%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0032%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.510

Variant Score: 0.100

Phenotype matches:
Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.332 to Hypogonadotropic hypogonadism 15 with or without anosmia associated with HS6ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002857, Genu valgum
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0002857, Genu valgum
HP:0010055, Broad hallux - HP:0002857, Genu valgum
Proximity score 0.510 in interactome to HS6ST1 and phenotypic similarity 0.783 to mouse mutant of HS6ST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005104, abnormal tarsal bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.510

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 13-92101163-G-A [0/1] rs942126306
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
GPC5:ENST00000377067.3:c.312G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0033%

Exomiser Score: 0.001

Phenotype Score: 0.508

Variant Score: 0.099

Phenotype matches:
Proximity score 0.508 in interactome to GRHL2 and phenotypic similarity 0.347 to Ectodermal dysplasia/short stature syndrome associated with GRHL2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0008404, Nail dystrophy
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0008404, Nail dystrophy
HP:0010055, Broad hallux - HP:0008404, Nail dystrophy
Proximity score 0.508 in interactome to GRHL2 and phenotypic similarity 0.756 to mouse mutant of GRHL2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis - MP:0011495, abnormal head shape
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.508

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-124390619-G-A [0/1] rs201086875
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0060%
ExAC AMR: 0.0086%
ExAC EAS: 0.0116%
ExAC NFE: 0.0015%
ExAC SAS: 0.0363%
gnomAD_E_AMR: 0.0089%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0227%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.507

Variant Score: 0.100

Phenotype matches:
Proximity score 0.507 in interactome to KCNJ2 and phenotypic similarity 0.651 to Andersen syndrome associated with KCNJ2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009803, Short phalanx of finger
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.507 in interactome to KCNJ2 and phenotypic similarity 0.254 to mouse mutant of KCNJ2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0030248, narrow maxilla
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:609620 Short QT syndrome 1 - autosomal dominant
OMIM:613688 Long QT syndrome 2 - autosomal dominant
OMIM:613688 Long QT syndrome 2, acquired, susceptibility to (susceptibility)
ORPHA:101016 Romano-Ward syndrome - autosomal dominant
ORPHA:51083 Familial short QT syndrome - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.507

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-150649741-G-A [0/1] rs754215143
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
ClinVar: LIKELY_BENIGN (criteria provided, single submitter)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ExAC EAS: 0.0116%
gnomAD_E_EAS: 0.0174%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.100

Phenotype matches:
Proximity score 0.506 in interactome to TNRC6B and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with TNRC6B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 8-101721804-A-C [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

Phenotype matches:
Proximity score 0.506 in interactome to SLC35A2 and phenotypic similarity 0.712 to SLC35A2-CDG associated with SLC35A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001840, Metatarsus adductus
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0001840, Metatarsus adductus
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 4-69688084-C-T [0/1] rs374908612
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
UGT2B10:ENST00000265403.7:c.963C>T:p.(=)
UGT2B10:ENST00000458688.2:c.711C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0096%
ESP AA: 0.0454%
ESP All: 0.0154%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0065%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

Phenotype matches:
Phenotypic similarity 0.399 to mouse mutant involving SEPTIN5.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002764, short tibia
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002764, short tibia
HP:0010055, Broad hallux - MP:0002764, short tibia
Proximity score 0.506 in interactome to GP1BB and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with GP1BB.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 22-19707858-C-T [0/1] rs550209881
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0032%
ExAC AMR: 0.0260%
ExAC NFE: 0.0015%
gnomAD_E_AMR: 0.0417%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

Phenotype matches:
Proximity score 0.506 in interactome to NSUN2 and phenotypic similarity 0.810 to Dubowitz syndrome associated with NSUN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.506 in interactome to NSUN2 and phenotypic similarity 0.571 to mouse mutant of NSUN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005296, abnormal humerus morphology
HP:0001363, Craniosynostosis - MP:0002932, abnormal joint morphology
HP:0011304, Broad thumb - MP:0005296, abnormal humerus morphology
HP:0010055, Broad hallux - MP:0005296, abnormal humerus morphology
Known diseases:
OMIM:614153 Spinocerebellar ataxia 36 - autosomal dominant
ORPHA:276198 Spinocerebellar ataxia type 36 - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.506

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 20-2635995-G-A [0/1] rs200115137
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
NOP56:ENST00000329276.5:c.594G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0024%
ExAC SAS: 0.0121%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0195%
gnomAD_G_AFR: 0.0115%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

Phenotype matches:
Proximity score 0.505 in interactome to KCNH1 and phenotypic similarity 0.856 to Temple-Baraitser syndrome associated with KCNH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-49575510-G-A [0/1] rs754428544
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
KCNA7:ENST00000221444.1:c.333C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0024%

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.483 to mouse mutant involving ULK4.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000440, domed cranium
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.505 in interactome to SUFU and phenotypic similarity 0.657 to Gorlin syndrome associated with SUFU.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly
HP:0011304, Broad thumb - HP:0001166, Arachnodactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.505 in interactome to SUFU and phenotypic similarity 0.722 to mouse mutant of SUFU.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-41979618-G-A [0/1] rs747260126
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
ExAC SAS: 0.0061%
gnomAD_E_SAS: 0.0130%

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

Phenotype matches:
Proximity score 0.505 in interactome to STAMBP and phenotypic similarity 0.666 to Microcephaly-capillary malformation syndrome associated with STAMBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.505 in interactome to STAMBP and phenotypic similarity 0.268 to mouse mutant of STAMBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001344, blepharoptosis
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.505

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-51702485-T-C [0/1] rs144300978
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
RNF11:ENST00000242719.3:c.57T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0056%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC EAS: 0.0118%
ExAC NFE: 0.0015%
gnomAD_E_EAS: 0.0233%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

Phenotype matches:
Proximity score 0.504 in interactome to FLNA and phenotypic similarity 0.812 to ?FG syndrome 2 associated with FLNA.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0010055, Broad hallux
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.504 in interactome to FLNA and phenotypic similarity 0.583 to mouse mutant of FLNA.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000157, abnormal sternum morphology
HP:0001363, Craniosynostosis - MP:0001319, irregularly shaped pupil
HP:0011304, Broad thumb - MP:0000157, abnormal sternum morphology
HP:0010055, Broad hallux - MP:0000157, abnormal sternum morphology
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV X-123785959-G-A [0/1] rs1207491156
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
TENM1:ENST00000371130.3:c.1384C>T:p.(=)
TENM1:ENST00000422452.2:c.1384C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0019%
gnomAD_E_EAS: 0.0079%

X_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV X-123785959-G-A [0/1] rs1207491156
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
TENM1:ENST00000371130.3:c.1384C>T:p.(=)
TENM1:ENST00000422452.2:c.1384C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0019%
gnomAD_E_EAS: 0.0079%

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.303 to mouse mutant involving IKBKB.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to TWIST1 and phenotypic similarity 0.871 to Robinow-Sorauf syndrome associated with TWIST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0010055, Broad hallux
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.504 in interactome to TWIST1 and phenotypic similarity 1.000 to mouse mutant of TWIST1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Known diseases:
OMIM:615592 Immunodeficiency 15B - autosomal recessive
OMIM:618204 Immunodeficiency 15A - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 8-42147746-G-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

Phenotype matches:
Proximity score 0.503 in interactome to PIAS2 and phenotypic similarity 0.727 to mouse mutant of PIAS2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0001325, abnormal retina morphology
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-55902184-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
SEPTIN14:ENST00000388975.3:c.654T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.099

Phenotype matches:
Phenotypic similarity 0.307 to mouse mutant involving MYO1C.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000062, increased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to EXOC8 and phenotypic similarity 0.635 to ?Neurodevelopmental disorder with microcephaly, seizures, and brain atrophy associated with EXOC8.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.504

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 17-1383860-C-T [0/1] rs200873831
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0045%
ExAC EAS: 0.0924%
gnomAD_E_EAS: 0.0928%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

Phenotype matches:
Proximity score 0.503 in interactome to ACAN and phenotypic similarity 0.885 to Short stature and advanced bone age, with or without early-onset osteoarthritis and/or osteochondritis dissecans associated with ACAN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0009778, Short thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.503 in interactome to ACAN and phenotypic similarity 0.853 to mouse mutant of ACAN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0030420, short basicranium
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Known diseases:
OMIM:611543 Cavitary optic disc anomalies - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.503

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-56236591-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.318 to mouse mutant involving SMN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.502 in interactome to SNRPN and phenotypic similarity 0.664 to Prader-Willi syndrome due to translocation associated with SNRPN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0005469, Flat occiput
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001845, Overlapping toe
Known diseases:
OMIM:253300 Spinal muscular atrophy-1 - autosomal recessive
OMIM:253400 Spinal muscular atrophy-3 - autosomal recessive
OMIM:253550 Spinal muscular atrophy-2 - autosomal recessive
OMIM:271150 Spinal muscular atrophy-4 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 5-70238373-A-G [1/1] rs4915
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP6_Strong]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 5-70247773-C-T [0/1] rs1164325688
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:
Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.621 to Mental retardation, X-linked syndromic 16 associated with FGD1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009466, Radial deviation of finger
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Proximity score 0.502 in interactome to FGD1 and phenotypic similarity 0.272 to mouse mutant of FGD1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001297, microphthalmia
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 10-49663075-G-A [0/1] rs773894826
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ExAC AMR: 0.0091%
ExAC EAS: 0.0118%
ExAC SAS: 0.0071%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0116%
gnomAD_E_NFE: 0.0018%
gnomAD_E_SAS: 0.0066%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:
Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.662 to Adams-Oliver syndrome associated with RBPJ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0010760, Absent toe
Proximity score 0.502 in interactome to RBPJ and phenotypic similarity 0.245 to mouse mutant of RBPJ.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0010124, decreased bone mineral content
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-42893093-C-T [0/1] rs766577832
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_FIN: 0.0081%
gnomAD_E_NFE: 0.0063%

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.313 to Tuberous sclerosis-1 associated with TSC1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009724, Subungual fibromas
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009724, Subungual fibromas
HP:0010055, Broad hallux - HP:0009724, Subungual fibromas
Proximity score 0.502 in interactome to SFN and phenotypic similarity 0.710 to mouse mutant of SFN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0005306, abnormal phalanx morphology
HP:0001363, Craniosynostosis - MP:0000454, abnormal jaw morphology
HP:0011304, Broad thumb - MP:0005306, abnormal phalanx morphology
HP:0010055, Broad hallux - MP:0005306, abnormal phalanx morphology
Known diseases:
OMIM:191100 Tuberous sclerosis-1 - autosomal dominant
OMIM:606690 Lymphangioleiomyomatosis - somatic
OMIM:607341 Focal cortical dysplasia, type II, somatic - somatic
ORPHA:538 Lymphangioleiomyomatosis (unconfirmed)
ORPHA:805 Tuberous sclerosis complex - autosomal dominant
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.313 to OMIM:191100 Tuberous sclerosis-1
Phenotypic similarity 0.296 to ORPHA:805 Tuberous sclerosis complex
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 9-135802630-C-T [0/1] rs781483110
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0026%
ExAC NFE: 0.0030%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0182%
gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

Phenotype matches:
Proximity score 0.502 in interactome to PSMD12 and phenotypic similarity 0.869 to Non-specific syndromic intellectual disability associated with PSMD12.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010109, Short hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-2271460-C-T [0/1] rs755649263
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
gnomAD_E_NFE: 0.0010%

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.271 to mouse mutant involving EMX1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003795, abnormal bone structure
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.501 in interactome to FGF8 and phenotypic similarity 0.681 to Holoprosencephaly associated with FGF8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0005469, Flat occiput
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.501 in interactome to FGF8 and phenotypic similarity 0.737 to mouse mutant of FGF8.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 2-73151467-C-T [0/1] rs1383337307
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
EMX1:ENST00000258106.6:c.550C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.099

Phenotype matches:
Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.656 to 2q37 microdeletion syndrome associated with HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0006101, Finger syndactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.934 to mouse mutant of HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0001363, Craniosynostosis - MP:0030356, premature lambdoid suture closure
HP:0011304, Broad thumb - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0010055, Broad hallux - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
Proximity score 0.502 in interactome to HDAC4 and phenotypic similarity 0.614 to fish mutant of HDAC4.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0107238, anguloarticular premature ossification, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-26199376-G-A [0/1] rs745708378
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
H2AC7:ENST00000341023.1:c.96C>T:p.(=)
H2AC7:ENST00000377831.5:c.-309C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0083%
gnomAD_E_AFR: 0.0394%
gnomAD_E_AMR: 0.0030%
gnomAD_G_AFR: 0.0114%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.502

Variant Score: 0.087

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-26199376-G-A [0/1] rs745708378
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
H2AC7:ENST00000341023.1:c.96C>T:p.(=)
H2AC7:ENST00000377831.5:c.-309C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0083%
gnomAD_E_AFR: 0.0394%
gnomAD_E_AMR: 0.0030%
gnomAD_G_AFR: 0.0114%
SYNONYMOUS_VARIANT SNV 6-26199442-C-T [0/1] rs117678923
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.076 CONTRIBUTING VARIANT
Transcripts:
H2AC7:ENST00000341023.1:c.30G>A:p.(=)
H2AC7:ENST00000377831.5:c.-375G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.2995%
TOPMed: 0.2102%
ESP AA: 0.4085%
ESP EA: 0.0233%
ESP All: 0.1538%
ExAC AFR: 0.4792%
ExAC AMR: 0.0266%
ExAC EAS: 1.0328%
ExAC NFE: 0.0062%
gnomAD_E_AFR: 0.3846%
gnomAD_E_AMR: 0.0229%
gnomAD_E_EAS: 0.8937%
gnomAD_E_NFE: 0.0046%
gnomAD_E_OTH: 0.0569%
gnomAD_E_SAS: 0.0070%
gnomAD_G_AFR: 0.3091%
gnomAD_G_EAS: 0.1850%

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:
Proximity score 0.501 in interactome to CASP3 and phenotypic similarity 0.631 to mouse mutant of CASP3.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0003843, abnormal sagittal suture morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-10529295-T-G [0/1] rs1407270291
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
DFFA:ENST00000377036.2:c.237A>C:p.(=)
DFFA:ENST00000377038.3:c.237A>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.435 to mouse mutant involving IQSEC3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002764, short tibia
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002764, short tibia
HP:0010055, Broad hallux - MP:0002764, short tibia
Proximity score 0.501 in interactome to IQSEC2 and phenotypic similarity 0.701 to Smith-Magenis syndrome associated with IQSEC2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0000248, Brachycephaly
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-176273-G-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
IQSEC3:ENST00000326261.4:c.225G>A:p.(=)
IQSEC3:ENST00000538872.1:c.225G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

PBK

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

Phenotype matches:
Proximity score 0.501 in interactome to CHD4 and phenotypic similarity 0.639 to Sifrim-Hitz-Weiss syndrome associated with CHD4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001182, Tapered finger
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0001182, Tapered finger
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 8-27667969-C-T [-/1] rs2294092
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC AMR: 0.0087%
ExAC EAS: 0.0463%
ExAC NFE: 0.0015%
gnomAD_E_EAS: 0.0174%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0183%

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:
Proximity score 0.501 in interactome to PPP2R1A and phenotypic similarity 0.847 to Mental retardation, autosomal dominant 36 associated with PPP2R1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0009179, Deviation of the 5th finger
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-108273267-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
CIP2A:ENST00000295746.8:c.2280G>A:p.(=)
CIP2A:ENST00000491772.1:c.1803G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

Phenotype matches:
Proximity score 0.501 in interactome to LRP4 and phenotypic similarity 0.561 to Cenani-Lenz syndrome associated with LRP4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009778, Short thumb
HP:0001363, Craniosynostosis - HP:0002007, Frontal bossing
HP:0011304, Broad thumb - HP:0009778, Short thumb
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Proximity score 0.501 in interactome to LRP4 and phenotypic similarity 0.953 to mouse mutant of LRP4.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0008730, fused phalanges
HP:0011304, Broad thumb - MP:0008730, fused phalanges
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-65365051-G-A [0/1] rs1172897922
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0011%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to NOTCH1 and phenotypic similarity 0.662 to Adams-Oliver syndrome associated with NOTCH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001362, Calvarial skull defect
HP:0011304, Broad thumb - HP:0009882, Short distal phalanx of finger
HP:0010055, Broad hallux - HP:0010760, Absent toe
Proximity score 0.500 in interactome to NOTCH1 and phenotypic similarity 0.254 to mouse mutant of NOTCH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0010097, abnormal retinal blood vessel morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 5-143229-G-A [0/1] rs1579283441
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
PLEKHG4B:ENST00000283426.6:c.477G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to AIM2 and phenotypic similarity 0.755 to mouse mutant of AIM2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-30490966-C-T [0/1] rs757195335
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
NOD1:ENST00000222823.4:c.2067G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ExAC NFE: 0.0030%
gnomAD_E_NFE: 0.0027%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to PUF60 and phenotypic similarity 0.818 to Intellectual disability-cardiac anomalies-short stature-joint laxity syndrome associated with PUF60.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0009237, Short 5th finger
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-55751233-C-T [0/1] rs1212266113
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
PPP6R1:ENST00000412770.2:c.1524G>A:p.(=)
PPP6R1:ENST00000587283.1:c.1524G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to NEPRO and phenotypic similarity 0.710 to Anauxetic dysplasia 3 associated with NEPRO.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0009844, Broad middle phalanx of finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 17-6683278-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
FBXO39:ENST00000321535.4:c.91C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to L1CAM and phenotypic similarity 0.481 to Hydrocephalus with congenital idiopathic intestinal pseudoobstruction associated with L1CAM.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001181, Adducted thumb
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0001181, Adducted thumb
Proximity score 0.500 in interactome to L1CAM and phenotypic similarity 0.675 to mouse mutant of L1CAM.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000583, long toenails
HP:0001363, Craniosynostosis - MP:0006198, enophthalmos
HP:0011304, Broad thumb - MP:0000583, long toenails
HP:0010055, Broad hallux - MP:0000583, long toenails
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 22-20456772-G-T [1/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
RIMBP3:ENST00000426804.1:c.4530C>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

Phenotype matches:
Proximity score 0.501 in interactome to SOX14 and phenotypic similarity 0.755 to mouse mutant of SOX14.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.501

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-197241247-G-A [0/1] rs369406870
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0242%
UK10K: 0.0264%
ESP AA: 0.0227%
ESP EA: 0.0116%
ESP All: 0.0154%
ExAC AFR: 0.0096%
ExAC AMR: 0.0173%
ExAC NFE: 0.0317%
ExAC SAS: 0.0065%
gnomAD_E_AFR: 0.0066%
gnomAD_E_AMR: 0.0331%
gnomAD_E_NFE: 0.0441%
gnomAD_E_SAS: 0.0033%
gnomAD_G_NFE: 0.0400%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to FIBP and phenotypic similarity 0.656 to Tall stature-intellectual disability-renal anomalies syndrome associated with FIBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001847, Long hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001172, Abnormal thumb morphology
HP:0010055, Broad hallux - HP:0001847, Long hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-22637717-T-C [0/1] rs766920763
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0116%
ExAC NFE: 0.0015%
gnomAD_E_EAS: 0.0117%
gnomAD_E_NFE: 0.0018%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to TELO2 and phenotypic similarity 0.650 to TELO2-related intellectual disability-neurodevelopmental disorder associated with TELO2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0004692, 4-5 toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 14-78365556-T-C [0/1] rs1334605165
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
ADCK1:ENST00000238561.5:c.696T>C:p.(=)
ADCK1:ENST00000341211.5:c.492T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to PLOD2 and phenotypic similarity 0.617 to Bruck syndrome 2 associated with PLOD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0002980, Femoral bowing
HP:0001363, Craniosynostosis - HP:0002645, Wormian bones
HP:0011304, Broad thumb - HP:0002980, Femoral bowing
HP:0010055, Broad hallux - HP:0002980, Femoral bowing
Proximity score 0.500 in interactome to PLOD2 and phenotypic similarity 0.265 to mouse mutant of PLOD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005544, corneal deposits
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to PLOD2 and phenotypic similarity 0.433 to fish mutant of PLOD2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0006781, bone mineralization increased process quality, abnormal
HP:0011304, Broad thumb - ZP:0020434, rib curved, abnormal
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 11-30352717-A-T [0/1] rs769433126
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
ARL14EP:ENST00000282032.3:c.222A>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0232%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to FBN2 and phenotypic similarity 0.510 to Contractural arachnodactyly, congenital associated with FBN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001166, Arachnodactyly
HP:0001363, Craniosynostosis - HP:0000268, Dolichocephaly
HP:0011304, Broad thumb - HP:0001181, Adducted thumb
HP:0010055, Broad hallux - HP:0001166, Arachnodactyly
Proximity score 0.500 in interactome to FBN2 and phenotypic similarity 0.790 to mouse mutant of FBN2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis - MP:0008730, fused phalanges
HP:0011304, Broad thumb - MP:0008730, fused phalanges
HP:0010055, Broad hallux - MP:0000564, syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-3422002-G-A [0/1] rs758885697
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
MEGF6:ENST00000294599.4:c.1722C>T:p.(=)
MEGF6:ENST00000356575.4:c.2037C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0023%
ExAC NFE: 0.0106%
ExAC SAS: 0.0206%
gnomAD_E_NFE: 0.0047%
gnomAD_E_SAS: 0.0099%
gnomAD_G_NFE: 0.0067%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.077

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-3422002-G-A [0/1] rs758885697
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
MEGF6:ENST00000294599.4:c.1722C>T:p.(=)
MEGF6:ENST00000356575.4:c.2037C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0023%
ExAC NFE: 0.0106%
ExAC SAS: 0.0206%
gnomAD_E_NFE: 0.0047%
gnomAD_E_SAS: 0.0099%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 1-3431226-C-T [0/1] rs372060403
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.055 CONTRIBUTING VARIANT
Transcripts:
MEGF6:ENST00000294599.4:c.426G>A:p.(=)
MEGF6:ENST00000356575.4:c.741G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0397%
ESP EA: 0.0241%
ESP All: 0.0163%
ExAC AMR: 0.0362%
ExAC EAS: 1.4658%
ExAC NFE: 0.0185%
gnomAD_E_AMR: 0.0034%
gnomAD_E_EAS: 1.0591%
gnomAD_E_NFE: 0.0116%
gnomAD_E_OTH: 0.0217%
gnomAD_G_EAS: 0.8631%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to RXRA and phenotypic similarity 0.772 to mouse mutant of RXRA.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0002092, abnormal eye morphology
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-21207493-C-T [0/1] rs753670409
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0048%
ExAC AMR: 0.0266%
ExAC EAS: 0.0234%
gnomAD_E_AMR: 0.0278%
gnomAD_E_EAS: 0.0118%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0187%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to SIAH1 and phenotypic similarity 0.858 to Buratti-Harel syndrome associated with SIAH1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0011304, Broad thumb
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-43172273-G-A [0/1] rs779402516
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0011%
ExAC EAS: 0.0347%
gnomAD_E_EAS: 0.0174%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

Phenotype matches:
Proximity score 0.500 in interactome to TELO2 and phenotypic similarity 0.650 to TELO2-related intellectual disability-neurodevelopmental disorder associated with TELO2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0004692, 4-5 toe syndactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 10-134040457-G-A [0/1] rs377335124
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
STK32C:ENST00000368622.1:c.135C>T:p.(=)
STK32C:ENST00000368625.4:c.525C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0129%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0196%
ExAC NFE: 0.0031%
gnomAD_E_AFR: 0.0131%
gnomAD_E_AMR: 0.0030%
gnomAD_E_NFE: 0.0018%
gnomAD_E_OTH: 0.0183%
gnomAD_G_AFR: 0.0458%
gnomAD_G_NFE: 0.0133%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

Phenotype matches:
Proximity score 0.500 in interactome to FGFR2 and phenotypic similarity 0.880 to Jackson-Weiss syndrome associated with FGFR2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010055, Broad hallux
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0001783, Broad metatarsal
HP:0010055, Broad hallux - HP:0010055, Broad hallux
Proximity score 0.500 in interactome to FGFR2 and phenotypic similarity 1.000 to mouse mutant of FGFR2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000157, abnormal sternum morphology
HP:0001363, Craniosynostosis - MP:0000081, premature cranial suture closure
HP:0011304, Broad thumb - MP:0000157, abnormal sternum morphology
HP:0010055, Broad hallux - MP:0000157, abnormal sternum morphology
Known diseases:
OMIM:245340 Erythrocyte lactate transporter defect - autosomal dominant
OMIM:610021 Hyperinsulinemic hypoglycemia, familial, 7 - autosomal dominant
OMIM:616095 Monocarboxylate transporter 1 deficiency - autosomal dominant/recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-113456674-A-G [0/1] rs773196238
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: UNCERTAIN_SIGNIFICANCE (criteria provided, single submitter)
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
SLC16A1:ENST00000369626.3:c.1342T>C:p.(=)
SLC16A1:ENST00000538576.1:c.1342T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0040%
ExAC EAS: 0.0347%
ExAC SAS: 0.0182%
gnomAD_E_EAS: 0.0348%
gnomAD_E_SAS: 0.0162%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

Phenotype matches:
Proximity score 0.500 in interactome to FIBP and phenotypic similarity 0.656 to Tall stature-intellectual disability-renal anomalies syndrome associated with FIBP.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001847, Long hallux
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001172, Abnormal thumb morphology
HP:0010055, Broad hallux - HP:0001847, Long hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-94540787-T-C [0/1] rs144417105
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0178%
ESP AA: 0.0908%
ESP EA: 0.0349%
ESP All: 0.0538%
ExAC AFR: 0.0195%
ExAC AMR: 0.0261%
ExAC FIN: 0.0303%
ExAC NFE: 0.0213%
gnomAD_E_AFR: 0.0131%
gnomAD_E_AMR: 0.0238%
gnomAD_E_FIN: 0.0730%
gnomAD_E_NFE: 0.0199%
gnomAD_G_AFR: 0.0229%
gnomAD_G_FIN: 0.0573%
gnomAD_G_NFE: 0.0267%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.095

Phenotype matches:
Proximity score 0.500 in interactome to MAPK1 and phenotypic similarity 0.619 to Noonan syndrome 13 associated with MAPK1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0030084, Clinodactyly
HP:0001363, Craniosynostosis - HP:0005487, Prominent metopic ridge
HP:0011304, Broad thumb - HP:0001182, Tapered finger
HP:0010055, Broad hallux - HP:0001845, Overlapping toe
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.095

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV X-152915087-C-T [0/1] rs145220210
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.095 CONTRIBUTING VARIANT
Transcripts:
DUSP9:ENST00000342782.3:c.774C>T:p.(=)
DUSP9:ENST00000370167.4:c.774C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0265%
TOPMed: 0.0111%
ExAC EAS: 0.2718%
ExAC NFE: 0.0021%
gnomAD_E_EAS: 0.2021%
gnomAD_E_NFE: 0.0025%
gnomAD_E_OTH: 0.0494%
gnomAD_G_EAS: 0.2882%
gnomAD_G_OTH: 0.1376%

Exomiser Score: 0.001

Phenotype Score: 0.570

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.570 to Hyperphosphatasia-intellectual disability syndrome associated with PGAP3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0030084, Clinodactyly
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0006118, Shortening of all distal phalanges of the fingers
HP:0010055, Broad hallux - HP:0030084, Clinodactyly
Phenotypic similarity 0.315 to mouse mutant involving PGAP3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002111, abnormal tail morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002111, abnormal tail morphology
HP:0010055, Broad hallux - MP:0002111, abnormal tail morphology
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.479 to Congenital disorder of glycosylation, type IIb associated with MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0010557, Overlapping fingers
HP:0001363, Craniosynostosis - HP:0000269, Prominent occiput
HP:0011304, Broad thumb - HP:0010557, Overlapping fingers
HP:0010055, Broad hallux - HP:0010557, Overlapping fingers
Proximity score 0.500 in interactome to MOGS and phenotypic similarity 0.920 to mouse mutant of MOGS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis - MP:0000063, decreased bone mineral density
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:615716 Hyperphosphatasia with mental retardation syndrome 4 - autosomal recessive
ORPHA:247262 Hyperphosphatasia-intellectual disability syndrome - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 17-37844262-G-A [0/1] rs199645746
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0068%
ExAC SAS: 0.0370%
gnomAD_E_SAS: 0.0171%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.077

Phenotype matches:
Phenotypic similarity 0.346 to mouse mutant involving SLC4A11.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005301, abnormal corneal endothelium morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.500 in interactome to CCNQ and phenotypic similarity 0.780 to STAR syndrome associated with CCNQ.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001770, Toe syndactyly
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001770, Toe syndactyly
Known diseases:
OMIM:217400 Corneal endothelial dystrophy and perceptive deafness - autosomal recessive
OMIM:217700 Corneal endothelial dystrophy, autosomal recessive - autosomal recessive
OMIM:613268 Corneal dystrophy, Fuchs endothelial, 4 - autosomal dominant
ORPHA:1490 Corneal dystrophy-perceptive deafness syndrome - autosomal recessive
ORPHA:293603 Congenital hereditary endothelial dystrophy type II - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.001

Phenotype Score: 0.500

Variant Score: 0.077

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 20-3212021-C-T [0/1] rs193080010
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1198%
TOPMed: 0.1043%
ExAC AMR: 0.0087%
ExAC EAS: 0.9024%
ExAC NFE: 0.0090%
ExAC SAS: 0.0787%
gnomAD_E_AMR: 0.0119%
gnomAD_E_EAS: 0.9508%
gnomAD_E_NFE: 0.0090%
gnomAD_E_SAS: 0.0780%
gnomAD_G_EAS: 0.8631%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 20-3211616-G-A [0/1] rs139297339
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
ClinVar: CONFLICTING_PATHOGENICITY_INTERPRETATIONS (criteria provided, conflicting interpretations)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1797%
TOPMed: 0.1311%
ESP AA: 0.1135%
ESP All: 0.0384%
ExAC AFR: 0.1784%
ExAC AMR: 0.0087%
ExAC EAS: 0.8958%
ExAC NFE: 0.0121%
ExAC OTH: 0.1119%
ExAC SAS: 0.0730%
gnomAD_E_AFR: 0.2299%
gnomAD_E_AMR: 0.0179%
gnomAD_E_EAS: 1.0214%
gnomAD_E_NFE: 0.0109%
gnomAD_E_OTH: 0.0367%
gnomAD_E_SAS: 0.0845%
gnomAD_G_AFR: 0.2070%
gnomAD_G_EAS: 0.9864%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.637

Phenotype matches:
No phenotype or PPI evidence
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:618084 Peeling skin syndrome 6 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.001

Phenotype Score: 0.000

Variant Score: 0.637

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-152324836-C-G [0/1] rs1254496666
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.637 CONTRIBUTING VARIANT
Transcripts:
FLG2:ENST00000388718.5:c.5426G>C:p.(Ser1809Thr)
Pathogenicity Data:
Best Score: 0.63699996
Polyphen2: 0.007 (B)
SIFT: 0.363 (T)
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.000

Phenotype Score: 0.332

Variant Score: 0.237

Phenotype matches:
Phenotypic similarity 0.323 to Peeling skin syndrome 1 associated with CDSN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001806, Onycholysis
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001806, Onycholysis
HP:0010055, Broad hallux - HP:0001806, Onycholysis
Phenotypic similarity 0.332 to mouse mutant involving CDSN.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001303, abnormal lens morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases:
OMIM:146520 Hypotrichosis 2 - autosomal dominant
OMIM:270300 Peeling skin syndrome 1 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.332

Variant Score: 0.237

Phenotype matches to diseases consistent with this MOI:
Phenotypic similarity 0.323 to OMIM:270300 Peeling skin syndrome 1
Variants contributing to score:
MISSENSE_VARIANT SNV 6-31084941-T-A [0/1] rs200396521
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
Pathogenicity Data:
Best Score: 1.0
SIFT: 0.000 (D)
Frequency Data:
1000Genomes: 0.5192%
TOPMed: 0.1058%
ExAC AFR: 0.0325%
ExAC AMR: 0.2715%
ExAC EAS: 1.7176%
ExAC FIN: 0.1224%
ExAC NFE: 0.0177%
ExAC OTH: 0.1144%
ExAC SAS: 0.0379%
gnomAD_E_AFR: 0.0282%
gnomAD_E_AMR: 0.2316%
gnomAD_E_EAS: 1.4615%
gnomAD_E_FIN: 0.1096%
gnomAD_E_NFE: 0.0143%
gnomAD_E_OTH: 0.0377%
gnomAD_E_SAS: 0.0304%
gnomAD_G_AFR: 0.0121%
gnomAD_G_AMR: 0.2421%
gnomAD_G_EAS: 1.8916%
gnomAD_G_FIN: 0.2367%
MISSENSE_VARIANT SNV 6-31084936-G-C [0/1] rs144038841
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP6]
Pathogenicity Data:
Best Score: 0.99
SIFT: 0.010 (D)
Frequency Data:
1000Genomes: 0.5192%
TOPMed: 0.1633%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0322%
ExAC AMR: 0.2714%
ExAC EAS: 1.7163%
ExAC FIN: 0.1224%
ExAC NFE: 0.0176%
ExAC OTH: 0.1142%
ExAC SAS: 0.0379%
gnomAD_E_AFR: 0.0282%
gnomAD_E_AMR: 0.2320%
gnomAD_E_EAS: 1.4669%
gnomAD_E_FIN: 0.1096%
gnomAD_E_NFE: 0.0143%
gnomAD_E_OTH: 0.0378%
gnomAD_E_SAS: 0.0305%
gnomAD_G_AFR: 0.0121%
gnomAD_G_AMR: 0.2421%
gnomAD_G_EAS: 1.8916%
gnomAD_G_FIN: 0.2365%
Other passed variants:
SYNONYMOUS_VARIANT SNV 6-31084723-G-A [0/1] rs117764398
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.3794%
TOPMed: 0.0808%
UK10K: 0.0264%
ESP AA: 0.1135%
ESP EA: 0.0465%
ESP All: 0.0692%
ExAC AFR: 0.0483%
ExAC AMR: 0.0432%
ExAC EAS: 1.3179%
ExAC NFE: 0.0435%
ExAC OTH: 0.2208%
ExAC SAS: 0.0182%
gnomAD_E_AFR: 0.0458%
gnomAD_E_AMR: 0.0774%
gnomAD_E_EAS: 1.1887%
gnomAD_E_FIN: 0.0090%
gnomAD_E_NFE: 0.0376%
gnomAD_E_OTH: 0.1094%
gnomAD_E_SAS: 0.0292%
gnomAD_G_AFR: 0.0344%
gnomAD_G_EAS: 0.2469%
gnomAD_G_NFE: 0.0334%

Exomiser Score: 0.000

Phenotype Score: 0.506

Variant Score: 0.029

Phenotype matches:
Phenotypic similarity 0.325 to zebrafish mutant involving NDC80.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0000399, head flat, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.506 in interactome to SMC1A and phenotypic similarity 0.790 to Developmental and epileptic encephalopathy 85, with or without midline brain defects associated with SMC1A.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0030084, Clinodactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0009471, Contracture of the proximal interphalangeal joint of the 3rd finger
HP:0010055, Broad hallux - HP:0010055, Broad hallux
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.506

Variant Score: 0.029

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 18-2608826-G-A [0/1] rs775421948
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Variant score: 0.029 CONTRIBUTING VARIANT
Transcripts:
NDC80:ENST00000261597.4:c.1685G>A:p.(Arg562Gln)
Pathogenicity Data:
Best Score: 0.028999984
Polyphen2: 0.002 (B)
SIFT: 0.971 (T)
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_AFR: 0.0196%
gnomAD_E_EAS: 0.0465%
gnomAD_E_SAS: 0.0195%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 9-67793922-C-T [0/1] rs796614575
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.600 CONTRIBUTING VARIANT
Transcripts:
FAM27B:ENST00000377484.3:c.53G>A:p.(Arg18Lys)
FAM27B:ENST00000315762.5:n.1756C>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.595

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 9-67793922-C-T [0/1] rs796614575
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.600 CONTRIBUTING VARIANT
Transcripts:
FAM27B:ENST00000377484.3:c.53G>A:p.(Arg18Lys)
FAM27B:ENST00000315762.5:n.1756C>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data
MISSENSE_VARIANT SNV 9-67793952-G-A [0/1] rs367573394
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.591 CONTRIBUTING VARIANT
Transcripts:
FAM27B:ENST00000377484.3:c.23C>T:p.(Thr8Met)
FAM27B:ENST00000315762.5:n.1786G>A:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0102%
gnomAD_E_EAS: 0.1059%
gnomAD_E_NFE: 0.0060%
gnomAD_E_OTH: 0.0722%
gnomAD_E_SAS: 0.0157%
Other passed variants:
SYNONYMOUS_VARIANT SNV 9-67793951-C-A [0/1] rs375326774
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-247274889-C-A [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.600 CONTRIBUTING VARIANT
Transcripts:
LINC02897:ENST00000408893.2:c.638G>T:p.(Trp213Leu)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 9-39888542-T-C [1/1] rs1556461968
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.600 CONTRIBUTING VARIANT
Transcripts:
SPATA31A2:ENST00000456183.2:c.1529T>C:p.(Leu510Pro)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-7934244-G-C [0/1] rs569642414
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.600 CONTRIBUTING VARIANT
Transcripts:
CTD-3193O13.9:ENST00000539422.1:c.3716C>G:p.(Pro1239Arg)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0032%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.600

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 19-58926946-G-T [0/1] rs372304121
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0024%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.599

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.599

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-145298363-C-T [0/1] rs200081155
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0086%
gnomAD_E_NFE: 0.0038%
gnomAD_E_SAS: 0.0043%
gnomAD_G_AFR: 0.0115%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.598

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-145298363-C-T [0/1] rs200081155
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0086%
gnomAD_E_NFE: 0.0038%
gnomAD_E_SAS: 0.0043%
gnomAD_G_AFR: 0.0115%
MISSENSE_VARIANT SNV 1-145298247-C-T [0/1] rs782682192
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0061%
gnomAD_E_NFE: 0.0058%
gnomAD_G_FIN: 0.0287%
gnomAD_G_NFE: 0.0133%
Other passed variants:
MISSENSE_VARIANT SNV 1-145368473-G-C [0/1] rs1043749
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.1309%
gnomAD_E_EAS: 0.0061%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0557%
gnomAD_E_SAS: 0.0034%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.593

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.593

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-16902844-G-T [0/1] rs199969012
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0440%
gnomAD_E_EAS: 0.0066%
gnomAD_E_FIN: 0.0804%
gnomAD_E_NFE: 0.0324%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.593

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-16902844-G-T [0/1] rs199969012
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0440%
gnomAD_E_EAS: 0.0066%
gnomAD_E_FIN: 0.0804%
gnomAD_E_NFE: 0.0324%
MISSENSE_VARIANT SNV 1-16918468-T-A [0/1] rs368239045
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.592 CONTRIBUTING VARIANT
Transcripts:
NBPF1:ENST00000430580.2:c.49A>T:p.(Ile17Phe)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0064%
ExAC EAS: 0.0925%
ExAC SAS: 0.0061%
gnomAD_E_EAS: 0.0290%
Other passed variants:
MISSENSE_VARIANT SNV 1-16895721-C-G [0/1] rs745573919
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0871%
gnomAD_E_AMR: 0.0151%
gnomAD_E_EAS: 0.3599%
gnomAD_E_FIN: 0.0094%
gnomAD_E_NFE: 0.0225%
gnomAD_E_OTH: 0.0190%
gnomAD_E_SAS: 0.0427%
gnomAD_G_AFR: 0.2393%
gnomAD_G_EAS: 0.5921%
gnomAD_G_NFE: 0.0745%
gnomAD_G_OTH: 0.1129%
SYNONYMOUS_VARIANT SNV 1-16912138-A-G [0/1] rs201223391
Variant score: 0.097
Transcripts:
NBPF1:ENST00000430580.2:c.834T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.1955%
gnomAD_E_AMR: 0.1293%
gnomAD_E_EAS: 0.0557%
gnomAD_E_FIN: 0.1477%
gnomAD_E_NFE: 0.1257%
gnomAD_E_OTH: 0.2194%
gnomAD_E_SAS: 0.0810%
SYNONYMOUS_VARIANT SNV 1-16895707-C-T [0/1] rs764129354
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0870%
gnomAD_E_AMR: 0.0091%
gnomAD_E_EAS: 0.3785%
gnomAD_E_FIN: 0.0183%
gnomAD_E_NFE: 0.0187%
gnomAD_E_OTH: 0.0568%
gnomAD_E_SAS: 0.0427%
gnomAD_G_AFR: 0.2390%
gnomAD_G_EAS: 0.7864%
gnomAD_G_NFE: 0.0811%
gnomAD_G_OTH: 0.1134%

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.012

Phenotype matches:
Proximity score 0.500 in interactome to SCLT1 and phenotypic similarity 0.720 to mouse mutant of SCLT1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0009743, preaxial polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0009743, preaxial polydactyly
HP:0010055, Broad hallux - MP:0009743, preaxial polydactyly
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.012

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 21-45959293-A-G [0/1] rs782221526
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.5391%
TOPMed: 0.3321%
ExAC AFR: 0.5305%
ExAC AMR: 0.5221%
ExAC EAS: 1.8813%
ExAC FIN: 0.1979%
ExAC NFE: 0.1598%
ExAC OTH: 1.0090%
ExAC SAS: 0.2124%
gnomAD_E_AFR: 0.4915%
gnomAD_E_AMR: 0.3905%
gnomAD_E_EAS: 1.8480%
gnomAD_E_FIN: 0.0901%
gnomAD_E_NFE: 0.1697%
gnomAD_E_OTH: 0.4750%
gnomAD_E_SAS: 0.1885%
gnomAD_G_AFR: 0.6438%
gnomAD_G_AMR: 0.1193%
gnomAD_G_EAS: 1.4180%
gnomAD_G_FIN: 0.0859%
gnomAD_G_NFE: 0.1942%
gnomAD_G_OTH: 0.2045%
MISSENSE_VARIANT SNV 21-45959298-T-C [0/1] rs147442908
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
SIFT: 1.000 (T)
Frequency Data:
1000Genomes: 0.6190%
TOPMed: 0.3560%
ESP AA: 0.5901%
ESP EA: 0.0581%
ESP All: 0.2384%
ExAC AFR: 0.4883%
ExAC AMR: 0.2523%
ExAC EAS: 1.8817%
ExAC FIN: 0.0304%
ExAC NFE: 0.0949%
ExAC OTH: 0.1116%
ExAC SAS: 0.1274%
gnomAD_E_AFR: 0.5501%
gnomAD_E_AMR: 0.2235%
gnomAD_E_EAS: 1.8129%
gnomAD_E_FIN: 0.0090%
gnomAD_E_NFE: 0.0610%
gnomAD_E_OTH: 0.2925%
gnomAD_E_SAS: 0.1008%
gnomAD_G_AFR: 0.5295%
gnomAD_G_AMR: 0.3580%
gnomAD_G_EAS: 1.2963%
gnomAD_G_FIN: 0.0573%
gnomAD_G_NFE: 0.0336%

Exomiser Score: 0.000

Phenotype Score: 0.504

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.479 to Autoimmune pulmonary alveolar proteinosis associated with HLA-DRB1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Proximity score 0.504 in interactome to SEC24C and phenotypic similarity 0.740 to 22q11.2 deletion syndrome associated with SEC24C.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001829, Foot polydactyly
HP:0001363, Craniosynostosis - HP:0011324, Multiple suture craniosynostosis
HP:0011304, Broad thumb - HP:0001161, Hand polydactyly
HP:0010055, Broad hallux - HP:0001829, Foot polydactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:126200 Multiple sclerosis, susceptibility to, 1 (susceptibility)
OMIM:181000 Sarcoidosis, susceptibility to, 1 (susceptibility)
ORPHA:2073 Narcolepsy type 1 (susceptibility)
ORPHA:220402 Limited cutaneous systemic sclerosis (susceptibility)
ORPHA:397 Giant cell arteritis (susceptibility)
ORPHA:545 Follicular lymphoma (susceptibility)
ORPHA:747 Autoimmune pulmonary alveolar proteinosis (susceptibility)
ORPHA:797 Sarcoidosis (susceptibility)
ORPHA:85414 Systemic-onset juvenile idiopathic arthritis (susceptibility)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.162

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_REGION_VARIANT SNV 6-32548053-A-G [0/1] rs28732251
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.299 CONTRIBUTING VARIANT
Transcripts:
HLA-DRB1:ENST00000360004.5:c.764-6T>C:p.?
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.4631%
gnomAD_E_AMR: 0.2896%
gnomAD_E_EAS: 0.8238%
gnomAD_E_FIN: 0.1160%
gnomAD_E_NFE: 0.3312%
gnomAD_E_OTH: 0.3086%
gnomAD_E_SAS: 0.3272%
gnomAD_G_AFR: 1.4742%
gnomAD_G_AMR: 0.6211%
gnomAD_G_EAS: 1.7271%
gnomAD_G_FIN: 0.6720%
gnomAD_G_NFE: 1.5136%
gnomAD_G_OTH: 1.5000%
SYNONYMOUS_VARIANT SNV 6-32549587-T-G [0/1] rs2308761
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.025 CONTRIBUTING VARIANT
Transcripts:
HLA-DRB1:ENST00000360004.5:c.399A>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.4615%
gnomAD_E_AMR: 0.3676%
gnomAD_E_EAS: 0.8338%
gnomAD_E_FIN: 0.0143%
gnomAD_E_NFE: 0.2176%
gnomAD_E_OTH: 0.3798%
gnomAD_E_SAS: 0.2057%
gnomAD_G_AFR: 1.2306%
gnomAD_G_AMR: 0.7062%
gnomAD_G_EAS: 1.8822%
gnomAD_G_FIN: 1.0424%
gnomAD_G_NFE: 1.0781%
gnomAD_G_OTH: 1.3447%
Other passed variants:
SYNONYMOUS_VARIANT SNV 6-32549392-C-T [0/1] rs16822972
Variant score: 0.021
Transcripts:
HLA-DRB1:ENST00000360004.5:c.594G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 1.4300%
gnomAD_G_AMR: 0.9434%
gnomAD_G_EAS: 1.9203%
gnomAD_G_FIN: 0.4012%
gnomAD_G_NFE: 1.4284%
gnomAD_G_OTH: 0.9346%

Exomiser Score: 0.000

Phenotype Score: 0.501

Variant Score: 0.000

Phenotype matches:
Proximity score 0.501 in interactome to ITGB1BP1 and phenotypic similarity 0.750 to mouse mutant of ITGB1BP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0004509, abnormal pelvic girdle bone morphology
HP:0001363, Craniosynostosis - MP:0003840, abnormal coronal suture morphology
HP:0011304, Broad thumb - MP:0004509, abnormal pelvic girdle bone morphology
HP:0010055, Broad hallux - MP:0004509, abnormal pelvic girdle bone morphology
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.501

Variant Score: 0.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-124739825-T-C [0/1] rs746734858
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Variant score: 0.000 CONTRIBUTING VARIANT
Transcripts:
HEG1:ENST00000311127.4:c.1063A>G:p.(Lys355Glu)
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
SIFT: 1.000 (T)
Frequency Data:
TOPMed: 0.0038%
ExAC AMR: 0.0088%
ExAC EAS: 0.0117%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0522%

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.274 to Autosomal recessive spastic paraplegia type 74 associated with IBA57.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb -
HP:0010055, Broad hallux - HP:0001761, Pes cavus
Proximity score 0.500 in interactome to NUBP1 and phenotypic similarity 0.794 to mouse mutant of NUBP1.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0001304, cataract
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:615330 Multiple mitochondrial dysfunctions syndrome 3 - autosomal recessive
OMIM:616451 ?Spastic paraplegia 74, autosomal recessive (unconfirmed)
ORPHA:468661 Autosomal recessive spastic paraplegia type 74 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.278

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-228362991-G-A [0/1] rs749840888
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.278
Polyphen2: 0.022 (B)
SIFT: 0.722 (T)
Frequency Data:
ExAC NFE: 0.0031%
gnomAD_E_NFE: 0.0027%

Exomiser Score: 0.000

Phenotype Score: 0.500

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.479 to Surfactant metabolism dysfunction, pulmonary, 3 associated with ABCA3.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001217, Clubbing
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0001217, Clubbing
HP:0010055, Broad hallux - HP:0001217, Clubbing
Proximity score 0.500 in interactome to ETV5 and phenotypic similarity 0.737 to mouse mutant of ETV5.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000562, polydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0000562, polydactyly
HP:0010055, Broad hallux - MP:0000562, polydactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:610921 Surfactant metabolism dysfunction, pulmonary, 3 - autosomal recessive
ORPHA:2032 Idiopathic pulmonary fibrosis - polygenic
ORPHA:70587 Infant acute respiratory distress syndrome - unknown
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 16-2336835-C-T [0/1] rs764759666
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
ABCA3:ENST00000301732.5:c.3138G>A:p.(=)
ABCA3:ENST00000382381.3:c.2964G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0034%
ExAC AFR: 0.0096%
ExAC AMR: 0.0086%
ExAC EAS: 0.0116%
ExAC NFE: 0.0090%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0058%
gnomAD_E_FIN: 0.0090%
gnomAD_E_NFE: 0.0045%
gnomAD_E_SAS: 0.0065%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.538

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.538

No phenotype matches to diseases with this MOI.
Variants contributing to score:
DISRUPTIVE_INFRAME_DELETION DEL 16-15457556-AGTGAGCAGACACACTCGGGAGGTGTCTTGAGAT-A [0/1] rs773123485
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.588 CONTRIBUTING VARIANT
Transcripts:
NPIPA5:ENST00000360151.4:c.980_1012del:p.(Asn327_Leu338delinsIle)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0035%
gnomAD_E_EAS: 0.0382%
gnomAD_E_NFE: 0.0047%
gnomAD_E_OTH: 0.0393%
gnomAD_G_AFR: 0.1902%
gnomAD_G_AMR: 0.7163%
gnomAD_G_EAS: 1.1881%
gnomAD_G_FIN: 0.7033%
gnomAD_G_NFE: 0.2903%
gnomAD_G_OTH: 0.5580%
FRAMESHIFT_TRUNCATION DEL 16-15457591-ATCATCCGCTGAGGGTGGAGCTGAGGGTGGAAGGGGAGT-A [0/1] rs764101650
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.487 CONTRIBUTING VARIANT
Transcripts:
NPIPA5:ENST00000360151.4:c.940_977del:p.(Thr314fs)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.0072%
gnomAD_E_AMR: 0.0070%
gnomAD_E_EAS: 0.0398%
gnomAD_E_NFE: 0.0028%
gnomAD_E_OTH: 0.0394%
gnomAD_G_AFR: 0.2922%
gnomAD_G_AMR: 0.7862%
gnomAD_G_EAS: 1.5660%
gnomAD_G_FIN: 1.0480%
gnomAD_G_NFE: 0.5083%
gnomAD_G_OTH: 0.8373%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.521

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.521

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 5-140221071-G-T [0/1] rs62384463
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2, BP4]
Pathogenicity Data:
Best Score: 0.999959
Polyphen2: 0.012 (B)
Mutation Taster: 1.000 (P)
SIFT: 0.169 (T)
Frequency Data:
gnomAD_E_AFR: 0.0270%
gnomAD_E_AMR: 0.3382%
gnomAD_E_EAS: 0.1847%
gnomAD_E_FIN: 0.0433%
gnomAD_E_NFE: 0.0789%
gnomAD_E_OTH: 0.1034%
gnomAD_E_SAS: 0.0645%
gnomAD_G_EAS: 0.1312%
gnomAD_G_FIN: 0.0296%
gnomAD_G_NFE: 0.0275%
SYNONYMOUS_VARIANT SNV 5-140221065-G-A [0/1] rs62384462
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 0.1581%
gnomAD_E_AMR: 0.1267%
gnomAD_E_EAS: 0.0075%
gnomAD_E_FIN: 0.0605%
gnomAD_E_NFE: 0.0718%
gnomAD_E_OTH: 0.0217%
gnomAD_E_SAS: 0.0193%
gnomAD_G_AFR: 0.1074%
gnomAD_G_EAS: 0.0663%
gnomAD_G_FIN: 0.0600%
gnomAD_G_NFE: 0.0279%
gnomAD_G_OTH: 0.2123%

Exomiser Score: 0.000

Phenotype Score: 0.432

Variant Score: 0.000

Phenotype matches:
Phenotypic similarity 0.432 to Idiopathic pulmonary fibrosis associated with MUC5B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0100759, Clubbing of fingers
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0100759, Clubbing of fingers
HP:0010055, Broad hallux - HP:0100759, Clubbing of fingers
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:178500 Pulmonary fibrosis, idiopathic, susceptibility to (susceptibility)
ORPHA:2032 Idiopathic pulmonary fibrosis (susceptibility)
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.184

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 11-1268488-C-T [0/1] rs200106077
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.41900003
SIFT: 0.581 (T)
Frequency Data:
gnomAD_E_AFR: 0.0198%
gnomAD_E_AMR: 0.0030%
gnomAD_E_EAS: 0.0767%
gnomAD_E_NFE: 0.0054%
gnomAD_E_SAS: 0.0228%
gnomAD_G_AFR: 0.0577%
gnomAD_G_EAS: 1.1436%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 11-1254268-G-A [0/1] rs567233629
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.070 CONTRIBUTING VARIANT
Transcripts:
MUC5B:ENST00000447027.1:c.2100G>A:p.(=)
MUC5B:ENST00000529681.1:c.2091G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0295%
ExAC EAS: 0.9442%
ExAC OTH: 0.2146%
ExAC SAS: 0.0090%
gnomAD_E_EAS: 0.6938%
gnomAD_E_OTH: 0.0194%
gnomAD_E_SAS: 0.0034%
gnomAD_G_EAS: 1.1714%

AMN

Exomiser Score: 0.000

Phenotype Score: 0.291

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.583 to mouse mutant involving AMN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000157, abnormal sternum morphology
HP:0001363, Craniosynostosis - MP:0001297, microphthalmia
HP:0011304, Broad thumb - MP:0000157, abnormal sternum morphology
HP:0010055, Broad hallux - MP:0000157, abnormal sternum morphology
Proximity score 0.500 in interactome to CBL and phenotypic similarity 0.642 to Noonan syndrome associated with CBL.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0004209, Clinodactyly of the 5th finger
HP:0010055, Broad hallux - HP:0001156, Brachydactyly
Proximity score 0.500 in interactome to CBL and phenotypic similarity 0.299 to mouse mutant of CBL.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:618882 Imerslund-Grasbeck syndrome 2 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.291

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 14-103394846-C-A [0/1] rs775510849
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
AMN:ENST00000299155.5:c.291C>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC EAS: 0.0165%
ExAC SAS: 0.0078%
gnomAD_E_EAS: 0.0060%
gnomAD_E_SAS: 0.0033%

Exomiser Score: 0.000

Phenotype Score: 0.278

Variant Score: 0.099

Phenotype matches:
Phenotypic similarity 0.278 to mouse mutant involving LTN1.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0001312, abnormal cornea morphology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.278

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 21-30313625-G-A [0/1] rs554472667
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
LTN1:ENST00000361371.5:c.4399C>T:p.(=)
LTN1:ENST00000389194.2:c.4537C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0030%
ExAC EAS: 0.0462%
gnomAD_E_EAS: 0.0580%

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

Phenotype matches:
Phenotypic similarity 0.293 to Synaptic congenital myasthenic syndromes associated with LAMB2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - HP:0003691, Scapular winging
HP:0010055, Broad hallux - HP:0001762, Talipes equinovarus
Phenotypic similarity 0.340 to mouse mutant involving LAMB2.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - MP:0005551, abnormal eye electrophysiology
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Proximity score 0.504 in interactome to LAMA5 and phenotypic similarity 0.739 to mouse mutant of LAMA5.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:609049 Pierson syndrome - autosomal recessive
OMIM:614199 Nephrotic syndrome, type 5, with or without ocular abnormalities - autosomal recessive
ORPHA:98915 Synaptic congenital myasthenic syndromes - unknown
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-49160932-T-C [0/1] rs1190966266
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
LAMB2:ENST00000305544.4:c.3930A>G:p.(=)
LAMB2:ENST00000418109.1:c.3930A>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0019%

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

Phenotype matches:
Proximity score 0.503 in interactome to CDC45 and phenotypic similarity 0.703 to Ear-patella-short stature syndrome associated with CDC45.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0004209, Clinodactyly of the 5th finger
HP:0001363, Craniosynostosis - HP:0001363, Craniosynostosis
HP:0011304, Broad thumb - HP:0100490, Camptodactyly of finger
HP:0010055, Broad hallux - HP:0004209, Clinodactyly of the 5th finger
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:616185 Ovarian dysgenesis 4 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.252

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-119252724-C-A [0/1] rs1221350810
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
MCM9:ENST00000316068.3:c.165G>T:p.(=)
MCM9:ENST00000316316.6:c.165G>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_EAS: 0.0058%

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.100

Phenotype matches:
Proximity score 0.502 in interactome to FURIN and phenotypic similarity 0.935 to mouse mutant of FURIN.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002544, brachydactyly
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002544, brachydactyly
HP:0010055, Broad hallux - MP:0002544, brachydactyly
Proximity score 0.502 in interactome to FURIN and phenotypic similarity 0.274 to fish mutant of FURIN.
Best Phenotype Matches:
HP:0001156, Brachydactyly -
HP:0001363, Craniosynostosis - ZP:0006947, symplectic in contact with Meckel's cartilage, abnormal
HP:0011304, Broad thumb -
HP:0010055, Broad hallux -
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:617115 Peeling skin syndrome 5 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 18-61648960-T-C [0/1] rs2050674105
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.099

Phenotype matches:
Proximity score 0.503 in interactome to SLC26A2 and phenotypic similarity 0.668 to Atelosteogenesis type II associated with SLC26A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - HP:0001156, Brachydactyly
HP:0001363, Craniosynostosis - HP:0001357, Plagiocephaly
HP:0011304, Broad thumb - HP:0001234, Hitchhiker thumb
HP:0010055, Broad hallux - HP:0001852, Sandal gap
Proximity score 0.503 in interactome to SLC26A2 and phenotypic similarity 0.560 to mouse mutant of SLC26A2.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000165, abnormal long bone hypertrophic chondrocyte zone
HP:0001363, Craniosynostosis - MP:0003419, delayed endochondral bone ossification
HP:0011304, Broad thumb - MP:0004358, bowed tibia
HP:0010055, Broad hallux - MP:0004358, bowed tibia
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:214700 Diarrhea 1, secretory chloride, congenital - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.251

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-107420200-C-G [0/1] rs577337450
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
SLC26A3:ENST00000340010.5:c.1320G>C:p.(=)
SLC26A3:ENST00000422236.2:c.1215G>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0015%
ExAC EAS: 0.0813%
gnomAD_E_EAS: 0.0754%

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to CS and phenotypic similarity 0.755 to mouse mutant of CS.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis -
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:212138 Carnitine-acylcarnitine translocase deficiency - autosomal recessive
ORPHA:159 Carnitine-acylcarnitine translocase deficiency - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-48936201-G-A [0/1] rs1279750269
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0019%

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

Phenotype matches:
Proximity score 0.500 in interactome to MYO10 and phenotypic similarity 0.730 to mouse mutant of MYO10.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0000564, syndactyly
HP:0001363, Craniosynostosis - MP:0001289, persistence of hyaloid vascular system
HP:0011304, Broad thumb - MP:0000564, syndactyly
HP:0010055, Broad hallux - MP:0000564, syndactyly
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:618594 Nephrotic syndrome, type 21 - autosomal recessive
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-58197108-G-A [0/1] rs758880730
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.099

Phenotype matches:
Proximity score 0.500 in interactome to RABL2B and phenotypic similarity 0.752 to mouse mutant of RABL2B.
Best Phenotype Matches:
HP:0001156, Brachydactyly - MP:0002110, abnormal digit morphology
HP:0001363, Craniosynostosis - MP:0006203, eye hemorrhage
HP:0011304, Broad thumb - MP:0002110, abnormal digit morphology
HP:0010055, Broad hallux - MP:0002110, abnormal digit morphology
Known diseases - observed variants incompatible with mode of inheritance:
OMIM:612551 End-stage renal disease, nondiabetic, susceptibility to (susceptibility)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.250

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 22-36661545-C-T [0/1] rs201375679
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0072%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0288%
ExAC NFE: 0.0045%
gnomAD_E_AFR: 0.0261%
gnomAD_E_FIN: 0.0045%
gnomAD_E_NFE: 0.0054%
gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.309

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

X_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.309

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV X-55103931-T-C [0/1] rs149758580
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [BP4]
Pathogenicity Data:
Best Score: 0.784
Polyphen2: 0.659 (P)
SIFT: 0.216 (T)
Frequency Data:
1000Genomes: 0.1325%
TOPMed: 0.0385%
ExAC AMR: 0.0107%
ExAC EAS: 1.2975%
ExAC SAS: 0.0297%
gnomAD_E_EAS: 1.1351%
gnomAD_E_OTH: 0.0494%
gnomAD_E_SAS: 0.0419%
gnomAD_G_EAS: 1.7013%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.294

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.294

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 3-97611805-C-G [0/1] rs139188566
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.488 CONTRIBUTING VARIANT
Transcripts:
CRYBG3:ENST00000182096.4:c.1698C>G:p.(His566Gln)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.1398%
TOPMed: 0.0552%
ExAC EAS: 0.7452%
ExAC NFE: 0.0030%
ExAC SAS: 0.0121%
gnomAD_E_EAS: 0.7579%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0071%
gnomAD_G_EAS: 0.8663%
gnomAD_G_NFE: 0.0067%
SYNONYMOUS_VARIANT SNV 3-97607242-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
CRYBG3:ENST00000182096.4:c.1503C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 3-97607242-C-T [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
CRYBG3:ENST00000182096.4:c.1503C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.273

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.273

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 2-167992429-T-C [0/1] rs74698684
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.978
Polyphen2: 0.677 (P)
SIFT: 0.022 (D)
Frequency Data:
1000Genomes: 0.3594%
TOPMed: 0.0680%
ExAC EAS: 1.4830%
ExAC NFE: 0.0046%
ExAC SAS: 0.0069%
gnomAD_E_EAS: 1.5688%
gnomAD_E_NFE: 0.0037%
gnomAD_E_SAS: 0.0241%
gnomAD_G_EAS: 1.6069%
SYNONYMOUS_VARIANT SNV 2-168108351-G-A [0/1] rs186691484
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0094%
UK10K: 0.0132%
ESP EA: 0.0122%
ESP All: 0.0084%
ExAC EAS: 0.1398%
ExAC NFE: 0.0151%
ExAC SAS: 0.0367%
gnomAD_E_AMR: 0.0060%
gnomAD_E_EAS: 0.2962%
gnomAD_E_NFE: 0.0118%
gnomAD_E_SAS: 0.0456%
gnomAD_G_AMR: 0.1196%
gnomAD_G_EAS: 0.2541%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.269

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.269

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SPLICE_ACCEPTOR_VARIANT SNV 21-9909279-T-A [0/1] rs796504204
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.275 CONTRIBUTING VARIANT
Transcripts:
TEKT4P2:ENST00000416067.1:n.130-2A>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.7353%
gnomAD_G_AMR: 1.7544%
gnomAD_G_EAS: 1.1765%
gnomAD_G_FIN: 1.8499%
gnomAD_G_NFE: 1.0155%
gnomAD_G_OTH: 0.6623%
SPLICE_REGION_VARIANT SNV 21-9909282-G-A [0/1] rs796601648
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.263 CONTRIBUTING VARIANT
Transcripts:
TEKT4P2:ENST00000416067.1:n.130-5C>T:
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_G_AFR: 0.7991%
gnomAD_G_AMR: 1.7857%
gnomAD_G_EAS: 1.2821%
gnomAD_G_FIN: 1.5963%
gnomAD_G_NFE: 1.1327%
gnomAD_G_OTH: 0.6849%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 6-24429329-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
GPLD1:ENST00000230036.1:c.2454T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 20-20453523-G-A [0/1] rs1602474521
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
RALGAPA2:ENST00000202677.7:c.5445C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 4-69795762-A-G [0/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
UGT2A3:ENST00000251566.4:c.1353T>C:p.(=)
UGT2A3:ENST00000420231.2:c.486T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-52537597-G-T [1/1]
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
ZNF432:ENST00000221315.5:c.1335C>A:p.(=)
ZNF432:ENST00000594154.1:c.1335C>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
No frequency data

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 10-98742362-G-A [0/1] rs1194780039
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
C10orf12:ENST00000286067.2:c.1215G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 15-29428644-A-G [0/1] rs978303869
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
FAM189A1:ENST00000261275.4:c.852T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 2-39417507-G-C [0/1] rs1341397520
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
CDKL4:ENST00000378803.1:c.591C>G:p.(=)
CDKL4:ENST00000395035.3:c.591C>G:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
gnomAD_E_AMR: 0.0030%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
Known diseases:
OMIM:601583 Wilms tumor susceptibility-5 (susceptibility)
ORPHA:654 Nephroblastoma (susceptibility)
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-39472856-C-T [0/1] rs770670204
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
ExAC AMR: 0.0087%
ExAC NFE: 0.0015%
gnomAD_E_AMR: 0.0030%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 11-64602405-G-A [0/1] rs1319739374
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
CDC42BPG:ENST00000342711.5:c.2091C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0011%
gnomAD_E_EAS: 0.0116%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 2-241515989-G-A [0/1] rs777178847
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.100 CONTRIBUTING VARIANT
Transcripts:
RNPEPL1:ENST00000270357.4:c.855G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0034%
gnomAD_E_EAS: 0.0117%
gnomAD_E_NFE: 0.0009%
gnomAD_E_SAS: 0.0033%
gnomAD_G_NFE: 0.0134%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 1-20073747-G-A [0/1] rs138797643
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0024%
ESP EA: 0.0116%
ESP All: 0.0077%
ExAC AFR: 0.0101%
ExAC NFE: 0.0061%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0066%
gnomAD_E_EAS: 0.0058%
gnomAD_E_NFE: 0.0063%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0033%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.100

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 16-31503397-T-C [0/1] rs190298510
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0023%
ExAC EAS: 0.0232%
gnomAD_E_EAS: 0.0348%
gnomAD_E_SAS: 0.0032%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 11-1619403-A-G [0/1] rs569804144
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
KRTAP5-2:ENST00000412090.1:c.78T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0030%
gnomAD_E_FIN: 0.0284%
gnomAD_E_NFE: 0.0426%
gnomAD_E_OTH: 0.0380%
gnomAD_E_SAS: 0.0443%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.052

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 11-1619403-A-G [0/1] rs569804144
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
KRTAP5-2:ENST00000412090.1:c.78T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AMR: 0.0030%
gnomAD_E_FIN: 0.0284%
gnomAD_E_NFE: 0.0426%
gnomAD_E_OTH: 0.0380%
gnomAD_E_SAS: 0.0443%
MISSENSE_VARIANT SNV 11-1619423-T-C [0/1] rs538571214
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.005 CONTRIBUTING VARIANT
Transcripts:
KRTAP5-2:ENST00000412090.1:c.58A>G:p.(Ser20Gly)
Pathogenicity Data:
Best Score: 0.005
Polyphen2: 0.005 (B)
Frequency Data:
gnomAD_E_AFR: 0.0135%
gnomAD_E_AMR: 0.0213%
gnomAD_E_FIN: 0.0767%
gnomAD_E_NFE: 0.1038%
gnomAD_E_OTH: 0.1151%
gnomAD_E_SAS: 0.1383%
gnomAD_G_AFR: 0.0708%
gnomAD_G_AMR: 0.3049%
gnomAD_G_EAS: 0.0761%
gnomAD_G_FIN: 0.3261%
gnomAD_G_NFE: 0.2889%
gnomAD_G_OTH: 0.1235%
Other passed variants:
MISSENSE_VARIANT SNV 11-1619459-T-C [0/1] rs542255670
Variant score: 0.000
Transcripts:
KRTAP5-2:ENST00000412090.1:c.22A>G:p.(Arg8Gly)
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
Frequency Data:
1000Genomes: 0.0399%
TOPMed: 0.0399%
gnomAD_E_AFR: 0.0601%
gnomAD_G_AFR: 0.0234%
gnomAD_G_EAS: 0.0637%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-10168342-T-C [0/1] rs531439346
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
CLEC12B:ENST00000396502.1:c.696T>C:p.(=)
CLEC12B:ENST00000338896.5:c.680+16T>C:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0023%
ExAC EAS: 0.0116%
ExAC NFE: 0.0015%
gnomAD_E_EAS: 0.0581%
gnomAD_E_NFE: 0.0009%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 17-46847448-G-A [0/1] rs199679267
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
TTLL6:ENST00000393382.3:c.2052C>T:p.(=)
TTLL6:ENST00000433608.2:c.1131C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0599%
TOPMed: 0.0079%
ExAC AFR: 0.0099%
ExAC EAS: 0.0231%
ExAC NFE: 0.0015%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0175%
gnomAD_E_NFE: 0.0018%
gnomAD_G_NFE: 0.0067%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 12-27571026-A-C [0/1] rs951223490
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0008%
gnomAD_E_EAS: 0.0117%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-138764604-G-A [0/1] rs768822061
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0174%
gnomAD_G_EAS: 0.0617%

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 7-138764604-G-A [0/1] rs768822061
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0004%
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0174%
gnomAD_G_EAS: 0.0617%
SYNONYMOUS_VARIANT SNV 7-138764808-G-C [0/1] rs767144137
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
ExAC EAS: 0.0231%
gnomAD_E_EAS: 0.0174%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 22-42536461-C-T [0/1] rs777649126
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
CYP2D7:ENST00000358097.4:c.1323G>A:p.(=)
CYP2D7:ENST00000433992.1:c.1380G>A:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0094%
gnomAD_E_AMR: 0.0084%
gnomAD_E_EAS: 0.0587%
gnomAD_E_NFE: 0.0019%
gnomAD_G_EAS: 0.0617%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 11-100863297-C-T [0/1] rs544581252
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Variant score: 0.099 CONTRIBUTING VARIANT
Transcripts:
TMEM133:ENST00000303130.2:c.258C>T:p.(=)
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
ExAC EAS: 0.0116%
gnomAD_E_AFR: 0.0131%
gnomAD_E_EAS: 0.0116%
gnomAD_G_EAS: 0.0618%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 15-81172082-C-T [0/1] rs147426682
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0223%
ESP AA: 0.0454%
ESP All: 0.0154%
ExAC AFR: 0.0673%
ExAC EAS: 0.0463%
ExAC SAS: 0.0061%
gnomAD_E_AFR: 0.0653%
gnomAD_E_AMR: 0.0089%
gnomAD_E_EAS: 0.0464%
gnomAD_E_NFE: 0.0009%
gnomAD_E_OTH: 0.0183%
gnomAD_E_SAS: 0.0032%
gnomAD_G_AFR: 0.0115%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.099

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 19-56163962-C-T [0/1] rs368332551
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
No pathogenicity data
Frequency Data:
TOPMed: 0.0272%
ESP AA: 0.0227%
ESP All: 0.0077%
ExAC AFR: 0.0683%
gnomAD_E_AFR: 0.0788%
gnomAD_E_AMR: 0.0030%
gnomAD_E_NFE: 0.0009%
gnomAD_G_AFR: 0.0805%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.063

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_RECESSIVE

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.063

No phenotype matches to diseases with this MOI.
Variants contributing to score:
SYNONYMOUS_VARIANT SNV 16-89017483-C-G [1/1] rs200170070
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
No pathogenicity data
Frequency Data:
gnomAD_E_AFR: 1.1911%
gnomAD_E_AMR: 0.1741%
gnomAD_E_EAS: 0.0120%
gnomAD_E_FIN: 0.0314%
gnomAD_E_NFE: 0.0788%
gnomAD_E_OTH: 0.0368%
gnomAD_E_SAS: 0.1701%
gnomAD_G_AFR: 0.8479%
gnomAD_G_AMR: 0.6276%
gnomAD_G_EAS: 0.2252%
gnomAD_G_FIN: 1.3185%
gnomAD_G_NFE: 0.5303%
gnomAD_G_OTH: 0.8811%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 18-12127835-G-A [0/1] rs999033599
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
Frequency Data:
TOPMed: 0.0030%
gnomAD_E_AMR: 0.0047%
gnomAD_E_NFE: 0.0079%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 10-81471597-C-G [0/1] rs1317635955
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE [PM2]
Pathogenicity Data:
Best Score: 0.0
SIFT: 1.000 (T)
Frequency Data:
gnomAD_E_EAS: 0.0140%
gnomAD_E_FIN: 0.0402%
gnomAD_E_NFE: 0.0029%
gnomAD_E_SAS: 0.0087%
gnomAD_G_AFR: 0.0659%
gnomAD_G_EAS: 0.0797%
gnomAD_G_FIN: 0.0634%
gnomAD_G_NFE: 0.0143%

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

Phenotype matches:
No phenotype or PPI evidence
No known disease
Gene scores under compatible inheritance modes:

AUTOSOMAL_DOMINANT

Exomiser Score: 0.000

Phenotype Score: 0.000

Variant Score: 0.000

No phenotype matches to diseases with this MOI.
Variants contributing to score:
MISSENSE_VARIANT SNV 1-153085095-A-G [0/1] rs533901980
Exomiser ACMG: UNCERTAIN_SIGNIFICANCE []
Pathogenicity Data:
Best Score: 0.0
Polyphen2: 0.000 (B)
Frequency Data:
1000Genomes: 0.0200%
TOPMed: 0.0212%
gnomAD_E_AFR: 0.0458%
gnomAD_E_NFE: 0.0009%
gnomAD_G_AFR: 0.0574%

About

The Exomizer is a Java program that functionally annotates variants from whole-exome sequencing data starting from a VCF file (version 4). The functional annotation code is based on Jannovar and uses UCSC KnownGene transcript definitions and hg19 genomic coordinates

Variants are prioritized according to user-defined criteria on variant frequency, pathogenicity, quality, inheritance pattern, and model organism phenotype data. Predicted pathogenicity data was extracted from the dbNSFP resource.

Developed by the Computational Biology and Bioinformatics group at the Institute for Medical Genetics and Human Genetics of the Charité - Universitätsmedizin Berlin, the Mouse Informatics Group at the Sanger Institute and the Smedley group at Queen Mary University of London.

Problems, suggestions, or comments? Please let us know